The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027355	Escherichia coli strain 2013C-4991 chromosome, complete genome	5367251	222020	326150	5367251	protease,holin,integrase,terminase,head,capsid,transposase,tRNA,tail	Enterobacteria_phage(33.75%)	111	224495:224514	277516:277535
WP_000569357.1|222020_222947_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|222951_223683_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|223663_223771_-	protein YohO	NA	NA	NA	NA	NA
WP_029208330.1|223830_224532_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.0e-102
224495:224514	attL	CACGCGCGTAACGTGACAGG	NA	NA	NA	NA
WP_000063648.1|224552_225839_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|225872_226127_-	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_033803522.1|226145_226280_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	95.5	4.6e-20
WP_000457728.1|226283_226526_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_033803232.1|226613_227279_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	52.3	8.7e-51
WP_001289880.1|227280_227697_-	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	86.6	1.7e-28
WP_000763367.1|227693_227915_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_077630180.1|228013_228295_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000548531.1|228305_228497_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000149542.1|228469_228652_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
WP_000186837.1|228648_229329_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	4.6e-132
WP_000100847.1|229325_230111_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|230116_230413_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372923.1|230488_230632_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_001198860.1|230600_230765_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_053896127.1|230837_231206_-	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	97.5	1.7e-64
WP_024236517.1|231356_231827_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	2.4e-87
WP_033803619.1|231885_232158_-	hypothetical protein	NA	K7PH69	Enterobacterial_phage	95.6	1.1e-25
WP_001095981.1|232471_233122_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	98.6	4.1e-122
WP_000276886.1|233202_233388_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_001177650.1|233496_233775_+	transcriptional regulator	NA	K7P7A2	Enterobacteria_phage	100.0	1.6e-43
WP_106912613.1|233809_234748_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	99.4	1.4e-171
WP_000788927.1|234744_235446_+	Replication protein P	NA	C1JJ58	Enterobacteria_phage	99.6	1.3e-129
WP_000145908.1|235442_235733_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	100.0	5.7e-47
WP_001000130.1|235803_236082_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|236214_236430_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001281772.1|236440_236677_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_024216032.1|236633_237080_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	98.6	1.2e-80
WP_106912614.1|237076_237604_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	99.4	1.2e-100
WP_001254221.1|237600_237783_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
WP_032355379.1|238286_240059_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.3	0.0e+00
WP_001108084.1|240616_241183_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_024216034.1|241157_241760_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	3.9e-90
WP_001028858.1|241756_242428_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|242418_242907_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_106912615.1|243548_243977_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.1	3.7e-63
WP_106912616.1|244455_246306_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_000411813.1|246598_246805_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
WP_024216148.1|246809_247154_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.4	2.1e-56
WP_025380493.1|247204_247738_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.3e-100
WP_000661712.1|248011_248707_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_001280923.1|248801_248933_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_012816791.1|249155_249341_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000828070.1|249741_250068_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095732.1|250199_250400_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	95.5	3.7e-29
WP_025380422.1|250441_250807_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.8e-65
WP_033803442.1|251096_251660_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	8.9e-81
WP_001368653.1|251656_253318_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.3	0.0e+00
WP_106912617.1|253381_255319_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.8	0.0e+00
WP_001063025.1|255363_255585_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|258111_258438_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007889.1|258448_258799_+|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000573374.1|258795_259242_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|259238_259583_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275471.1|259648_260365_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_001030043.1|260370_260745_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|260840_261050_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_106912618.1|261097_264340_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	94.7	0.0e+00
WP_000807964.1|264332_264674_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152217.1|264673_265372_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	99.6	2.8e-132
WP_106912619.1|265382_266126_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	8.6e-148
WP_122994740.1|266071_266704_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	95.2	3.3e-100
WP_106912620.1|266942_270422_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.0	0.0e+00
WP_001230485.1|270488_271088_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	2.6e-110
WP_101981526.1|271152_272466_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.2	1.9e-81
WP_033803510.1|272467_272737_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	2.7e-43
WP_033803505.1|273729_274971_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.2	7.7e-218
WP_077776999.1|275622_276837_-	secretion protein EspV	NA	H6WZN3	Escherichia_phage	99.0	3.3e-229
WP_001261971.1|277041_277290_-	DinI-like family protein	NA	H6WZN4	Escherichia_phage	100.0	2.4e-38
WP_001295431.1|277804_279490_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
277516:277535	attR	CACGCGCGTAACGTGACAGG	NA	NA	NA	NA
WP_000598641.1|279486_280206_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|280252_280723_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001423058.1|281350_283351_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_033803504.1|283347_284484_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.7e-161
WP_001294387.1|284476_286756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001300974.1|286766_287855_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636925.1|288161_288479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033803503.1|288539_292172_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_106912621.1|292181_295976_-	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001005448.1|298281_299391_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|299653_299935_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|300227_300770_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677393.1|300849_301524_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_032172848.1|301539_304020_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000405694.1|304035_305070_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|305151_305490_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134591.1|305708_306533_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|306652_306925_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195638.1|307147_307936_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|307932_308733_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001373513.1|308797_309616_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.9e-24
WP_000434038.1|309667_310414_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011950.1|310387_311353_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846217.1|311349_312354_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000858498.1|312350_313628_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|313884_314937_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289788.1|315245_316100_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853898.1|316128_317391_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182914.1|317400_317853_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823272.1|317883_318168_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_033803293.1|318171_319527_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000844219.1|319574_320615_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|320714_321494_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_033803294.1|321575_322475_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001318299.1|322879_323197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|323381_324543_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000476014.1|324788_326150_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
>prophage 2
NZ_CP027355	Escherichia coli strain 2013C-4991 chromosome, complete genome	5367251	375801	385345	5367251		Bacillus_phage(28.57%)	8	NA	NA
WP_001115957.1|375801_377196_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
WP_000183060.1|377370_378264_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_032173264.1|378589_379606_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	50.2	9.8e-86
WP_032173265.1|379936_381055_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.8	1.4e-133
WP_032173266.1|381058_382024_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	6.4e-87
WP_106912622.1|382026_382527_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_032224293.1|382519_383968_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.4	4.8e-54
WP_032172825.1|383971_385345_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.9	2.2e-32
>prophage 3
NZ_CP027355	Escherichia coli strain 2013C-4991 chromosome, complete genome	5367251	411109	455006	5367251	protease,lysis,holin,integrase,terminase,head,tail	Enterobacteria_phage(33.33%)	69	410385:410398	417046:417059
410385:410398	attL	CATCGTGGGCGTTG	NA	NA	NA	NA
WP_106912623.1|411109_412288_+|integrase	site-specific integrase	integrase	K7P7J2	Enterobacteria_phage	99.0	2.9e-230
WP_000132739.1|412268_412460_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_097310592.1|412539_412884_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	97.4	5.0e-58
WP_106912624.1|412910_413078_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_033803018.1|413135_413936_-	hypothetical protein	NA	K7P7Q8	Enterobacteria_phage	98.5	2.2e-157
WP_033803017.1|414093_415014_-	DUF551 domain-containing protein	NA	Q08J60	Stx2-converting_phage	95.3	9.5e-80
