The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027352	Escherichia coli strain 2012C-4606 chromosome, complete genome	5647195	1988	78535	5647195	holin,capsid,terminase,portal,protease,transposase,head,tail,lysis	Enterobacteria_phage(52.0%)	95	NA	NA
WP_106875242.1|1988_2207_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	93.8	3.7e-27
WP_000138558.1|2455_2728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|2887_3421_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3641_3755_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3976_4162_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|4688_5003_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|5084_5309_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000453587.1|5705_6251_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027379.1|6225_8151_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|8147_8354_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001415980.1|8350_9952_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.3e-307
WP_000123251.1|9932_11252_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001365129.1|11261_11594_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|11649_12675_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|12716_13112_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|13123_13477_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_137414698.1|14356_14449_+	hypothetical protein	NA	K7PJT1	Enterobacteria_phage	83.3	1.0e-07
WP_106875216.1|14456_15209_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	1.1e-134
WP_000479045.1|15222_15645_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|15671_16085_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_106875217.1|16065_18678_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.1	0.0e+00
WP_000847298.1|18674_19004_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001357740.1|19003_19702_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000194802.1|19712_20456_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	2.4e-150
WP_133253573.1|20401_21034_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	95.2	3.1e-106
WP_000515131.1|21279_24756_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.9	0.0e+00
WP_001456919.1|24824_25448_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	5.1e-69
WP_000279009.1|25512_26826_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_001023433.1|26827_27097_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	6.4e-45
WP_122988840.1|27207_27285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993102.1|27499_28513_+	peptidase M85	NA	NA	NA	NA	NA
WP_016241229.1|28883_29198_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_085948186.1|29633_30789_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000877010.1|30786_31851_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	60.1	8.6e-117
WP_001339397.1|32105_32783_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|32782_33130_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|33149_34721_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000048369.1|34916_37388_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083280.1|37481_37673_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|37669_37858_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000347171.1|38344_38920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|38921_39077_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001003381.1|39269_39677_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|39754_39982_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|39965_40487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054507.1|40467_41433_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.3	6.5e-55
WP_001151195.1|41473_41893_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.3e-55
WP_000589012.1|41926_43267_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001317460.1|43703_44036_-	protein flxA	NA	NA	NA	NA	NA
WP_001326990.1|44238_44544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|44568_44808_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|44807_45095_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|45166_45322_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|45538_45790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|45856_46135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|46136_47186_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_001047133.1|47199_47952_+	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	1.3e-130
WP_120795389.1|48229_48319_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_106875218.1|48373_48586_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066483.1|48886_49102_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	4.5e-25
WP_000839590.1|49855_50071_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189915.1|50075_50387_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|50383_50917_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|50913_51411_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|51773_51986_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|51996_52185_+	cold-shock protein	NA	NA	NA	NA	NA
WP_122134696.1|52187_52253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|52332_52488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|52659_52833_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000035577.1|52984_53395_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001031435.1|53695_53902_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	3.9e-26
WP_000421825.1|54462_55002_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_000507036.1|55010_57110_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.6	0.0e+00
WP_001072975.1|57106_57319_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985929.1|57318_58827_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	4.5e-289
WP_001136588.1|58771_60799_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097041.1|60885_61209_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	98.1	5.5e-51
WP_001283148.1|61201_61477_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
WP_000677128.1|61488_62067_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	98.4	3.0e-100
WP_001079398.1|62063_62465_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211132.1|62475_63219_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001341514.1|63279_63666_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_001161009.1|63674_64004_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372024.1|63975_67041_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447251.1|67040_67370_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.0e-60
WP_001152371.1|67379_68078_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	1.9e-133
WP_000140707.1|68082_68826_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.9	1.8e-145
WP_000741589.1|68723_69371_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_000515505.1|69431_72845_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_001233114.1|72915_73515_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	2.5e-105
WP_001448491.1|73579_76540_+	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	54.1	4.0e-55
WP_000885616.1|76539_77115_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086514.1|77212_77803_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000836768.1|78119_78353_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|78421_78535_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
>prophage 2
NZ_CP027352	Escherichia coli strain 2012C-4606 chromosome, complete genome	5647195	279893	336083	5647195	holin,capsid,terminase,portal,integrase,transposase,tRNA,head,tail,lysis	Escherichia_phage(43.28%)	69	320948:320963	336435:336450
WP_000837943.1|279893_281027_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	4.1e-117
WP_001295593.1|281167_281602_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|282542_283184_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|283265_283895_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131657.1|283967_284543_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	1.8e-89
WP_001023379.1|284655_284925_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_000268927.1|284926_286240_-|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.3	2.8e-77
WP_001233130.1|286304_286904_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	97.5	1.8e-108
WP_106875219.1|286971_290448_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.6	0.0e+00
WP_122993493.1|290693_291326_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	7.1e-103
WP_001429308.1|291271_292015_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_106873516.1|292025_292724_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	5.8e-130
WP_000847304.1|292723_293053_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082321.1|293049_295629_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.2	0.0e+00
WP_000533431.1|295609_296023_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|296049_296481_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000235067.1|296494_297247_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683137.1|297254_297650_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000975098.1|297646_298225_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
WP_000752994.1|298236_298590_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|298601_298997_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|299038_300064_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|300119_300452_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123251.1|300461_301781_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001415980.1|301761_303363_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.3e-307
WP_000198153.1|303359_303566_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027379.1|303562_305488_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453587.1|305462_306008_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001307652.1|306396_306591_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881326.1|306778_307396_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092325.1|307545_307983_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000075132.1|307979_308477_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|308476_308683_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000143049.1|309130_310981_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000762928.1|312150_312972_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217413.1|312968_313343_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_001265080.1|313355_314405_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	3.4e-110
WP_001341382.1|314406_314685_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_000018421.1|314852_315065_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001278454.1|315254_315359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207986.1|315474_316344_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_000224233.1|316354_316618_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_042350895.1|316619_316784_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000935420.1|316869_317082_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000403777.1|317132_317489_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_001209480.1|317466_317928_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266134.1|317924_318221_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001151124.1|318217_318640_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.0e-64
WP_000450672.1|318655_319417_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	89.7	3.8e-119
WP_000788968.1|319439_320186_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_085947969.1|320614_321827_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
320948:320963	attL	TGCTGGATAAGCTGCG	NA	NA	NA	NA
WP_001432368.1|321830_322310_-	YdaU family protein	NA	A0A0U2RT81	Escherichia_phage	82.4	3.2e-63
WP_000693802.1|322373_322796_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
WP_001072343.1|322792_323047_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233320.1|323126_323546_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001427316.1|323844_323997_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_000560223.1|324417_324639_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|324638_324809_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|324883_325159_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105151.1|325260_327861_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.2	2.6e-247
WP_000166313.1|327853_328663_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|328718_328868_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|328905_329094_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|329193_329409_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040851.1|329410_330646_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	3.0e-238
WP_001157407.1|330697_331633_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123745.1|331761_333135_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|333612_334596_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|334850_336083_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
336435:336450	attR	CGCAGCTTATCCAGCA	NA	NA	NA	NA
>prophage 3
NZ_CP027352	Escherichia coli strain 2012C-4606 chromosome, complete genome	5647195	439033	452437	5647195	holin,transposase,tail	Escherichia_phage(38.46%)	16	NA	NA
WP_001023357.1|439033_439303_-|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_085948186.1|439405_440562_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001056807.1|440618_441137_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	1.0e-94
WP_000992088.1|441407_441941_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_000731221.1|441991_442336_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|442340_442556_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000023141.1|442705_444559_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
WP_001059384.1|446083_446773_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000140002.1|446769_447135_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001265290.1|447135_448191_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	4.9e-88
WP_010917803.1|448192_448471_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|448540_448798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|449018_449231_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001449026.1|449509_450268_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|450966_451131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157825328.1|451894_452437_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
>prophage 4
NZ_CP027352	Escherichia coli strain 2012C-4606 chromosome, complete genome	5647195	565108	692130	5647195	holin,capsid,terminase,protease,integrase,transposase,tRNA,head,tail	Escherichia_phage(27.18%)	153	592766:592782	684690:684706