WP_000951712.1|415010_415220_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	92.8	2.0e-33
WP_159032751.1|415221_415833_-	ead/Ea22-like family protein	NA	A0A222YWN7	Escherichia_phage	65.5	7.2e-60
WP_033803015.1|415916_416084_-	DUF2737 family protein	NA	K7PJY9	Enterobacterial_phage	98.2	3.0e-24
WP_001111298.1|416094_416388_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	99.0	1.9e-50
WP_033803014.1|416890_417364_-	single-stranded DNA-binding protein	NA	G8EYH4	Enterobacteria_phage	97.5	3.9e-61
417046:417059	attR	CAACGCCCACGATG	NA	NA	NA	NA
WP_033803013.1|417364_418072_-	recombinase	NA	K7PKU3	Enterobacteria_phage	99.1	1.1e-136
WP_001243350.1|418326_418479_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.1e-20
WP_000638547.1|418463_418595_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_033803012.1|418619_419588_-	hypothetical protein	NA	G5DA88	Enterobacteria_phage	99.4	1.7e-55
WP_024236517.1|419731_420202_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	2.4e-87
WP_000340008.1|420210_420537_-	antitermination protein	NA	A4KWR0	Enterobacteria_phage	100.0	2.7e-53
WP_001519589.1|421029_421725_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.5	1.3e-129
WP_033803110.1|421800_422016_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	97.2	4.1e-34
WP_000251073.1|422135_422429_+	hypothetical protein	NA	K7P6Y2	Enterobacteria_phage	100.0	2.8e-46
WP_001608293.1|422609_423431_+	replication protein	NA	K7PJZ3	Enterobacterial_phage	99.6	2.0e-153
WP_001248388.1|423427_424804_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_023351780.1|424876_425083_+	hypothetical protein	NA	A0A2I6PIF1	Escherichia_phage	97.1	6.0e-27
WP_085458232.1|425090_425537_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	90.5	2.2e-74
WP_106912625.1|425533_426061_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	99.4	2.1e-100
WP_001254255.1|426057_426234_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_001543886.1|426236_426638_+	hypothetical protein	NA	K7PJK0	Enterobacteria_phage	98.5	6.0e-71
WP_021514114.1|426597_426807_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.0e-30
WP_033803109.1|426799_427522_+	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	94.6	1.6e-122
WP_000002243.1|427521_427812_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_001008199.1|427808_428171_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000994516.1|428167_428356_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001235459.1|428352_428976_+	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_032145908.1|429116_429299_-	hypothetical protein	NA	A0A088CPS7	Enterobacteria_phage	93.3	4.5e-26
WP_000783734.1|429409_429733_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_106912626.1|429716_430193_+	glycoside hydrolase family protein	NA	C6ZR65	Salmonella_phage	99.4	4.9e-88
WP_106912627.1|430189_430627_+|lysis	lysis protein	lysis	Q9MCN3	Enterobacteria_phage	97.2	1.9e-70
WP_049254001.1|431235_431733_+	HNH endonuclease	NA	A9J6Z2	Pseudomonas_phage	43.3	6.8e-24
WP_040063256.1|431734_432289_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	69.4	4.0e-65
WP_001519796.1|432291_433914_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_106912628.1|433913_435380_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	94.7	1.3e-269
WP_086353604.1|435267_436005_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	95.0	5.0e-108
WP_106912629.1|436019_437240_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	84.6	8.2e-188
WP_032330425.1|437244_437748_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	82.6	1.6e-73
WP_034169229.1|437759_438701_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	2.2e-156
WP_001107515.1|438743_438965_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	7.7e-12
WP_106912630.1|438930_439338_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	96.3	2.3e-70
WP_106912631.1|439334_439889_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	84.8	6.7e-81
WP_001142482.1|439875_440265_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	95.3	4.3e-66
WP_106912632.1|440239_440803_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	3.4e-80
WP_106912633.1|440806_441952_+	DUF3383 family protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.2	2.6e-159
WP_000109249.1|441962_442403_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_032330416.1|442406_442859_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	74.7	1.9e-57
WP_106912634.1|443036_444989_+	lytic transglycosylase catalytic	NA	A0A0M4REK7	Salmonella_phage	64.0	9.1e-165
WP_047643983.1|444988_445639_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	64.8	3.1e-61
WP_047643984.1|445642_445945_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	59.0	1.8e-27
WP_032330411.1|445947_446982_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	52.2	2.1e-99
WP_000755137.1|446978_447314_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	55.6	1.6e-24
WP_001302649.1|447338_447659_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|447766_447940_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_086353609.1|448011_448890_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	1.7e-94
WP_001738127.1|448950_449703_+	translation initiation factor IF-2	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	64.4	2.2e-90
WP_001270632.1|449702_450056_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	9.0e-55
WP_106912635.1|450055_451255_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.1	4.1e-184
WP_000049950.1|451251_451932_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	2.6e-103
WP_106912636.1|451931_452735_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	61.3	1.6e-46
WP_106912637.1|452734_453337_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	91.5	4.6e-99
WP_106912701.1|453308_453500_-|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	79.4	3.2e-22
WP_001403689.1|453839_455006_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.5	8.0e-225
>prophage 4
NZ_CP027355	Escherichia coli strain 2013C-4991 chromosome, complete genome	5367251	593202	687573	5367251	protease,portal,holin,integrase,terminase,tRNA,tail	Enterobacteria_phage(47.54%)	105	594927:594942	612163:612178
WP_001025330.1|593202_594936_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	2.0e-86
594927:594942	attL	GAATATTCACCGGAAT	NA	NA	NA	NA
WP_033803526.1|595151_595718_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185727.1|595731_596478_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_033803525.1|596865_597966_+	cytochrome c	NA	NA	NA	NA	NA
WP_000176795.1|597990_600420_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564726.1|600584_601556_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|601552_602296_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|602336_602732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088369018.1|602784_603549_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.6e-72
WP_000063650.1|603565_604852_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	99.8	6.9e-254
WP_001193437.1|604885_605140_-	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|605158_605293_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457705.1|605296_605539_-	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	91.2	3.2e-35
WP_001434060.1|605570_605900_-	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	86.7	2.0e-48
WP_000070808.1|605935_606217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001434061.1|606219_606801_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	90.2	4.5e-104
WP_032144886.1|606797_606992_-	hypothetical protein	NA	Q8W652	Enterobacteria_phage	86.9	1.2e-24
WP_000141094.1|607212_607419_-	hypothetical protein	NA	Q8W651	Enterobacteria_phage	95.6	3.4e-30
WP_001201870.1|607799_608480_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	58.8	3.9e-22
WP_001434065.1|608612_609338_-	helix-turn-helix transcriptional regulator	NA	K7P7I4	Enterobacteria_phage	61.2	6.7e-81
WP_000833499.1|609473_609725_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001090256.1|609721_610429_+	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	94.0	2.6e-122
WP_033803520.1|610537_611200_+	hypothetical protein	NA	Q8W643	Enterobacteria_phage	89.7	1.7e-107
WP_000626792.1|611196_611391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621935.1|611387_611621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106912639.1|611607_612516_+	DNA-binding protein	NA	Q8W642	Enterobacteria_phage	93.1	1.6e-58
612163:612178	attR	GAATATTCACCGGAAT	NA	NA	NA	NA
WP_000988196.1|612526_613405_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.0	2.0e-140
WP_000203852.1|613401_614802_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.4	1.7e-245
WP_001065352.1|614798_615056_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
WP_001202271.1|615107_616097_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	8.9e-193
WP_001204809.1|616115_616496_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	99.2	1.4e-66
WP_000917741.1|616711_616909_+	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_000483505.1|617060_618119_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.0	2.9e-205
WP_001365055.1|618501_619461_+	Shiga toxin Stx2d subunit A	NA	Q6DWN9	Enterobacteria_phage	100.0	1.6e-175
WP_000738080.1|619472_619742_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_096071282.1|620252_622199_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	97.2	0.0e+00
WP_000142777.1|622335_622515_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_001290217.1|622555_622828_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000284510.1|622904_623120_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_048227790.1|623124_623658_+	lysozyme	NA	A0A2R2Z343	Escherichia_phage	97.7	1.3e-100
WP_001208683.1|623874_624060_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	86.9	8.1e-23
WP_000735655.1|624145_624370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000373410.1|624789_625266_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	99.4	9.5e-84
WP_033803518.1|625262_627386_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
WP_000102415.1|627382_627595_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974568.1|627594_629097_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_001114424.1|629041_631066_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|631153_631480_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|631472_631754_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_033803517.1|631756_632380_+|tail	tail protein	tail	Q9EYD6	Enterobacteria_phage	98.6	3.6e-99
WP_000682716.1|632392_632791_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|632798_633551_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479061.1|633564_633987_+|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	97.1	3.7e-71
WP_000532073.1|634013_634322_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918270.1|634365_637011_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.5	0.0e+00
WP_000847298.1|637007_637337_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_096071284.1|637336_638035_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	3.4e-130
WP_137591927.1|638728_639361_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	94.3	2.4e-98
WP_106912640.1|639703_643195_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	98.3	0.0e+00
WP_001230468.1|643265_643865_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	6.7e-111
WP_096079837.1|643929_645243_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.8	1.4e-76
WP_096079836.1|645244_645514_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	7.1e-44
WP_122988840.1|645625_645703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993326.1|645917_646931_+	peptidase M85	NA	NA	NA	NA	NA
WP_001261931.1|647302_647551_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	96.3	1.2e-37
WP_000891621.1|647868_648435_-	hydrolase	NA	NA	NA	NA	NA
WP_001258678.1|648744_650517_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001300367.1|650634_651087_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|651115_651856_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|651890_652412_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024904.1|652413_653016_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072094247.1|653086_653152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580327.1|653290_653902_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|653910_654921_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571479.1|655067_655853_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202990.1|655849_656605_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001300644.1|656683_657616_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|657631_658954_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_000448381.1|659073_660045_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000091148.1|660176_661619_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_001056706.1|661746_662616_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000301727.1|662953_664429_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_096969936.1|664663_666475_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000800512.1|666511_667153_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000173474.1|667208_668387_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000257738.1|668520_668811_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001295500.1|668877_669234_+	protein YebF	NA	NA	NA	NA	NA
WP_000024745.1|669560_670220_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000936952.1|670428_672489_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944256.1|672485_673148_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011658.1|673171_673828_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|673929_674160_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168736.1|674298_674673_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879298.1|674676_675549_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976472.1|675561_675903_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812739.1|676298_676955_+	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	50.0	1.2e-55
WP_001313035.1|676955_677147_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|677251_677488_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001383086.1|677605_679045_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295498.1|679124_681758_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207283.1|681726_683010_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|683139_683637_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431370.1|683733_684432_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001055778.1|684451_686500_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
WP_000984517.1|686691_687573_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 5
NZ_CP027355	Escherichia coli strain 2013C-4991 chromosome, complete genome	5367251	882109	1015812	5367251	protease,lysis,portal,integrase,terminase,head,capsid,transposase,tRNA,tail	Enterobacteria_phage(27.78%)	147	899964:899980	1022446:1022462
WP_001295400.1|882109_883384_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
WP_000789751.1|883445_884306_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_000765749.1|884349_884955_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100932.1|885060_886563_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030339.1|887173_887809_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289652.1|887808_888504_-	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_033803272.1|888507_889128_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_000915778.1|890189_892412_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000991805.1|892404_892983_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133193.1|892982_893564_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_001310854.1|893640_894081_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217950.1|894166_894382_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_001300888.1|894654_894780_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_001282516.1|895022_896063_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000567490.1|896096_897098_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000459391.1|897201_898374_-	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000125636.1|898383_899976_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
899964:899980	attL	TTTTCGCCGTCATAAAA	NA	NA	NA	NA
WP_000179519.1|900150_901179_+	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_000483353.1|901289_902057_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_000969092.1|902277_902868_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000945878.1|903258_905070_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
WP_001075863.1|905066_906440_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_033803271.1|906478_907744_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_001043339.1|907969_909478_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170664.1|909578_910754_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066639.1|910952_912599_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_001099080.1|912741_914145_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000135181.1|914141_915071_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000732512.1|915146_916448_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	3.2e-17
WP_001092508.1|916451_917171_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524868.1|917299_917635_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000520804.1|917631_918354_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412379.1|918390_919773_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769322.1|919958_920903_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001300486.1|921426_922959_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014036.1|922969_924358_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_001429962.1|925464_926694_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.4	7.1e-131
WP_000953271.1|927068_927257_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_071781756.1|927401_928460_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000076676.1|928456_928687_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	45.6	6.5e-06
WP_087895110.1|928676_928907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204073.1|928899_929121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106912643.1|929122_929356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032258053.1|929361_929661_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_053877286.1|929657_931058_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.3	1.4e-114
WP_106912703.1|931260_931512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106912644.1|931508_931919_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233300.1|931929_932202_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001137345.1|932489_933647_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_000504056.1|933686_934259_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_128491137.1|934296_935472_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	6.2e-185
WP_001020670.1|935468_935807_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	53.6	1.7e-31
WP_000134113.1|935803_936100_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145905.1|936099_936540_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000113645.1|936828_937185_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001560954.1|937168_938830_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.7	8.9e-278
WP_000133423.1|938843_939125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303517.1|940122_940293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000276149.1|940399_940765_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000046661.1|940751_941081_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260865.1|941119_941941_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|942040_942124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033803270.1|942216_942552_-	acid shock protein	NA	NA	NA	NA	NA
WP_001019525.1|944307_945201_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|945335_946556_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|946680_947376_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|947328_948621_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|948779_949394_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526477.1|949436_950291_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|950292_950910_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001295396.1|956030_956336_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_072104773.1|956443_957154_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|957156_957717_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|957751_958093_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001295395.1|958227_958554_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_001295394.1|958759_959974_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836059.1|959985_961005_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|961062_961173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876958.1|961192_962473_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
WP_001296941.1|962507_962744_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_106912704.1|962831_965303_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	1.9e-58
WP_001083297.1|965395_965587_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|965583_965772_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000344926.1|966258_966834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|966835_966991_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001003381.1|967191_967599_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|967676_967904_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|967887_968409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033803319.1|968389_969355_+	phage O protein family	NA	U5P0A0	Shigella_phage	61.2	1.7e-55
WP_033803318.1|969395_969818_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	2.6e-64