WP_001297484.1|565108_566215_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|566250_566892_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|566895_568266_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|568433_569105_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|569104_570565_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|571166_571448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001432354.1|571703_572246_-|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	5.1e-33
WP_000224599.1|572450_572864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380886.1|572876_573212_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907455.1|573224_574280_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.7	3.5e-70
WP_000796958.1|574279_574486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132079.1|574737_574962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233304.1|575088_575361_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126687.1|575371_575782_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000192401.1|575778_576030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833619.1|576230_577631_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	1.2e-115
WP_000770175.1|577627_577927_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001204981.1|577932_578166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000336167.1|578158_578623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012816761.1|578612_579641_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000953272.1|579698_579887_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085258.1|580252_581482_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	8.4e-132
WP_000456506.1|581730_582852_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359438.1|582997_584227_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|584476_585613_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000799399.1|585596_586460_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001132165.1|586733_587324_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_001144080.1|587506_588157_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001299273.1|588231_589290_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_012816780.1|589417_590053_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001118085.1|590120_590702_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_001131642.1|590992_591568_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023435.1|591681_591951_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	2.4e-44
WP_044723507.1|591952_593266_-|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	98.2	2.8e-77
592766:592782	attL	GGCTGCACTTTCTGCCG	NA	NA	NA	NA
WP_001216290.1|593331_593955_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_106875220.1|594023_597500_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.6	0.0e+00
WP_122993493.1|597745_598378_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	7.1e-103
WP_001429308.1|598323_599067_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_001335877.1|599077_599776_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000807940.1|599775_600117_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_000212983.1|600109_603352_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.6	0.0e+00
WP_001513217.1|603399_603609_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030060.1|603704_604079_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275459.1|604084_604801_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	9.5e-128
WP_000133388.1|604866_605211_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|605207_605654_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007892.1|605650_606001_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	3.5e-59
WP_000125984.1|606011_606338_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|608864_609086_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_001341975.1|611130_612792_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
WP_000958402.1|612788_613352_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_001303046.1|613640_614006_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000095749.1|614047_614275_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_012816791.1|614699_614885_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|615112_615259_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|615258_615828_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_001092890.1|616098_616632_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	100.0	1.6e-103
WP_000731236.1|616682_617027_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000284518.1|617031_617247_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001290217.1|617323_617596_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000143462.1|617636_617816_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_000142998.1|617951_619889_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	100.0	0.0e+00
WP_000752026.1|620388_620658_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|620667_621615_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_106875221.1|622121_622313_-	Q protein	NA	Q777W5	Enterobacteria_phage	93.7	4.3e-27
WP_085948186.1|622340_623497_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000144759.1|623815_624010_-	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001107963.1|624006_624612_-	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_001004024.1|624611_625334_-	DNA-binding protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_000211422.1|625408_626143_-	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001254256.1|626417_626600_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153280.1|626596_627124_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|627120_627567_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|627523_627760_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|627770_627986_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|628118_628397_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000145907.1|628467_628758_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	99.0	1.6e-46
WP_000788927.1|628754_629456_-	Replication protein P	NA	C1JJ58	Enterobacteria_phage	99.6	1.3e-129
WP_000185454.1|629452_630391_-	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000438542.1|630423_630720_-	hypothetical protein	NA	Q6H9X8	Enterobacteria_phage	100.0	5.2e-48
WP_000064148.1|630858_631092_-	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_000428098.1|631205_631910_+	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000866443.1|632046_632334_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	100.0	1.6e-49
WP_001082382.1|632330_632987_+	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	100.0	2.6e-116
WP_000687675.1|632983_633388_+	hypothetical protein	NA	A0A0P0ZDD3	Stx2-converting_phage	100.0	1.6e-68
WP_000198444.1|633895_634279_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167595.1|634337_634808_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_001198866.1|635001_635142_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q9AZ26	Salmonella_phage	100.0	3.3e-21
WP_000361831.1|635134_635248_+	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	100.0	2.7e-13
WP_000613346.1|635244_635433_+	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
WP_000536228.1|635441_636122_+	AAA family ATPase	NA	G9L667	Escherichia_phage	100.0	3.4e-127
WP_000073098.1|636118_636706_+	hypothetical protein	NA	G9L666	Escherichia_phage	99.5	4.9e-106
WP_001111290.1|636729_637026_+	DUF2856 family protein	NA	G9L665	Escherichia_phage	98.0	2.3e-48
WP_001214439.1|637036_637201_+	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	9.3e-23
WP_000812200.1|637197_637827_+	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	73.9	3.1e-58
WP_000034212.1|637823_638231_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_001014298.1|638232_638424_+	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000206782.1|638426_638885_+	hypothetical protein	NA	V5UT79	Shigella_phage	54.5	7.1e-20
WP_000224734.1|638890_639088_+	hypothetical protein	NA	A0A222YWL3	Escherichia_phage	93.4	3.2e-25
WP_000628762.1|639601_640513_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	94.4	3.6e-164
WP_042357761.1|640445_640661_+	DUF1382 family protein	NA	G3CFH1	Escherichia_phage	100.0	6.7e-29
WP_000994787.1|640696_641059_+	DUF1627 domain-containing protein	NA	A0A0P0ZH73	Escherichia_phage	96.7	1.7e-56
WP_021351637.1|641202_641436_+	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
WP_000497812.1|641423_641675_+	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_001208773.1|641720_642005_+	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000013656.1|642057_643368_+|integrase	site-specific integrase	integrase	A0A0P0ZGA8	Escherichia_phage	99.5	6.0e-253
WP_000607021.1|643364_643943_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|643963_644191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044313.1|644228_645470_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000097601.1|645761_647021_-	YccE family protein	NA	NA	NA	NA	NA
WP_000420629.1|647280_648201_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
WP_000024561.1|648200_648506_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209869.1|648598_649198_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062101.1|649194_651741_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_001230242.1|651740_652913_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|653042_653735_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264955.1|653707_654736_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001444338.1|654818_657563_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_000818472.1|657634_658708_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|658755_658929_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001316982.1|658918_659149_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|659123_659312_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|659322_659535_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|659820_660033_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001295358.1|660474_660780_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001247610.1|660886_661531_+	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001038062.1|661527_662274_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742348.1|662273_664370_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|664415_665555_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|665542_665989_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208650.1|666008_668189_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001300464.1|668303_669602_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000270305.1|669681_669774_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460810.1|669786_670923_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_071527988.1|670934_672431_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004899.1|672613_673471_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063971.1|673467_673866_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003671.1|673862_674450_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186421.1|674446_675154_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|675172_676966_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|676962_678081_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_095585410.1|678676_678829_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
WP_000938122.1|679205_680567_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	39.8	4.4e-49
WP_001023483.1|681021_681291_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
WP_000381371.1|681328_682900_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.4e-168
WP_000624622.1|682919_683267_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|683266_683944_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000279108.1|683999_685313_-|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	96.3	1.2e-72
684690:684706	attR	GGCTGCACTTTCTGCCG	NA	NA	NA	NA
WP_001230532.1|685377_685977_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
WP_122993493.1|689761_690394_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	7.1e-103
WP_159032311.1|690850_690973_-|tail	phage tail protein	tail	Q687F0	Enterobacteria_phage	88.9	3.1e-07
WP_001335877.1|691090_691789_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000807940.1|691788_692130_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
>prophage 5
NZ_CP027352	Escherichia coli strain 2012C-4606 chromosome, complete genome	5647195	695411	730352	5647195	holin,terminase,integrase,transposase,head,tail	Escherichia_phage(35.14%)	47	728220:728234	735568:735582
WP_001513217.1|695411_695621_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030060.1|695716_696091_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275459.1|696096_696813_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	9.5e-128
WP_000133388.1|696878_697223_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|697219_697666_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007892.1|697662_698013_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	3.5e-59
WP_000125984.1|698023_698350_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|700876_701098_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_001341975.1|703142_704804_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
WP_000958402.1|704800_705364_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_001303046.1|705652_706018_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_001341372.1|706059_706245_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	88.5	6.4e-20
WP_000347013.1|706374_706515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|706871_707096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|707160_707367_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_001003112.1|708013_708547_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_000138558.1|708706_708979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411804.1|709234_709441_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_000143031.1|709731_711582_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000466957.1|712152_712584_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000611213.1|713055_714105_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	88.5	4.0e-183
WP_000917767.1|714255_714453_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000640023.1|714765_715308_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.3	1.4e-67
WP_000140011.1|715316_715682_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	6.7e-37
WP_001265089.1|715682_716738_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	1.5e-89
WP_001341382.1|716739_717018_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_000902687.1|717185_717398_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|717584_717689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137957.1|717798_718362_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	93.9	2.9e-47
WP_001273106.1|718488_718800_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001375713.1|718796_718949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|718981_719338_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|719334_719559_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450612.1|719580_720279_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.1	4.7e-71