WP_001310834.1|969814_970171_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_000955178.1|971477_971660_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_033803317.1|971837_973151_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001301033.1|973587_973920_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|974122_974428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|974452_974692_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|974691_974979_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|975050_975206_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|975422_975674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|975740_976019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|976020_977070_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_001047135.1|977083_977836_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|978113_978203_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|978257_978470_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|978770_978986_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|979739_979955_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|979959_980271_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|980267_980801_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|980797_981295_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|981657_981870_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|981880_982069_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|982071_982137_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|982216_982372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|982543_982717_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_085947771.1|982864_984027_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000373090.1|984129_984540_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|984597_984831_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453603.1|985219_985765_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	8.1e-95
WP_001549229.1|985739_987665_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198149.1|987661_987868_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001324962.1|987864_989466_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.9e-309
WP_000123333.1|989446_990766_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	1.6e-234
WP_001549228.1|990775_991108_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_001552792.1|991163_992189_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.1	2.3e-191
WP_000158895.1|992230_992626_+	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	93.2	4.5e-55
WP_000752960.1|992637_992991_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_000985123.1|993002_993581_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	1.7e-79
WP_106912646.1|993577_993973_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	2.5e-69
WP_001439072.1|993980_994721_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	4.0e-129
WP_033803353.1|994736_995159_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	6.9e-70
WP_000459480.1|995140_995575_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_106912647.1|995567_998147_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	96.3	0.0e+00
WP_000847345.1|998143_998473_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152612.1|998472_999171_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_032143059.1|999176_999920_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	8.6e-148
WP_159032749.1|999856_1000462_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.2	1.1e-84
WP_097549127.1|1000522_1004002_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_000080195.1|1004274_1005888_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|1005918_1006269_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|1006265_1006691_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_077890157.1|1007274_1010382_+|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	59.9	3.1e-82
WP_000885600.1|1010381_1010957_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	1.8e-105
WP_000086522.1|1011054_1011645_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000836768.1|1011961_1012195_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|1012263_1012377_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|1012979_1014263_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527813.1|1014351_1015812_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	8.6e-43
1022446:1022462	attR	TTTTCGCCGTCATAAAA	NA	NA	NA	NA
>prophage 6
NZ_CP027355	Escherichia coli strain 2013C-4991 chromosome, complete genome	5367251	1150513	1318154	5367251	lysis,portal,terminase,holin,integrase,transposase,head,capsid,tRNA,tail	Escherichia_phage(35.78%)	168	1262481:1262495	1312976:1312990
WP_106912649.1|1150513_1151722_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	3.9e-206
WP_001261013.1|1152253_1152922_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000587030.1|1154001_1154595_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001300478.1|1154591_1155584_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_000140873.1|1156679_1157219_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|1157281_1157506_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375956.1|1157645_1159301_-	glucan biosynthesis protein	NA	NA	NA	NA	NA
WP_000013789.1|1159525_1160869_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414567.1|1161085_1162009_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033803008.1|1162046_1163687_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_085947770.1|1164063_1165432_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001320773.1|1165532_1165682_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|1165752_1165926_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_033803225.1|1166947_1167478_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	5.4e-19
WP_000115937.1|1168709_1170149_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027964.1|1170345_1171146_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139568.1|1171417_1175320_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048951.1|1175520_1176126_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_077776979.1|1176176_1177469_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_001459704.1|1177481_1179146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000471482.1|1179316_1181623_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000097802.1|1181686_1182547_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123448.1|1182778_1183369_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039895.1|1183350_1184301_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632280.1|1184401_1185715_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206197.1|1185741_1186947_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|1186946_1187369_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973371.1|1187358_1188786_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969784.1|1188787_1189576_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|1189575_1190343_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_033803224.1|1190339_1191410_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189201.1|1191417_1191915_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|1191929_1192676_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|1192684_1192972_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191077.1|1192983_1193913_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186468.1|1194197_1196243_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535466.1|1196490_1198764_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|1198821_1200321_-	NAD-dependent phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067519.1|1200556_1201462_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001300734.1|1201633_1201960_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|1201967_1202153_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_033803092.1|1202149_1204789_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762236.1|1204996_1205986_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_001298828.1|1206096_1206519_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|1206515_1206782_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628243.1|1207055_1210580_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837924.1|1210946_1212080_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001300461.1|1212220_1212655_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000938107.1|1213915_1214485_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_095111390.1|1215614_1215746_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
WP_000950813.1|1216092_1217073_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001371738.1|1217249_1217519_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	9.3e-44
WP_106912650.1|1217520_1218834_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	95.7	2.1e-72
WP_001408020.1|1218898_1219522_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.7e-69
WP_000515030.1|1219590_1223067_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.7	0.0e+00
WP_000649829.1|1223200_1223728_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_122991560.1|1223914_1224547_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.6	1.9e-103
WP_001299882.1|1225240_1225939_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
WP_000847304.1|1225938_1226268_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082490.1|1226264_1228844_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.1	0.0e+00
WP_000533425.1|1228824_1229238_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_000479084.1|1229264_1229696_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	3.7e-42
WP_000683071.1|1230468_1230864_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_000975037.1|1230860_1231436_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_001204544.1|1231450_1231804_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201528.1|1231796_1232171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522630.1|1232222_1233251_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000256821.1|1233308_1233656_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_106912651.1|1233692_1235198_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.2e-100
WP_001371732.1|1235187_1236780_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	8.4e-185
WP_000259002.1|1236776_1236983_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_106912652.1|1236966_1238895_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	8.8e-261
WP_000235436.1|1238866_1239376_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001300236.1|1239778_1240003_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|1240084_1240399_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1240926_1241112_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1241333_1241447_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_106912653.1|1241667_1242201_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	93.8	1.5e-98
WP_000138558.1|1242360_1242633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411814.1|1242888_1243095_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000874319.1|1243542_1245393_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_000871288.1|1245652_1245988_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	73.8	6.8e-44