WP_000373320.1|720313_720736_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_001262408.1|720767_721805_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	67.1	1.7e-85
WP_000693816.1|721873_722299_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|722295_722523_-	cell division protein	NA	NA	NA	NA	NA
WP_000444615.1|722620_723265_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|723540_723693_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_085948186.1|723939_725096_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000449192.1|725449_725638_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|725634_725826_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048520.1|725918_728390_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
728220:728234	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000003742.1|728451_728721_+	excisionase	NA	NA	NA	NA	NA
WP_000074974.1|728689_729808_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	2.6e-84
WP_001113310.1|729884_730352_-	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
735568:735582	attR	GCGTACATCGCGATC	NA	NA	NA	NA
>prophage 6
NZ_CP027352	Escherichia coli strain 2012C-4606 chromosome, complete genome	5647195	873995	1067696	5647195	holin,capsid,terminase,portal,protease,integrase,transposase,head,tail	Escherichia_phage(29.1%)	219	929017:929033	1075824:1075840
WP_001182418.1|873995_875075_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|875074_876031_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506898.1|876041_877250_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|877267_877735_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|877995_878325_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957249.1|878311_878692_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|879595_881209_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|881239_881590_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|881586_882012_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000397130.1|884199_884871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135715.1|885741_885882_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000803992.1|886183_886447_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001021388.1|887656_888274_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001142971.1|888285_888960_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966485.1|888960_889425_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000467898.1|889434_891105_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_000612148.1|891130_891451_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|891459_891762_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_000886249.1|891771_892551_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000134927.1|892931_893207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000591994.1|893431_895051_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|895143_895503_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_001304211.1|896188_896479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303891.1|896502_896754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028913479.1|896801_897407_-	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_001171554.1|898798_899179_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|899175_899523_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998025.1|899572_901105_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	7.1e-298
WP_000282084.1|904377_904941_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335696.1|905761_907195_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|907413_907611_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|907837_908134_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000279869.1|911248_912451_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_001297190.1|913075_913531_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001307105.1|914342_915266_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
WP_001199164.1|915749_917021_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154411.1|917026_918154_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497942.1|918211_919042_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_001018496.1|919707_921216_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000979516.1|921374_921584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001341463.1|921638_925601_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000191700.1|925640_926279_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001297176.1|926566_927658_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001307708.1|927657_928350_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126777.1|928361_928748_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001341462.1|928755_929556_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
929017:929033	attL	GCGCTCGGTGCGCTGGT	NA	NA	NA	NA
WP_001001171.1|929565_930156_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028095.1|930166_930661_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001240628.1|930681_932010_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
WP_001273658.1|932092_932266_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_122988840.1|933633_933711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023986.1|933821_934091_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	96.6	4.2e-44
WP_001230400.1|935469_936069_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	1.3e-109
WP_032363152.1|936135_939612_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.3	0.0e+00
WP_064721023.1|939857_940490_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	2.6e-105
WP_001375566.1|940435_941173_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.8	7.2e-147
WP_001432327.1|941227_942151_-	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	98.0	6.6e-174
WP_001154345.1|942221_942395_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|942502_942823_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001448747.1|942839_943538_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	99.1	1.6e-132
WP_000807964.1|943537_943879_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212962.1|943871_947114_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.2	0.0e+00
WP_001513217.1|947161_947371_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030063.1|947466_947841_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275459.1|947846_948563_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	9.5e-128
WP_000133388.1|948628_948973_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|948969_949416_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007892.1|949412_949763_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	3.5e-59
WP_000125984.1|949773_950100_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|952626_952848_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173071.1|952892_954830_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.7	0.0e+00
WP_001399867.1|954893_956555_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_000958380.1|956551_957115_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000279807.1|957404_957770_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	5.4e-63
WP_001448509.1|957811_958036_+	YlcI/YnfO family protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_001302717.1|958117_958432_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|958957_959143_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000455402.1|959370_959520_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_001056882.1|959519_960089_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	98.9	3.4e-104
WP_000087714.1|960363_960897_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001072901.1|960901_961117_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|961194_961440_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143463.1|961480_961660_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_032361126.1|961795_963733_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	97.1	0.0e+00
WP_000466957.1|964210_964642_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000301785.1|965091_965805_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917770.1|965939_966137_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640048.1|966378_966909_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904103.1|966917_967277_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_001265113.1|967289_968336_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_001342259.1|968337_968610_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_001260977.1|968745_969003_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_000220601.1|969008_969308_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_000206830.1|969512_969857_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	1.7e-58
WP_001229296.1|969853_970219_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000209152.1|970220_970439_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
WP_001289353.1|970526_971162_-	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_001224662.1|971327_971510_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000935422.1|971543_971756_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_000403783.1|971806_972163_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_001209480.1|972140_972602_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266133.1|972598_972895_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_001040234.1|972891_973284_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
WP_000450641.1|973299_974025_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.2e-77
WP_072096947.1|974058_974601_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	1.8e-78
WP_000729535.1|974512_975523_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.8	4.9e-170
WP_000693932.1|975609_976047_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
WP_001172789.1|976043_976304_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
WP_000578360.1|976430_976823_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_001022415.1|976869_977229_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
WP_000692026.1|977231_977534_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_024182289.1|977947_978148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171921.1|978240_978459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|978462_978627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|979027_979216_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|979212_979401_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048500.1|979495_981946_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000273151.1|982013_982256_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001232849.1|982350_982611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947969.1|982650_983864_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
WP_077630526.1|983939_984566_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	55.0	8.2e-59
WP_012817749.1|985368_986121_+	type III effector	NA	NA	NA	NA	NA
WP_001023445.1|986245_986515_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_000268933.1|986516_987830_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	4.8e-77
WP_106875243.1|987894_988518_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	2.3e-69
WP_106875222.1|988586_992063_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.9	0.0e+00
WP_159032312.1|992308_992941_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.8	1.4e-103
WP_000194707.1|992886_993630_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.2	1.2e-149
WP_001443841.1|993640_994339_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	97.4	4.4e-130
WP_000847298.1|994338_994668_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000533442.1|997256_997670_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|997696_998119_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235067.1|998132_998885_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683137.1|998892_999288_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000752994.1|999873_1000227_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|1000238_1000634_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|1000675_1001701_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|1001756_1002089_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123251.1|1002098_1003418_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001301524.1|1003398_1005000_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|1004996_1005203_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|1005199_1007125_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|1007099_1007645_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001431375.1|1008031_1008256_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	5.9e-20
WP_001303878.1|1008337_1008652_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|1009179_1009365_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000992045.1|1009916_1010450_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.6	8.1e-100
WP_001041949.1|1010961_1011753_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000411809.1|1011756_1011963_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000023191.1|1012410_1014261_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001299632.1|1014739_1015171_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	98.6	7.8e-69
WP_000498121.1|1015360_1015570_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.5e-20
WP_000735807.1|1015622_1015847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047111.1|1016691_1017444_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	2.6e-136
WP_001375683.1|1017457_1018507_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	4.6e-115
WP_012817785.1|1018508_1018778_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	3.0e-10
WP_001452497.1|1018831_1019059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217944.1|1019282_1019654_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000042395.1|1019646_1019964_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000882662.1|1020066_1020279_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000211993.1|1020493_1021045_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000215512.1|1021396_1021582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450895.1|1021641_1022403_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	63.6	2.4e-73
WP_000790460.1|1022432_1023173_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	4.7e-114
WP_000054520.1|1023179_1024145_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
WP_000705368.1|1024125_1024647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920571.1|1024630_1024861_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000379972.1|1024944_1025352_+	helix-turn-helix domain-containing protein	NA	B1B6L9	Salmonella_phage	58.7	3.1e-14
WP_000380321.1|1025518_1025671_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.9e-06
WP_000394548.1|1025682_1026321_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|1026321_1026531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|1027095_1027284_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|1027280_1027469_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102117.1|1027561_1030024_+	exonuclease	NA	V5UQJ3	Shigella_phage	47.7	4.0e-125
WP_001368608.1|1030111_1030348_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001206147.1|1030367_1031663_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.2	1.3e-154
WP_072095801.1|1031682_1031793_-	transporter	NA	NA	NA	NA	NA
WP_000836079.1|1031850_1032870_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|1032881_1034096_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1034301_1034628_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1034762_1035104_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138576.1|1035138_1035699_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1035701_1036412_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|1036519_1036825_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001342196.1|1039509_1041933_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000213028.1|1041943_1042561_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|1042562_1043417_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1043459_1044074_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_001315626.1|1044232_1045525_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919226.1|1045477_1046173_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225276.1|1046297_1047518_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001019545.1|1047652_1048546_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|1048652_1049906_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743951.1|1050302_1050638_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233090.1|1050730_1050814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260840.1|1050913_1051735_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000046661.1|1051773_1052103_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000276149.1|1052089_1052455_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001303517.1|1052561_1052732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000133423.1|1053768_1054050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127891.1|1054063_1055725_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	2.0e-277
WP_000113645.1|1055708_1056065_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001145905.1|1056353_1056794_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000134113.1|1056793_1057090_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020674.1|1057086_1057425_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
WP_001398592.1|1057421_1058597_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	4.8e-185
WP_000504055.1|1058634_1059207_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	4.7e-61
WP_001137345.1|1059246_1060404_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_001132080.1|1060695_1060920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233310.1|1061045_1061318_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126691.1|1061328_1061739_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000125509.1|1061735_1061981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000710169.1|1062268_1064086_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	48.3	7.5e-129
WP_001261490.1|1064082_1064382_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001113154.1|1064388_1064709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024184083.1|1064701_1064992_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001496008.1|1064924_1065851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012817788.1|1065903_1066092_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	62.3	3.8e-12
WP_000085277.1|1066466_1067696_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.4	1.6e-130
1075824:1075840	attR	ACCAGCGCACCGAGCGC	NA	NA	NA	NA
>prophage 7
NZ_CP027352	Escherichia coli strain 2012C-4606 chromosome, complete genome	5647195	1186455	1231315	5647195	holin,capsid,terminase,portal,plate,integrase,tRNA,head,tail	Enterobacteria_phage(86.36%)	57	1188858:1188882	1223956:1223980
WP_000029479.1|1186455_1187205_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	1.6e-08
WP_001154187.1|1187204_1187756_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956529.1|1187818_1188799_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
1188858:1188882	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_005142454.1|1188991_1189429_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
WP_000403440.1|1189529_1190030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247212.1|1190032_1190971_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	5.1e-81
WP_000021112.1|1191059_1191371_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	49.5	8.3e-20
WP_001151412.1|1191466_1191745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917795.1|1191759_1192098_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	86.2	8.9e-52
WP_044711780.1|1192108_1192396_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	2.3e-32
WP_000514277.1|1192407_1192650_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021668.1|1192646_1192760_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.2e-08
WP_000985159.1|1192846_1193050_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000153690.1|1193046_1193292_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	86.4	1.0e-33
WP_000599382.1|1193433_1193799_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_136748941.1|1193805_1196628_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.2	0.0e+00
WP_000686521.1|1196704_1197664_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.9e-180
WP_000211274.1|1197668_1197980_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	94.2	1.0e-46
WP_001080493.1|1198078_1198486_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	91.7	4.0e-22
WP_000236497.1|1199045_1199570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087814.1|1199584_1200631_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000613766.1|1200630_1202382_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	99.5	0.0e+00
WP_001262673.1|1202536_1203373_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_106875224.1|1203395_1204448_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	98.3	5.4e-196
WP_000632311.1|1204493_1205294_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	1.5e-126
WP_000063100.1|1205395_1205890_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864911.1|1205889_1206090_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
WP_000104350.1|1206092_1206416_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|1206412_1206805_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780572.1|1206801_1207209_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000920603.1|1207346_1207814_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.7	2.9e-85
WP_000356339.1|1207806_1208442_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001271894.1|1208438_1209020_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.0e-100
WP_000213447.1|1209016_1209367_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111942.1|1209370_1210267_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
WP_000071739.1|1210259_1210790_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_106875225.1|1210792_1212925_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.7	4.2e-131
WP_000144023.1|1212924_1213503_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	5.9e-96
WP_000954196.1|1213546_1214119_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979950.1|1214275_1214764_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.1	7.5e-84
WP_000853434.1|1214776_1217584_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.9	0.0e+00
WP_000333503.1|1217570_1217726_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|1217734_1218109_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000290462.1|1218164_1218677_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005384.1|1218676_1219861_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	4.7e-225
WP_106875226.1|1220018_1221128_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	5.7e-204
WP_106875227.1|1221353_1222856_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000488103.1|1223099_1223360_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078923.1|1223550_1223691_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
WP_001229265.1|1223997_1224297_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
1223956:1223980	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000672359.1|1224301_1226689_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|1226703_1227687_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|1227970_1228015_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|1228137_1228494_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|1228546_1228744_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|1228840_1229383_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|1229386_1231315_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 8
NZ_CP027352	Escherichia coli strain 2012C-4606 chromosome, complete genome	5647195	1300438	1396694	5647195	holin,capsid,terminase,portal,protease,integrase,transposase,tRNA,head,tail,lysis	Escherichia_phage(28.79%)	110	1340002:1340016	1398141:1398155
WP_085948186.1|1300438_1301594_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000604932.1|1301711_1302143_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	4.8e-42
WP_000513743.1|1302158_1302347_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_000939317.1|1302350_1302710_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457202.1|1302882_1303521_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_001061578.1|1303647_1304571_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000978494.1|1304673_1305759_+	multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase	NA	NA	NA	NA	NA
WP_000987525.1|1306009_1307620_+	BCCT family transporter YeaV	NA	NA	NA	NA	NA
WP_032341932.1|1307651_1308776_+	carnitine monooxygenase subunit YeaW	NA	NA	NA	NA	NA
WP_001287005.1|1308831_1309797_+	carnitine monooxygenase subunit YeaX	NA	NA	NA	NA	NA
WP_001342154.1|1309850_1310966_-	ribonuclease D	NA	NA	NA	NA	NA
WP_000758422.1|1311047_1312733_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|1312937_1313519_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001221003.1|1313558_1314254_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|1314311_1316222_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|1316353_1316698_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|1317060_1317420_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|1317539_1317719_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854972.1|1317792_1319154_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000456725.1|1319157_1319736_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624298.1|1319919_1321284_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001295494.1|1321414_1323013_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000394983.1|1323016_1324573_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_000150551.1|1325035_1326007_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406926.1|1326069_1326870_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000228655.1|1326882_1327734_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156255.1|1327788_1328247_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001296134.1|1328675_1329242_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010107.1|1329238_1330048_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001062678.1|1330213_1330423_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001295496.1|1330435_1330579_-	YobF family protein	NA	NA	NA	NA	NA
WP_001006866.1|1331247_1331535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|1331609_1331753_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001211011.1|1331911_1332151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262174.1|1332293_1333085_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001127210.1|1333261_1334635_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984517.1|1334680_1335562_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001431407.1|1335753_1337802_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.4e-86
WP_000431370.1|1337821_1338520_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|1338616_1339114_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207284.1|1339243_1340527_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
1340002:1340016	attL	CCCGCTACGCCTGCG	NA	NA	NA	NA
WP_001299674.1|1340495_1343129_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057024.1|1343208_1344648_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|1344765_1345002_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|1345106_1345298_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812724.1|1345298_1345955_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_001121225.1|1346909_1347560_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491545.1|1347784_1348660_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
WP_001023379.1|1348800_1349070_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_000268926.1|1349071_1350385_-|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.3	2.8e-77
WP_001230428.1|1350449_1351049_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_000099160.1|1351104_1352643_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|1352691_1353039_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839165.1|1353035_1353440_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.5e-69
WP_000514713.1|1353578_1356974_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	83.6	0.0e+00
WP_050439450.1|1357316_1357949_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194723.1|1357894_1358638_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_001357740.1|1358648_1359347_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847298.1|1359346_1359676_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081762.1|1359672_1362285_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	91.9	0.0e+00
WP_000533440.1|1362265_1362679_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|1362705_1363128_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_106875229.1|1363141_1363879_-	hypothetical protein	NA	Q687F6	Enterobacteria_phage	98.7	4.2e-70