WP_000562553.1|1246268_1246400_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000762885.1|1247296_1248118_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.1e-78
WP_000904111.1|1248132_1248489_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
WP_001265044.1|1248501_1249551_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.0e-106
WP_001410105.1|1249552_1249831_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001013636.1|1251346_1251559_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_122358658.1|1251603_1251711_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	93.1	9.4e-08
WP_001429093.1|1252169_1252367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371964.1|1253062_1253644_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_000521772.1|1253621_1254503_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001151144.1|1255036_1255495_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	8.9e-63
WP_001262367.1|1255535_1256606_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	3.8e-64
WP_000693867.1|1256677_1257103_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|1257086_1257329_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_024173647.1|1257720_1258059_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	1.5e-06
WP_032355724.1|1258351_1258504_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_001340571.1|1258515_1258890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|1259421_1259610_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090198.1|1259606_1259798_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048420.1|1259890_1262362_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000067202.1|1262420_1262624_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
1262481:1262495	attL	AGCCACCAGCGAAAA	NA	NA	NA	NA
WP_000533619.1|1262623_1263649_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_001143784.1|1264157_1264799_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|1264880_1265510_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_033814039.1|1265582_1266158_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	4.1e-89
WP_001023994.1|1266270_1266540_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	96.6	1.9e-44
WP_106912654.1|1266541_1267855_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_001216290.1|1267919_1268543_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_106912655.1|1268611_1272088_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.2	0.0e+00
WP_139839058.1|1272334_1272967_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.9	5.9e-97
WP_106912657.1|1272912_1273656_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	9.5e-147
WP_106912658.1|1273660_1274359_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	2.4e-131
WP_000847298.1|1274358_1274688_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081762.1|1274684_1277297_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	91.9	0.0e+00
WP_000533440.1|1277277_1277691_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_100008885.1|1277717_1278140_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	4.8e-71
WP_000235098.1|1278153_1278906_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000683137.1|1278913_1279309_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000985123.1|1279305_1279884_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	1.7e-79
WP_000752960.1|1279895_1280249_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_000158895.1|1280260_1280656_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	93.2	4.5e-55
WP_001552792.1|1280697_1281723_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.1	2.3e-191
WP_001549228.1|1281778_1282111_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000123234.1|1282120_1283440_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.1e-233
WP_001443752.1|1283420_1285022_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000198153.1|1285018_1285225_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027379.1|1285221_1287147_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453587.1|1287121_1287667_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001082545.1|1288108_1288576_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	99.3	2.9e-77
WP_000087714.1|1288874_1289408_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001072901.1|1289412_1289628_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|1289705_1289951_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143463.1|1289991_1290171_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_000023293.1|1290306_1292244_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_000466957.1|1292721_1293153_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000640158.1|1293714_1294269_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000247761.1|1294265_1294556_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000940319.1|1294555_1295155_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000138556.1|1295654_1297046_+	ATPase	NA	NA	NA	NA	NA
WP_000016656.1|1297045_1298035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365100.1|1299584_1299830_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_000208018.1|1299908_1300070_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000224233.1|1300080_1300344_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_042350895.1|1300345_1300510_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000935420.1|1300595_1300808_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001141110.1|1300913_1301336_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000450712.1|1301351_1302113_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_000788980.1|1302135_1302882_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_001304174.1|1302888_1303677_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|1303754_1304177_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|1304173_1304428_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|1304507_1304927_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001326317.1|1305169_1305349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000373334.1|1305609_1306056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|1306759_1306948_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|1306944_1307136_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_064754629.1|1307229_1309932_+	hypothetical protein	NA	Q9QF34	Lambdoid_phage	97.7	2.1e-172
WP_000166313.1|1309924_1310734_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|1310789_1310939_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|1310976_1311165_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|1311264_1311480_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|1311481_1312717_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001157406.1|1312768_1313704_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
1312976:1312990	attR	TTTTCGCTGGTGGCT	NA	NA	NA	NA
WP_000123737.1|1313832_1315206_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|1315683_1316667_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|1316921_1318154_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 7
NZ_CP027355	Escherichia coli strain 2013C-4991 chromosome, complete genome	5367251	1516220	1583777	5367251	terminase,holin,integrase,transposase,head,capsid,tRNA,tail	Escherichia_phage(32.76%)	78	1524411:1524425	1583879:1583893
WP_001297484.1|1516220_1517327_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|1517362_1518004_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|1518007_1519378_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|1519545_1520217_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735411.1|1520216_1521677_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|1521752_1522874_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359441.1|1522922_1524149_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|1524398_1525535_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
1524411:1524425	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799399.1|1525518_1526382_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001132165.1|1526655_1527246_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_001144080.1|1527428_1528079_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001299273.1|1528153_1529212_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_012816780.1|1529339_1529975_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001118085.1|1530042_1530624_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_001131646.1|1530914_1531490_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	61.1	1.4e-57
WP_001023432.1|1531602_1531872_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	5.4e-44
WP_106912659.1|1531873_1533187_-|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.5	7.7e-75
WP_001230428.1|1533251_1533851_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_159032752.1|1533917_1536425_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	97.6	0.0e+00
WP_047085664.1|1537630_1538263_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.7	2.5e-103
WP_000194787.1|1538208_1538952_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.1e-146
WP_001368648.1|1538962_1539661_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	6.8e-131
WP_000807964.1|1539660_1540002_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_106912660.1|1539994_1543237_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.1	0.0e+00
WP_001513217.1|1543284_1543494_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030043.1|1543589_1543964_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275471.1|1543969_1544686_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_000133388.1|1544751_1545096_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573360.1|1545092_1545539_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	98.0	1.3e-74
WP_001007901.1|1545535_1545886_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|1545896_1546223_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001063023.1|1548749_1548971_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_106912661.1|1549015_1550938_-|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	96.7	0.0e+00
WP_000080195.1|1550957_1552571_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|1552601_1552952_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|1552948_1553374_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001368604.1|1553556_1555218_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.3	0.0e+00
WP_000958355.1|1555214_1555778_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	78.0	1.4e-65
WP_000829190.1|1556067_1556433_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	1.1e-63
WP_033803220.1|1556474_1556660_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	92.3	7.5e-21
WP_000347013.1|1556789_1556930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|1557286_1557511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|1557575_1557782_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_001003112.1|1558428_1558962_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_000138558.1|1559121_1559394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159032750.1|1559642_1559855_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	1.7e-29
WP_106912663.1|1560147_1561998_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000216623.1|1562405_1562573_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	74.5	1.1e-10
WP_001380362.1|1562569_1563001_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000611213.1|1564820_1565870_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	88.5	4.0e-183
WP_000917767.1|1566020_1566218_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000640023.1|1566530_1567073_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.3	1.4e-67
WP_000140011.1|1567081_1567447_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	6.7e-37
WP_001265092.1|1567447_1568503_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_001341382.1|1568504_1568783_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_000882662.1|1568950_1569163_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000156213.1|1569663_1570761_+	hypothetical protein	NA	A0A0U2S621	Escherichia_phage	99.7	9.5e-212
WP_001204666.1|1570720_1571299_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_001002672.1|1571604_1571916_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	97.1	1.1e-59
WP_000004322.1|1571908_1572163_-	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	94.0	4.8e-42
WP_106912664.1|1572159_1572582_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.2	2.8e-63
WP_077252119.1|1572597_1573215_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	65.0	1.2e-62
WP_089616028.1|1573286_1574499_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_072130322.1|1574714_1575257_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_001262344.1|1575168_1576185_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	76.1	1.2e-88
WP_000693918.1|1576256_1576682_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048458.1|1576665_1576941_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000824162.1|1577048_1577549_+	helix-turn-helix transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	54.5	1.4e-16
WP_000100896.1|1577566_1577758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014966210.1|1577757_1578048_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379581.1|1578317_1578473_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	4.0e-07
WP_001171975.1|1578632_1578851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122999420.1|1578854_1579019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|1579418_1579607_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|1579603_1579795_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_106912665.1|1579887_1582359_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000003742.1|1582420_1582690_+	excisionase	NA	NA	NA	NA	NA
WP_000074983.1|1582658_1583777_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
1583879:1583893	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 8
NZ_CP027355	Escherichia coli strain 2013C-4991 chromosome, complete genome	5367251	1806448	1863180	5367251	protease,holin,integrase,terminase,head,capsid,tail	Stx2-converting_phage(36.36%)	68	1811122:1811181	1862255:1862319
WP_000003671.1|1806448_1807036_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|1807032_1807740_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|1807758_1809552_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|1809548_1810667_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
1811122:1811181	attL	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCA	NA	NA	NA	NA
WP_095585410.1|1811262_1811415_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
WP_000938124.1|1811791_1813153_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_001023483.1|1813607_1813877_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
WP_000624622.1|1815504_1815852_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1815851_1816529_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_106912667.1|1816584_1817898_-|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	98.2	2.2e-77
WP_001230428.1|1817962_1818562_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_106912668.1|1818628_1822102_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.7	0.0e+00
WP_122991560.1|1822347_1822980_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.6	1.9e-103
WP_001356665.1|1822925_1823669_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	100.0	3.7e-151
WP_032162127.1|1823679_1824378_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.8e-131
WP_000807954.1|1824377_1824719_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212798.1|1824711_1827954_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	98.6	0.0e+00
WP_143191266.1|1828005_1828215_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	98.6	2.8e-32
WP_001030063.1|1828310_1828685_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275479.1|1828690_1829407_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133393.1|1829474_1829819_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|1829815_1830262_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007889.1|1830258_1830609_-|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000125984.1|1830619_1830946_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|1833472_1833694_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173079.1|1833738_1835676_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_001399867.1|1835739_1837401_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_000958380.1|1837397_1837961_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000279796.1|1838253_1838619_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001448509.1|1838660_1838885_+	YlcI/YnfO family protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_001302717.1|1838966_1839281_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|1839806_1839992_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000455402.1|1840219_1840369_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_001056883.1|1840368_1840938_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000087714.1|1841212_1841746_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001072901.1|1841750_1841966_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|1842043_1842289_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143463.1|1842329_1842509_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_000023293.1|1842644_1844582_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_000466957.1|1845060_1845492_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000301785.1|1845941_1846655_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917770.1|1846789_1846987_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640048.1|1847228_1847759_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_033803259.1|1847767_1848127_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.7	6.2e-35
WP_106912669.1|1848139_1849189_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.2	2.6e-110
WP_001341388.1|1849190_1849469_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000902696.1|1849636_1849849_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_001278454.1|1850037_1850142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208016.1|1850257_1851127_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	79.2	8.5e-123
WP_000224233.1|1851137_1851401_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000209148.1|1851402_1851621_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_000935424.1|1851653_1851866_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	95.7	2.8e-35
WP_001151239.1|1851971_1852394_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	1.1e-64
WP_000450998.1|1852409_1853180_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_000788950.1|1853201_1853948_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000095671.1|1853954_1854917_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693888.1|1854939_1855365_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391950.1|1855348_1855630_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362153.1|1855730_1856150_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000379589.1|1856415_1856571_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171930.1|1856730_1856949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394532.1|1856971_1857346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|1857865_1858054_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199473.1|1858050_1858239_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_052924991.1|1858334_1860806_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	1.9e-58
WP_032256979.1|1860873_1861116_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|1861093_1862113_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375136.1|1862520_1863180_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
1862255:1862319	attR	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAAATAA	NA	NA	NA	NA
>prophage 9
NZ_CP027355	Escherichia coli strain 2013C-4991 chromosome, complete genome	5367251	2087471	2138506	5367251	protease,lysis,portal,holin,integrase,terminase,head,capsid,transposase,tail	Enterobacteria_phage(54.84%)	70	2080777:2080791	2146991:2147005
2080777:2080791	attL	CAGGCCATCTTCCAG	NA	NA	NA	NA
WP_001247928.1|2087471_2088170_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|2088400_2089282_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|2089450_2089612_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_001592261.1|2090107_2091127_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|2091160_2092141_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001101707.1|2092317_2092587_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
WP_106912670.1|2092588_2093902_-|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.0	3.4e-75
WP_101979755.1|2093966_2094566_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	97.5	1.7e-109
WP_101979756.1|2094632_2098031_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	87.8	0.0e+00
WP_071781836.1|2098091_2098724_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.6	1.6e-94
WP_032144726.1|2098660_2099404_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	1.9e-147
WP_001152612.1|2099408_2100107_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847345.1|2100106_2100436_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_053896164.1|2100432_2103012_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.7	0.0e+00
WP_000533425.1|2102992_2103406_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_000479105.1|2103432_2103864_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_001143019.1|2103877_2104630_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	1.4e-126
WP_000683065.1|2104637_2105033_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_053896163.1|2105029_2105563_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.3e-57
WP_033803395.1|2105922_2106306_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_101979757.1|2106357_2107386_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	2.3e-114
WP_000256821.1|2107443_2107791_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_033803399.1|2107827_2109054_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.9	1.7e-76