WP_000752994.1|1363890_1364244_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|1364255_1364651_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|1364692_1365718_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|1365773_1366106_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123251.1|1366115_1367435_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001443752.1|1367415_1369017_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000198153.1|1369013_1369220_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027379.1|1369216_1371142_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453587.1|1371116_1371662_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001307652.1|1372050_1372245_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881326.1|1372432_1373050_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092325.1|1373199_1373637_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000075132.1|1373633_1374131_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|1374130_1374337_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000143049.1|1374784_1376635_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000762928.1|1377805_1378627_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217413.1|1378623_1378998_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_001265229.1|1379010_1380060_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|1380061_1380334_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|1380455_1380800_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|1380919_1381132_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|1381365_1381923_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|1381924_1382143_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|1382270_1382582_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|1382574_1382802_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|1382798_1383080_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450872.1|1383112_1383874_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.2	3.9e-79
WP_001444941.1|1384647_1385610_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.5	2.7e-69
WP_000693943.1|1385632_1386058_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|1386054_1386357_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_001169687.1|1386454_1386826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302048.1|1386846_1387038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001448501.1|1387039_1387318_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001427316.1|1387604_1387757_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_000560218.1|1388177_1388399_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
WP_001427414.1|1388398_1388569_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_001307773.1|1388642_1388918_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	3.0e-42
WP_000105101.1|1389016_1391668_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.6	0.0e+00
WP_000166317.1|1391660_1392470_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_042853000.1|1392526_1392721_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_001356607.1|1392713_1392902_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_001443927.1|1393008_1393290_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001189089.1|1393255_1394371_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.8	4.6e-97
WP_000976492.1|1394723_1395065_-	YebY family protein	NA	NA	NA	NA	NA
WP_032341845.1|1395077_1395947_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|1395950_1396325_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1396463_1396694_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
1398141:1398155	attR	CGCAGGCGTAGCGGG	NA	NA	NA	NA
>prophage 9
NZ_CP027352	Escherichia coli strain 2012C-4606 chromosome, complete genome	5647195	1638231	1644533	5647195		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001100797.1|1638231_1638774_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	1.9e-51
WP_000857547.1|1638778_1639657_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.5e-106
WP_001023633.1|1639714_1640614_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	5.7e-29
WP_000699427.1|1640613_1641699_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	1.4e-101
WP_000183038.1|1642070_1642964_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_001116073.1|1643138_1644533_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	2.2e-19
>prophage 10
NZ_CP027352	Escherichia coli strain 2012C-4606 chromosome, complete genome	5647195	1735974	1745902	5647195	transposase	Enterobacteria_phage(62.5%)	9	NA	NA
WP_001292774.1|1735974_1737111_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001342301.1|1737107_1739108_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001171523.1|1739439_1739820_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1739816_1740164_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998019.1|1740213_1741599_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000950404.1|1742030_1742501_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_000598641.1|1742547_1743267_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1743263_1744949_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|1745170_1745902_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
>prophage 11
NZ_CP027352	Escherichia coli strain 2012C-4606 chromosome, complete genome	5647195	1816729	1918910	5647195	holin,terminase,portal,protease,integrase,transposase,head,tail,lysis	Enterobacteria_phage(37.04%)	117	1853878:1853896	1928126:1928144
WP_000101718.1|1816729_1817971_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.2e-98
WP_000387479.1|1818467_1818674_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001443784.1|1819357_1819918_+	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	45.5	9.0e-17
WP_001342316.1|1819907_1820150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204070.1|1820122_1820344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204970.1|1820345_1820579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|1820584_1820884_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833625.1|1820880_1822281_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
WP_001080641.1|1822482_1822728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391151.1|1822858_1823053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018604.1|1823056_1823218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229487.1|1823344_1823833_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	4.6e-25
WP_000624042.1|1823995_1824919_+	hypothetical protein	NA	A0A0R6PHC6	Moraxella_phage	24.9	6.9e-14
WP_001113637.1|1828297_1828945_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001211567.1|1828979_1830032_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_000824439.1|1830028_1830586_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_032344719.1|1830582_1832526_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_001026418.1|1832522_1833002_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000186540.1|1832998_1833208_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001295447.1|1833204_1833942_-	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000971723.1|1833983_1834646_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000888560.1|1834642_1835260_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000528376.1|1835278_1835881_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000835177.1|1835890_1836340_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000013509.1|1836336_1837200_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091291.1|1837186_1837882_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000778069.1|1837888_1840375_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000557378.1|1840371_1840635_-	chaperone NapD	NA	NA	NA	NA	NA
WP_000686723.1|1840624_1841119_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000849214.1|1841527_1842016_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000758074.1|1842164_1843811_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000422231.1|1844028_1845672_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|1845747_1846398_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786386.1|1846397_1847462_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|1847535_1848591_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|1848702_1849794_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_001249127.1|1850532_1853205_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061917.1|1853221_1853872_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
1853878:1853896	attL	TGTAGGCCAGATAAGACGC	NA	NA	NA	NA
WP_000876007.1|1853957_1856807_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.0	1.7e-42
WP_001225855.1|1857081_1857858_-	YfaP family protein	NA	NA	NA	NA	NA
WP_001104541.1|1857862_1859512_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_001676637.1|1859512_1863907_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001025664.1|1864708_1866031_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.7	2.5e-227
WP_001448330.1|1866724_1867372_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.3	2.4e-37
WP_001023380.1|1867581_1867851_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	7.3e-41
WP_000279018.1|1867852_1869166_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	2.8e-77
WP_001228241.1|1869230_1869830_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_001230644.1|1869897_1870113_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	95.8	2.9e-32
WP_000099160.1|1870175_1871714_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|1871762_1872110_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839165.1|1872106_1872511_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.5e-69
WP_001375477.1|1872539_1875839_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	95.2	0.0e+00
WP_000090884.1|1875899_1876532_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_012817801.1|1876468_1877212_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	5.2e-145
WP_001152619.1|1877217_1877916_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000847413.1|1877915_1878245_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
WP_000082375.1|1878241_1880803_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.0	0.0e+00
WP_000533403.1|1880783_1881197_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479086.1|1881223_1881655_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_001143013.1|1881668_1882421_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000683071.1|1882428_1882824_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_000975037.1|1882820_1883396_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_001204544.1|1883410_1883764_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201528.1|1883756_1884131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522643.1|1884182_1885067_-	hypothetical protein	NA	C6ZCY2	Enterobacteria_phage	54.1	6.5e-94
WP_000256849.1|1885124_1885472_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
WP_001254039.1|1885508_1887014_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000827572.1|1887003_1888596_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	8.4e-185
WP_000258991.1|1888592_1888799_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_001238637.1|1888782_1888989_-|terminase	terminase	terminase	A0A2I6TC92	Escherichia_phage	59.4	1.1e-12
WP_024262528.1|1889001_1890711_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.3	4.9e-239
WP_000235436.1|1890682_1891192_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001427981.1|1891586_1891781_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000738423.1|1892140_1892434_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|1892524_1892707_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000075153.1|1892923_1893421_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	96.4	1.6e-89
WP_000284524.1|1893420_1893636_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|1893778_1894177_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|1894257_1894416_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|1894501_1895245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235460.1|1895497_1896121_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001028854.1|1896117_1896783_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223927.1|1896779_1897382_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001108084.1|1897356_1897923_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001429269.1|1898446_1900282_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
WP_001254228.1|1900785_1900968_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_000153270.1|1900964_1901492_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_000810176.1|1901488_1901935_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000229807.1|1901942_1902149_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	97.1	1.8e-26
WP_000145926.1|1902221_1902512_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788878.1|1902508_1903210_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_000185462.1|1903206_1904145_-	replication protein	NA	C1JJ53	Enterobacteria_phage	99.4	1.1e-171
WP_000035947.1|1904177_1904474_-	hypothetical protein	NA	A0A0N7C1W0	Escherichia_phage	96.9	1.3e-46
WP_000276885.1|1904583_1904769_-	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_001095982.1|1904849_1905500_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_000256573.1|1905814_1906120_+	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
WP_000930321.1|1906122_1906461_+	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
WP_000167595.1|1906594_1907065_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065385.1|1907214_1907583_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
WP_001198860.1|1907655_1907820_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372926.1|1907788_1907953_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.1	3.2e-23
WP_000995439.1|1908007_1908304_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|1908309_1909095_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|1909091_1909769_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|1909768_1909951_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|1909923_1910115_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|1910125_1910407_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763358.1|1910505_1910727_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_001289868.1|1910723_1911329_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	96.9	1.7e-45
WP_001345188.1|1911325_1911676_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	80.2	3.3e-33
WP_000457736.1|1911750_1911993_+	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	96.2	3.7e-36
WP_001281192.1|1912111_1912456_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001444001.1|1912561_1912780_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_000533670.1|1912757_1913828_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001215756.1|1913842_1914448_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000012302.1|1914444_1916133_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001281242.1|1916282_1918910_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
1928126:1928144	attR	GCGTCTTATCTGGCCTACA	NA	NA	NA	NA
>prophage 12
NZ_CP027352	Escherichia coli strain 2012C-4606 chromosome, complete genome	5647195	2007582	2081096	5647195	holin,capsid,terminase,portal,integrase,transposase,tRNA,head,lysis	Enterobacteria_phage(49.18%)	89	2033435:2033450	2053595:2053610