WP_044696974.1|2109032_2109332_-	hypothetical protein	NA	E4WL22	Enterobacteria_phage	54.3	2.4e-16
WP_053896161.1|2109321_2110914_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	2.2e-185
WP_000259002.1|2110910_2111117_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_053896160.1|2111100_2113029_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	7.9e-262
WP_000235436.1|2113000_2113510_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001307652.1|2113904_2114099_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881338.1|2114286_2114904_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.4	1.2e-91
WP_000080195.1|2114989_2116603_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|2116633_2116984_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|2116980_2117406_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_024223034.1|2117593_2118031_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	99.3	8.5e-71
WP_000075135.1|2118027_2118525_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	1.3e-91
WP_024164617.1|2118524_2118740_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_101979759.1|2119178_2121029_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000499454.1|2121327_2121486_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|2121571_2122315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|2122499_2123189_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|2123203_2123326_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|2123663_2124623_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028841.1|2124834_2125500_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.4	4.4e-127
WP_001108038.1|2125496_2126108_-	recombination protein NinG	NA	Q716C3	Shigella_phage	99.5	6.0e-99
WP_000566868.1|2126100_2126271_-	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	98.2	1.2e-25
WP_001254222.1|2126267_2126450_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_000153262.1|2126446_2126974_-	phage N-6-adenine-methyltransferase	NA	Q8H9Z7	Enterobacteria_phage	99.4	3.6e-100
WP_000736898.1|2126970_2127411_-	recombination protein NinB	NA	Q8H9Z8	Enterobacteria_phage	100.0	4.1e-81
WP_000145926.1|2127484_2127775_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_052896138.1|2127771_2128473_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_053896809.1|2128469_2129369_-	replication protein	NA	M1FN81	Enterobacteria_phage	99.3	1.4e-173
WP_001177650.1|2129403_2129682_-	transcriptional regulator	NA	K7P7A2	Enterobacteria_phage	100.0	1.6e-43
WP_000276886.1|2129790_2129976_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_001095981.1|2130056_2130707_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	98.6	4.1e-122
WP_033803619.1|2131020_2131293_+	hypothetical protein	NA	K7PH69	Enterobacterial_phage	95.6	1.1e-25
WP_106912671.1|2131351_2131822_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.1e-87
WP_000065384.1|2131972_2132341_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	98.4	2.2e-64
WP_001198860.1|2132413_2132578_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372923.1|2132546_2132690_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_000995439.1|2132765_2133062_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|2133067_2133853_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_024236337.1|2133849_2134530_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	97.3	7.4e-130
WP_024236336.1|2134526_2134685_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	98.1	4.0e-23
WP_000581109.1|2134681_2135434_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	100.0	6.4e-151
WP_000151207.1|2135441_2135657_+	hypothetical protein	NA	M1FPM2	Enterobacteria_phage	97.2	8.5e-32
WP_000763367.1|2135755_2135977_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_000120064.1|2136187_2136790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|2137032_2137200_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|2137239_2137458_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533642.1|2137435_2138506_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
2146991:2147005	attR	CAGGCCATCTTCCAG	NA	NA	NA	NA
>prophage 10
NZ_CP027355	Escherichia coli strain 2013C-4991 chromosome, complete genome	5367251	2608514	2697361	5367251	lysis,portal,holin,integrase,terminase,head,capsid,transposase,tail	Enterobacteria_phage(29.41%)	83	2635352:2635398	2682697:2682743
WP_000131044.1|2608514_2610548_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_033803456.1|2610676_2611264_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|2611277_2612750_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159095.1|2612763_2614434_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|2614646_2615315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|2615557_2616253_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|2616245_2617673_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|2617683_2618403_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|2618929_2619784_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046307.1|2620009_2621335_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|2621443_2621680_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|2621691_2622285_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_032142119.1|2623114_2624059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000947155.1|2628770_2629721_-	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_000951129.1|2630090_2630405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001460375.1|2633901_2634888_-	ATP-binding protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	27.6	4.8e-13
2635352:2635398	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000633074.1|2636065_2637172_-	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_033803116.1|2637754_2638675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000011690.1|2639125_2639764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000017384.1|2639760_2641749_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_033803117.1|2642302_2642887_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	2.2e-106
WP_106912677.1|2642886_2646126_-|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	59.9	1.2e-81
WP_052968575.1|2646190_2646790_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.7e-109
WP_106912678.1|2646856_2650339_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_122987463.1|2650399_2651002_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	3.1e-87
WP_097306820.1|2650938_2651682_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	3.6e-146
WP_000847352.1|2652384_2652714_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	1.1e-57
WP_106912679.1|2652710_2655290_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.7	0.0e+00
WP_000459480.1|2655282_2655717_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_033803353.1|2655698_2656121_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	6.9e-70
WP_001439072.1|2656136_2656877_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	4.0e-129
WP_000683143.1|2656884_2657280_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_000985123.1|2657276_2657855_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	1.7e-79
WP_000752994.1|2657866_2658220_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158895.1|2658231_2658627_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	93.2	4.5e-55
WP_106912680.1|2658668_2659694_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	1.7e-186
WP_001299443.1|2659749_2660082_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123234.1|2660091_2661411_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.1e-233
WP_074578639.1|2661391_2662993_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	2.1e-308
WP_000198153.1|2662989_2663196_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_096149050.1|2663192_2665118_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453587.1|2665092_2665638_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001307652.1|2666026_2666221_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_001298464.1|2666583_2666877_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000839596.1|2667862_2668078_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|2668145_2669198_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|2669348_2669552_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_033803569.1|2669817_2670744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033803570.1|2670730_2671279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033803571.1|2671291_2671633_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	89.4	1.6e-56
WP_021530631.1|2671650_2672640_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	2.5e-195
WP_021542882.1|2672647_2673445_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	4.4e-150
WP_000767113.1|2673464_2673854_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210153.1|2673850_2674177_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	2.7e-53
WP_001440426.1|2674176_2674671_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.0	1.6e-86
WP_000104943.1|2674667_2675609_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	4.9e-140
WP_001250269.1|2675598_2675778_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515851.1|2675953_2676511_-	protein YmfL	NA	S5FXP0	Shigella_phage	96.8	1.1e-96
WP_000649477.1|2676554_2676755_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|2676845_2677520_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000559916.1|2677734_2678250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000081287.1|2679146_2679971_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008200.1|2680098_2680635_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|2680625_2680988_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206734.1|2680987_2681293_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	2.6e-50
WP_000433939.1|2681292_2681643_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_000051887.1|2681519_2682683_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893279.1|2682887_2684141_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	2.2e-95
2682697:2682743	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|2684152_2685256_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|2685543_2686599_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_000174677.1|2686637_2687039_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|2687096_2688341_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|2688432_2688891_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293003.1|2689151_2690609_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001329160.1|2690665_2691202_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001321003.1|2691134_2691401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059847.1|2691634_2692087_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263493.1|2692096_2692495_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|2692497_2692791_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|2692842_2693898_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_033802998.1|2693968_2694739_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_033802984.1|2694698_2696438_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_033802985.1|2696863_2697361_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP027355	Escherichia coli strain 2013C-4991 chromosome, complete genome	5367251	4599273	4707508	5367251	protease,integrase,tRNA,transposase	Stx2-converting_phage(22.73%)	94	4650287:4650300	4698069:4698083