WP_001283577.1|2007582_2008395_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|2008394_2009408_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|2009473_2010610_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615813.1|2010708_2011704_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127749.1|2011700_2012879_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2013162_2014383_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683823.1|2014541_2016548_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|2016668_2016947_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089232.1|2016980_2017529_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447359.1|2017528_2018338_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_032341809.1|2018337_2019162_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|2019165_2020251_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|2020285_2021218_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2021383_2021935_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001315753.1|2022007_2022859_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000844750.1|2022860_2023400_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000714139.1|2023396_2023885_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000018471.1|2023881_2024391_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000482751.1|2024406_2025159_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001375769.1|2025178_2027824_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|2027905_2028469_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|2029152_2029638_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426169.1|2029840_2031985_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|2031984_2033295_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
2033435:2033450	attL	CCTGCCAGCAACTGAC	NA	NA	NA	NA
WP_001296869.1|2033474_2033759_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|2034130_2035471_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937833.1|2035835_2036894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|2037075_2037831_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|2038124_2039057_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958687.1|2039368_2040526_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	1.1e-221
WP_000440209.1|2040770_2041913_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.9	9.2e-24
WP_001280420.1|2041983_2044107_-	hypothetical protein	NA	A0A2D1GLP5	Escherichia_phage	36.7	2.5e-59
WP_000287055.1|2044228_2044495_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	90.5	9.5e-33
WP_000749290.1|2044565_2045051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868968.1|2045065_2046910_-	hypothetical protein	NA	A0A192Y934	Salmonella_phage	72.1	4.0e-239
WP_000246938.1|2046909_2048316_-	DNA transfer protein	NA	I6RSG0	Salmonella_phage	55.8	1.1e-127
WP_000964882.1|2048325_2049018_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000614047.1|2049020_2049476_-	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.0	3.3e-86
WP_000785546.1|2049475_2050324_-	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	97.9	1.5e-100
WP_001122374.1|2050323_2051742_-	Packaged DNA stabilization protein gp10	NA	Q716G7	Shigella_phage	99.2	2.3e-274
WP_000246750.1|2051750_2052233_-	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
WP_000375639.1|2052207_2052393_-	hypothetical protein	NA	Q716G9	Shigella_phage	98.4	4.6e-26
WP_001133481.1|2052435_2053707_-|head	head protein	head	Q716H0	Shigella_phage	99.8	6.6e-241
2053595:2053610	attR	CCTGCCAGCAACTGAC	NA	NA	NA	NA
WP_032341807.1|2053718_2054603_-|capsid	phage capsid scaffolding protein	capsid	Q716H1	Shigella_phage	98.3	9.9e-143
WP_000852339.1|2054616_2056743_-|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.3	0.0e+00
WP_000200776.1|2056745_2058158_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.6	2.2e-277
WP_000179910.1|2058154_2058580_-	hypothetical protein	NA	Q716H4	Shigella_phage	87.9	1.8e-65
WP_000807788.1|2058659_2058902_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000999682.1|2059005_2059377_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	88.6	3.2e-55
WP_085947969.1|2059766_2060980_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
WP_106875231.1|2060985_2061492_-	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	100.0	1.1e-82
WP_000092296.1|2061697_2062135_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	97.2	1.1e-70
WP_000229392.1|2062131_2062608_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_000783734.1|2062591_2062915_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_032344729.1|2063987_2064611_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.5	2.0e-113
WP_001271146.1|2064607_2065273_-	serine/threonine protein phosphatase	NA	K7P721	Enterobacteria_phage	97.7	1.6e-129
WP_000144614.1|2065250_2065457_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001107956.1|2065453_2066059_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	98.0	5.6e-97
WP_072189684.1|2066051_2066261_-	protein ninF	NA	G9L691	Escherichia_phage	95.6	2.2e-29
WP_000924601.1|2066220_2066622_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001254255.1|2066624_2066801_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000814611.1|2066797_2067208_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_000344573.1|2067179_2067536_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_000103674.1|2068001_2068217_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	98.6	2.2e-32
WP_001248395.1|2068303_2069680_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.1	5.3e-252
WP_000539347.1|2069676_2070498_-	replication protein	NA	K7PJZ3	Enterobacterial_phage	99.3	1.7e-152
WP_001375758.1|2070681_2070960_-	transcriptional regulator	NA	K7P7A2	Enterobacteria_phage	96.7	1.5e-41
WP_001054987.1|2071069_2071294_-	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	86.3	1.4e-29
WP_000092874.1|2071438_2072113_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	83.9	1.2e-103
WP_000394868.1|2072153_2072450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012817806.1|2072883_2073156_+	hypothetical protein	NA	K7PH69	Enterobacterial_phage	98.9	1.0e-26
WP_001430488.1|2073158_2073521_+	hypothetical protein	NA	K7P6R2	Enterobacteria_phage	100.0	6.2e-59
WP_000382838.1|2073551_2074046_-	hypothetical protein	NA	K7PK22	Enterobacteria_phage	99.4	1.6e-89
WP_000167585.1|2074246_2074717_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.1e-87
WP_000776959.1|2074860_2075172_+	superinfection exclusion protein	NA	O48416	Enterobacteria_phage	99.0	9.3e-56
WP_000972063.1|2075247_2075382_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_001243355.1|2075366_2075519_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000031004.1|2075775_2076381_+	ERF family protein	NA	O48415	Enterobacteria_phage	100.0	2.4e-108
WP_000951323.1|2076380_2076764_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	99.2	8.5e-67
WP_001111303.1|2076787_2077081_+	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	100.0	5.0e-51
WP_106875232.1|2077252_2077840_+	DUF4752 domain-containing protein	NA	K7PGR4	Enterobacteria_phage	96.6	7.2e-57
WP_000052365.1|2077836_2078505_+	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	79.7	9.3e-69
WP_000060377.1|2078506_2078695_+	hypothetical protein	NA	Q9G079	Enterobacteria_phage	100.0	1.7e-28
WP_001375782.1|2078698_2079316_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	100.0	3.7e-112
WP_000156090.1|2079312_2079900_+	DUF551 domain-containing protein	NA	Q9G077	Enterobacteria_phage	100.0	7.5e-115
WP_000376716.1|2079899_2080178_+	DUF4752 family protein	NA	K7P6P7	Enterobacteria_phage	98.9	5.4e-47
WP_001368678.1|2080335_2080635_+	hypothetical protein	NA	Q9G076	Enterobacteria_phage	100.0	2.4e-53
WP_000545713.1|2080670_2080838_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.2e-25
WP_001163428.1|2080895_2081096_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
>prophage 13
NZ_CP027352	Escherichia coli strain 2012C-4606 chromosome, complete genome	5647195	2335807	2439366	5647195	holin,capsid,terminase,integrase,tRNA,head,tail	Escherichia_phage(26.56%)	99	2417164:2417179	2447432:2447447
WP_001298974.1|2335807_2336545_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2336676_2338011_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001341633.1|2338219_2339101_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|2339203_2339791_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|2339846_2340230_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|2340534_2341224_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|2341271_2342309_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2342515_2342935_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001341635.1|2343003_2343702_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000083007.1|2343733_2346394_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|2346507_2347863_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|2347908_2348232_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|2348228_2349527_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|2355380_2357954_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_032344751.1|2358083_2358815_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079094.1|2358811_2359792_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2359926_2360664_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2360934_2361276_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2361379_2361427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|2361525_2362686_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|2362728_2363850_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|2363860_2364931_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000976004.1|2365140_2365506_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|2365655_2366174_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969036.1|2366163_2367390_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|2367405_2367888_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2367964_2368312_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|2368353_2369121_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2369151_2369700_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2369718_2369967_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460032.1|2370215_2371577_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|2371743_2372535_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2372555_2373842_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|2373896_2374490_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|2374612_2375491_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|2375576_2377238_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_032344749.1|2377386_2377728_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|2377789_2378080_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|2378069_2378546_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2378677_2379160_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000938109.1|2380914_2382276_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	1.2e-51
WP_001453949.1|2386644_2388993_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|2389012_2389102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023420.1|2389208_2389478_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_000268987.1|2389479_2390793_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
WP_001427270.1|2390857_2391457_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.7e-109
WP_000514836.1|2391524_2394998_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.4	0.0e+00
WP_122996338.1|2395236_2395869_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.1	4.9e-104
WP_001341641.1|2396567_2397266_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	97.4	7.6e-130
WP_000807927.1|2397265_2397607_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_106875234.1|2397599_2400842_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.8	0.0e+00
WP_001513217.1|2400889_2401099_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030067.1|2401194_2401569_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	1.7e-64
WP_001275471.1|2401574_2402291_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_000133388.1|2402356_2402701_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2402697_2403144_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2403140_2403491_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|2403501_2403828_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|2406354_2406576_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173032.1|2406620_2408558_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.5	0.0e+00
WP_001341975.1|2408621_2410283_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
WP_000958402.1|2410279_2410843_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_001375434.1|2411135_2411501_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.3e-66
WP_032321890.1|2411542_2411767_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	7.8e-20
WP_001303878.1|2411848_2412163_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208681.1|2412690_2412876_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_000075132.1|2413092_2413590_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|2413589_2413796_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000874350.1|2414243_2416094_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_001339373.1|2416911_2417064_-	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
2417164:2417179	attL	TTTTTAAGATTTTGTT	NA	NA	NA	NA
WP_001047129.1|2417373_2418126_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	7.6e-136
WP_001428967.1|2418139_2419129_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	1.2e-192
WP_001061413.1|2419136_2419934_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
WP_000767136.1|2419953_2420343_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	1.6e-68
WP_000210170.1|2420339_2420666_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001341555.1|2420662_2421316_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_001447903.1|2421315_2421810_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.3	1.3e-83
WP_000061518.1|2421806_2422625_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.3	1.1e-122
WP_000620696.1|2422621_2422846_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_001087342.1|2422842_2423994_-	peptidase	NA	K7PLX4	Enterobacteria_phage	96.3	6.9e-205
WP_000521508.1|2423990_2424542_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_000649477.1|2424585_2424786_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859462.1|2424876_2425551_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000135680.1|2426217_2426580_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081319.1|2426645_2427470_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	5.0e-149
WP_000008174.1|2427598_2428135_+	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
WP_000335005.1|2428125_2429004_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	94.9	1.9e-170
WP_000158004.1|2429000_2429204_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
WP_000476199.1|2429196_2429436_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	3.7e-36
WP_000034210.1|2429432_2429762_+	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	37.5	1.1e-25
WP_000206753.1|2429763_2430627_+	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	53.6	3.2e-69
WP_000457722.1|2430711_2430954_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	82.5	1.8e-30
WP_000557643.1|2430957_2431104_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	90.9	1.7e-20
WP_000516611.1|2431276_2432452_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	91.2	4.6e-204
WP_001431537.1|2432934_2433843_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	100.0	2.3e-171
WP_001341819.1|2434141_2435371_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|2435409_2435826_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214985.1|2435897_2437646_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	100.0	0.0e+00
WP_000577251.1|2437647_2439366_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	100.0	6.5e-308
2447432:2447447	attR	TTTTTAAGATTTTGTT	NA	NA	NA	NA
>prophage 14
NZ_CP027352	Escherichia coli strain 2012C-4606 chromosome, complete genome	5647195	2512157	2519297	5647195		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|2512157_2514719_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141347.1|2514824_2515481_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001297141.1|2515531_2516299_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2516494_2517403_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|2517399_2518662_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2518658_2519297_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 15
NZ_CP027352	Escherichia coli strain 2012C-4606 chromosome, complete genome	5647195	2671351	2679300	5647195	transposase,integrase	Stx2-converting_phage(42.86%)	7	2669308:2669324	2678393:2678409
2669308:2669324	attL	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
WP_000381395.1|2671351_2672923_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2672942_2673290_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2673289_2673967_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000082600.1|2674361_2675090_-	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	41.2	7.1e-14
WP_000852869.1|2675998_2676658_-	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	33.9	3.6e-33
WP_000935135.1|2676650_2678258_-|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	28.0	4.3e-11
WP_001272558.1|2678544_2679300_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
2678393:2678409	attR	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
>prophage 16
NZ_CP027352	Escherichia coli strain 2012C-4606 chromosome, complete genome	5647195	3727898	3741231	5647195	transposase,integrase	Enterobacteria_phage(66.67%)	15	3727392:3727414	3741392:3741414
3727392:3727414	attL	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
WP_000783645.1|3727898_3730232_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
WP_000856729.1|3730246_3730567_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001339397.1|3730722_3731400_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3731399_3731747_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|3731766_3733338_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000459320.1|3733413_3733869_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	6.1e-64
WP_001244665.1|3733861_3734149_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000980227.1|3734141_3734741_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
WP_001149160.1|3734737_3735004_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283024.1|3735555_3736290_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.0	5.7e-128
WP_000638629.1|3736286_3736787_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446132.1|3736860_3737433_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000186475.1|3737760_3738186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119815.1|3738182_3740042_-	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
WP_001218979.1|3740061_3741231_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.1	1.7e-198
3741392:3741414	attR	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
>prophage 17
NZ_CP027352	Escherichia coli strain 2012C-4606 chromosome, complete genome	5647195	4157601	4205524	5647195	transposase,tRNA,protease,integrase	Vibrio_phage(20.0%)	45	4138573:4138587	4164918:4164932
4138573:4138587	attL	TATGGATGATGAGAC	NA	NA	NA	NA
WP_001375513.1|4157601_4159221_+|transposase	ISL3-like element ISEc38 family transposase	transposase	NA	NA	NA	NA
WP_000704132.1|4159217_4160789_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.6	5.8e-295
WP_001218841.1|4160905_4162171_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_001188520.1|4162550_4163126_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068905.1|4163162_4164860_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883338.1|4164835_4165174_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
4164918:4164932	attR	TATGGATGATGAGAC	NA	NA	NA	NA
WP_000961959.1|4165289_4166591_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000069437.1|4166708_4168145_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|4168481_4168958_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015837.1|4168973_4170230_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|4170505_4170799_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|4170842_4172489_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|4172626_4172980_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000399685.1|4173232_4174213_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001008073.1|4174461_4175331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940530.1|4175720_4176749_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|4176790_4177357_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|4177408_4177534_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|4177644_4177791_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|4177972_4178290_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238378.1|4178286_4178820_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001299193.1|4178908_4180042_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001299198.1|4180104_4180464_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|4180474_4180870_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|4180880_4181615_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001192991.1|4181607_4183416_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|4183740_4184718_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001346081.1|4184936_4186439_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000342867.1|4186490_4186805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276180.1|4186801_4187116_+	YjeO family protein	NA	NA	NA	NA	NA
WP_001236850.1|4187144_4190468_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934920.1|4190489_4191458_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041970.1|4191554_4192607_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|4192701_4193247_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_100699686.1|4194110_4194164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294203.1|4194146_4195286_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001307537.1|4195284_4196832_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|4196803_4197265_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990321.1|4197283_4198621_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122519.1|4198630_4200478_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_001280349.1|4200470_4201421_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|4201506_4201815_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460361.1|4201891_4203172_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|4203257_4204517_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|4204519_4205524_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 18
NZ_CP027352	Escherichia coli strain 2012C-4606 chromosome, complete genome	5647195	4217236	4277675	5647195	transposase,protease	Stx2-converting_phage(25.0%)	57	NA	NA
WP_000811566.1|4217236_4217512_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254642.1|4217660_4217990_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569731.1|4218171_4218921_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|4218917_4219673_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|4219780_4220845_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001341647.1|4221199_4222597_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218360.1|4222612_4222918_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000056760.1|4223405_4224056_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|4224065_4224920_+	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001170812.1|4224919_4225606_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000492914.1|4225734_4226010_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|4226336_4226732_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|4226738_4227053_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|4227057_4227285_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|4227326_4227776_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001341645.1|4227846_4228641_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_072097616.1|4229080_4229695_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	1.8e-42
WP_000440544.1|4229702_4230911_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	6.4e-209
WP_001119478.1|4231045_4231684_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|4231902_4232523_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228344.1|4232831_4234235_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_001062220.1|4234501_4234936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001345317.1|4235034_4236102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000331456.1|4236348_4237011_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001296686.1|4237118_4238084_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560553.1|4238191_4239052_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|4239140_4239521_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589460.1|4239649_4241593_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886909.1|4241782_4242523_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000175289.1|4242512_4243070_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|4243394_4243601_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|4243662_4245006_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001295196.1|4245328_4245967_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|4246172_4247906_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060926.1|4247902_4251682_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|4251684_4252026_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223208.1|4252237_4252489_+	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_000239579.1|4252482_4252833_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|4252912_4253443_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265933.1|4253752_4254709_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205813.1|4254848_4256351_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001296689.1|4256364_4257387_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|4257373_4258369_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|4258401_4259400_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219792.1|4259575_4260949_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166267.1|4261036_4261588_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|4261681_4263034_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000099148.1|4263338_4264877_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.6	3.3e-295
WP_000612626.1|4264925_4265273_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|4265269_4265674_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001106238.1|4266109_4266574_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000187778.1|4266732_4268871_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001341327.1|4269264_4270920_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001181312.1|4272444_4273392_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|4273576_4273630_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471889.1|4273770_4276467_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000399685.1|4276694_4277675_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP027352	Escherichia coli strain 2012C-4606 chromosome, complete genome	5647195	4303310	4315874	5647195	transposase	Enterobacteria_phage(40.0%)	14	NA	NA
WP_001339397.1|4303310_4303988_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4303987_4304335_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|4304354_4305926_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001185332.1|4306235_4306508_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	46.9	8.3e-08
WP_000991130.1|4306509_4307064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214377.1|4307060_4307813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001084853.1|4308727_4308988_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	67.5	4.6e-24
WP_000761643.1|4308984_4309533_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.8	5.9e-29
WP_001014979.1|4309532_4309757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000842358.1|4309753_4310077_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_000016235.1|4310091_4312425_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.8	0.0e+00
WP_000594911.1|4313330_4314155_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_000916596.1|4314203_4314584_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	60.8	1.1e-37
WP_085948186.1|4314717_4315874_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
>prophage 20
NZ_CP027352	Escherichia coli strain 2012C-4606 chromosome, complete genome	5647195	5057472	5126345	5647195	capsid,terminase,portal,protease,integrase,transposase,tRNA,head,tail,lysis	Enterobacteria_phage(57.63%)	81	5067633:5067679	5117819:5117865
WP_000912342.1|5057472_5058858_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_001143540.1|5058893_5059415_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|5059522_5059735_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|5059736_5060603_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|5061083_5061626_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988363.1|5061845_5062538_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000701359.1|5062568_5065178_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|5065156_5066197_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255226.1|5066207_5066723_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|5066725_5067358_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
5067633:5067679	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|5067692_5068856_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000446905.1|5068711_5069083_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|5069054_5069333_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763390.1|5069380_5069599_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_001443983.1|5069697_5069979_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|5069989_5070181_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|5070153_5070336_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|5070332_5071013_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000100847.1|5071009_5071795_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|5071800_5072097_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000206913.1|5072172_5072463_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	82.4	2.5e-26
WP_001444023.1|5072929_5073250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000066829.1|5073385_5073649_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
WP_000858975.1|5073730_5074420_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|5074524_5074755_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182773.1|5074824_5075364_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001342088.1|5075450_5076380_+	replication protein	NA	M1FN81	Enterobacteria_phage	67.0	4.4e-109
WP_000788789.1|5076376_5077078_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
WP_000152742.1|5077282_5077630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001415151.1|5078382_5078991_+	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_001038620.1|5079290_5079707_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_000520500.1|5079685_5080087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097617.1|5080210_5080312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053023.1|5080308_5080764_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_000224914.1|5080763_5080934_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774477.1|5080926_5081217_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_001099712.1|5081213_5081576_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971074.1|5081572_5081713_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204791.1|5081798_5082182_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737278.1|5082370_5083453_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
WP_000839596.1|5084041_5084257_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135274.1|5084256_5084754_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_001228695.1|5084970_5085153_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|5085243_5085537_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_157825797.1|5085744_5085912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101750776.1|5085877_5087091_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	2.3e-166
WP_001427981.1|5087208_5087403_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000453558.1|5087791_5088337_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027297.1|5088311_5090237_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000198149.1|5090233_5090440_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001375452.1|5090436_5092038_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.0e-310
WP_000381395.1|5092510_5094082_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|5094101_5094449_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|5094448_5095126_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000088640.1|5095166_5096045_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.0	1.7e-147
WP_001345004.1|5096054_5096387_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063244.1|5096442_5097468_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_000158868.1|5097509_5097905_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752961.1|5097916_5098291_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
WP_000985132.1|5098281_5098860_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683110.1|5098856_5099252_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_001342267.1|5099259_5100000_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|5100015_5100438_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|5100419_5100854_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840236.1|5100846_5103408_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
WP_000847347.1|5103404_5103734_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_001152557.1|5103733_5104432_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	3.4e-130
WP_000090884.1|5105117_5105750_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_000515439.1|5105810_5109224_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_001230523.1|5109294_5109894_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
WP_000268807.1|5109958_5112919_+	membrane protein	NA	A0A2D1UII2	Escherichia_phage	97.4	6.6e-58
WP_000885569.1|5112918_5113503_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_000239881.1|5113557_5114226_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|5114282_5114588_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226384.1|5114771_5116256_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|5116442_5117396_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177453.1|5117908_5118670_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
5117819:5117865	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|5118852_5119743_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001375368.1|5119743_5122716_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383941.1|5122702_5124940_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420938.1|5125208_5126345_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP027352	Escherichia coli strain 2012C-4606 chromosome, complete genome	5647195	5345872	5396378	5647195	holin,terminase,portal,protease,integrase,transposase,head,tail,lysis	Enterobacteria_phage(50.82%)	65	5341620:5341635	5348691:5348706
5341620:5341635	attL	ATGGCGGCGCGGCAGG	NA	NA	NA	NA
WP_000533654.1|5345872_5346943_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
WP_001303849.1|5346920_5347139_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001281774.1|5347245_5347590_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_000545733.1|5347618_5347786_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000002107.1|5347858_5348143_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_012817743.1|5348135_5348438_-	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	97.0	9.4e-53
WP_000104414.1|5348434_5349052_-	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
5348691:5348706	attR	ATGGCGGCGCGGCAGG	NA	NA	NA	NA
WP_000034231.1|5349053_5349611_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
WP_000812206.1|5349607_5350165_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
WP_001214436.1|5350161_5350326_-	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
WP_001111278.1|5350336_5350630_-	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_000951334.1|5350653_5351037_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_000031370.1|5351036_5351642_-	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_085948186.1|5351831_5352987_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001243354.1|5353165_5353318_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
WP_000638547.1|5353302_5353434_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_085947969.1|5353860_5355074_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
WP_000788880.1|5357376_5358078_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	3.8e-129
WP_000145926.1|5358074_5358365_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000344573.1|5358661_5359018_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_000814611.1|5358989_5359400_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_001254255.1|5359396_5359573_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_032341936.1|5359575_5359974_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	99.2	2.9e-70
WP_001341811.1|5359933_5360143_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.6e-30
WP_001003989.1|5360135_5360858_+	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
WP_000002261.1|5360857_5361148_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_001008193.1|5361144_5361507_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_000994516.1|5361503_5361692_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000750155.1|5361903_5362863_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|5363201_5363324_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|5363338_5364028_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|5364212_5364956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|5365041_5365200_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000411802.1|5367810_5368017_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|5368016_5368514_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092330.1|5368510_5368948_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.2	1.1e-70
WP_000881326.1|5369097_5369715_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001307652.1|5369902_5370097_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000235451.1|5370492_5371002_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_000259002.1|5372884_5373091_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001432013.1|5373087_5374680_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.2e-184
WP_001254029.1|5374669_5374846_+	hypothetical protein	NA	E4WL22	Enterobacteria_phage	56.4	1.1e-08
WP_000839179.1|5374923_5375328_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612622.1|5375324_5375672_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	9.7e-62
WP_000099160.1|5375720_5377259_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_032284507.1|5377255_5377624_+	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	88.0	2.4e-50
WP_001143027.1|5377631_5378384_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	94.0	2.0e-128
WP_000479086.1|5378397_5378829_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533431.1|5378855_5379269_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000082320.1|5379249_5381829_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
WP_000847304.1|5381825_5382155_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001375577.1|5382154_5382853_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
WP_001429308.1|5382858_5383602_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_096844540.1|5383547_5384180_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_000515142.1|5384425_5387902_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
WP_001230449.1|5387969_5388569_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_000268998.1|5388633_5389848_+	short-chain dehydrogenase	NA	B6DZB7	Enterobacteria_phage	95.8	6.6e-81
WP_001023459.1|5389849_5390119_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000950982.1|5390224_5391106_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_000652081.1|5391329_5392157_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.2	3.1e-154
WP_021351651.1|5392280_5392652_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_000381395.1|5393126_5394698_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|5394717_5395065_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|5395064_5395742_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001448642.1|5395802_5396378_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
>prophage 22
NZ_CP027352	Escherichia coli strain 2012C-4606 chromosome, complete genome	5647195	5625704	5645277	5647195	transposase,protease,integrase	Escherichia_phage(47.37%)	28	5619972:5619987	5642601:5642616
5619972:5619987	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000375138.1|5625704_5626364_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
WP_001299351.1|5626772_5627792_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|5627769_5628012_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_106875240.1|5628079_5630530_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_001098307.1|5630623_5630815_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|5630811_5631000_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|5631567_5631777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394543.1|5631777_5632416_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	3.3e-07
WP_000380316.1|5632427_5632580_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001303876.1|5632856_5633144_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|5633143_5633335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|5633362_5633764_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|5633872_5634145_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|5634128_5634554_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|5634760_5635216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205821.1|5635294_5636410_+	hypothetical protein	NA	V5URT9	Shigella_phage	68.4	3.4e-132
WP_000788742.1|5636416_5637163_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.6	5.6e-115
WP_000451007.1|5637184_5637955_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151233.1|5637970_5638384_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_106875241.1|5638974_5640188_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000955173.1|5641186_5641324_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013636.1|5641368_5641581_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_001341388.1|5641748_5642027_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265141.1|5642028_5643078_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.5e-110
5642601:5642616	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|5643090_5643462_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|5643451_5643823_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|5643974_5644793_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|5645079_5645277_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
>prophage 1
NZ_CP027353	Escherichia coli strain 2012C-4606 plasmid unnamed1	20881	2419	14197	20881	protease,transposase	Stx2-converting_phage(83.33%)	9	NA	NA
WP_000997978.1|2419_3952_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	4.6e-297
WP_000612591.1|4001_4349_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000091308.1|4585_4951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937603.1|4950_6138_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012917687.1|6416_7985_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000631725.1|7988_8336_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|8332_9007_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_136139077.1|8937_9357_+	DUF1449 family protein	NA	NA	NA	NA	NA
WP_001034100.1|10294_14197_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
>prophage 1
NZ_CP027354	Escherichia coli strain 2012C-4606 plasmid unnamed2	57720	40426	46520	57720	transposase	Stx2-converting_phage(57.14%)	7	NA	NA
WP_012917687.1|40426_41995_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000631725.1|41998_42346_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|42342_43017_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001341442.1|43070_43298_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	6.2e-33
WP_000361610.1|43460_44438_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_085953785.1|45242_46455_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	2.5e-168
WP_086163899.1|46421_46520_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.5e-07