WP_000381383.1|4599273_4600845_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.9e-169
WP_000624622.1|4600864_4601212_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|4601211_4601889_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000609742.1|4614213_4614888_-	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_000953025.1|4614936_4615926_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	6.3e-98
WP_025380683.1|4616533_4618183_-	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_025380681.1|4624032_4624380_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	5.9e-43
WP_001341423.1|4624376_4625051_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_025380679.1|4626041_4627307_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	2.6e-80
WP_000779483.1|4627770_4628097_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001143297.1|4628093_4628357_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001280433.1|4628428_4629295_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839291.1|4629379_4629577_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761677.1|4629588_4630077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854735.1|4630073_4630451_-	toxin	NA	NA	NA	NA	NA
WP_001285415.1|4630497_4630872_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692309.1|4630951_4631173_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_001366855.1|4631235_4631712_-	RadC family protein	NA	NA	NA	NA	NA
WP_000844100.1|4631727_4632207_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001175148.1|4632288_4633107_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	40.1	2.5e-47
WP_001278287.1|4633196_4633430_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_001562086.1|4633435_4634113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000010403.1|4634231_4635116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000147745.1|4635300_4636431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023155732.1|4637974_4638706_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000991602.1|4639062_4639635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958153.1|4639703_4639940_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001167455.1|4640140_4640689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001323514.1|4640706_4640955_-	osmoprotectant transport activator ProQ	NA	Q2A0A1	Sodalis_phage	39.1	8.3e-07
WP_001323513.1|4641023_4641215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032346664.1|4642807_4642921_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	74.3	1.2e-08
WP_001043260.1|4644554_4645370_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001323507.1|4645456_4645738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000949574.1|4645746_4646334_+	trimethoprim-resistant dihydrofolate reductase DfrA36	NA	U5J9P6	Bacillus_phage	40.5	3.8e-26
WP_000494235.1|4646725_4647172_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_085970005.1|4647195_4647381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|4647608_4649102_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|4649213_4649519_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021038045.1|4649546_4650761_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	29.1	2.5e-19
4650287:4650300	attL	CGGCGATAGGGCCG	NA	NA	NA	NA
WP_032280752.1|4650977_4651700_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
4650287:4650300	attL	CGGCGATAGGGCCG	NA	NA	NA	NA
WP_001138064.1|4651701_4654668_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|4654670_4655231_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|4655356_4655707_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|4655909_4656923_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000381802.1|4657087_4657621_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_001206316.1|4657678_4658470_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_032280803.1|4658749_4659793_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
4659546:4659559	attR	CGGCGATAGGGCCG	NA	NA	NA	NA
WP_000679427.1|4660013_4660361_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
4659546:4659559	attR	CGGCGATAGGGCCG	NA	NA	NA	NA
WP_000259031.1|4660354_4661194_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376618.1|4661321_4661555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000287612.1|4661608_4663147_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.1	7.9e-47
WP_001163403.1|4663228_4664011_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_001324342.1|4664000_4665524_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_001176634.1|4665618_4665867_+	MerR family DNA-binding protein	NA	NA	NA	NA	NA
WP_001347502.1|4665856_4666099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072161421.1|4666129_4667098_-|transposase	IS91-like element ISVsa3 family transposase	transposase	NA	NA	NA	NA
WP_000107666.1|4668873_4669794_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000277213.1|4669961_4671479_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000344909.1|4671539_4672910_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001324288.1|4672909_4674319_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	23.3	6.6e-16
WP_001232703.1|4674344_4675352_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000335225.1|4675903_4676377_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001389182.1|4676695_4677433_+	porin family protein	NA	NA	NA	NA	NA
WP_000785678.1|4677852_4678749_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_021514490.1|4678797_4679877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100181.1|4679923_4681495_+	ATP--cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
WP_000766272.1|4681491_4681758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001238004.1|4681897_4682095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000281243.1|4682160_4683834_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000999870.1|4683977_4685021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218741.1|4685454_4686645_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	5.8e-122
WP_000234514.1|4687002_4687710_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_000839760.1|4688107_4690243_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001299430.1|4690292_4691549_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000760323.1|4691750_4692830_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|4692894_4693170_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001321419.1|4693197_4694250_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786911.1|4694410_4695130_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107564.1|4695129_4695456_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984796.1|4695639_4696359_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394131.1|4696534_4697581_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000745217.1|4697697_4698705_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000239928.1|4698859_4699996_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174735.1|4699988_4700582_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277222.1|4700589_4700880_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|4700876_4701443_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001424369.1|4701460_4702165_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001295381.1|4702182_4703163_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017111.1|4703346_4703763_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053178.1|4703762_4704326_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593273.1|4704434_4705385_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001300912.1|4705397_4706129_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286500.1|4706208_4706916_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001300769.1|4707010_4707508_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
>prophage 12
NZ_CP027355	Escherichia coli strain 2013C-4991 chromosome, complete genome	5367251	4944578	4957761	5367251		Escherichia_phage(40.0%)	12	NA	NA
WP_001295182.1|4944578_4945340_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|4945333_4945960_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|4946099_4947239_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|4947301_4948294_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104429.1|4948387_4949752_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|4949840_4950617_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|4950621_4951260_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590404.1|4951256_4952519_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	6.3e-135
WP_000847985.1|4952515_4953424_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001295181.1|4953619_4954387_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141339.1|4954437_4955094_-	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	45.3	5.6e-50
WP_033803637.1|4955199_4957761_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	2.3e-30
>prophage 13
NZ_CP027355	Escherichia coli strain 2013C-4991 chromosome, complete genome	5367251	5302358	5344246	5367251	protease,lysis,portal,coat,holin,transposase	Enterobacteria_phage(48.21%)	58	NA	NA
WP_085947771.1|5302358_5303520_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001300996.1|5304488_5305424_+	DNA-binding transcriptional regulator DsdC	NA	NA	NA	NA	NA
WP_001163428.1|5305607_5305808_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000545734.1|5305865_5306033_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_106912706.1|5306090_5306834_-	hypothetical protein	NA	K7P7Q8	Enterobacteria_phage	98.4	1.7e-143
WP_033803017.1|5307047_5307968_-	DUF551 domain-containing protein	NA	Q08J60	Stx2-converting_phage	95.3	9.5e-80
WP_000951712.1|5307964_5308174_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	92.8	2.0e-33
WP_159032751.1|5308175_5308787_-	ead/Ea22-like family protein	NA	A0A222YWN7	Escherichia_phage	65.5	7.2e-60
WP_033803015.1|5308870_5309038_-	DUF2737 family protein	NA	K7PJY9	Enterobacterial_phage	98.2	3.0e-24
WP_001111298.1|5309048_5309342_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	99.0	1.9e-50
WP_033803014.1|5309844_5310318_-	single-stranded DNA-binding protein	NA	G8EYH4	Enterobacteria_phage	97.5	3.9e-61
WP_033803013.1|5310318_5311026_-	recombinase	NA	K7PKU3	Enterobacteria_phage	99.1	1.1e-136
WP_001243350.1|5311280_5311433_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.1e-20
WP_000638547.1|5311417_5311549_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_033803012.1|5311573_5312542_-	hypothetical protein	NA	G5DA88	Enterobacteria_phage	99.4	1.7e-55
WP_024236517.1|5312685_5313156_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	2.4e-87
WP_000340008.1|5313164_5313491_-	antitermination protein	NA	A4KWR0	Enterobacteria_phage	100.0	2.7e-53
WP_001519589.1|5313983_5314679_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.5	1.3e-129
WP_033803110.1|5314754_5314970_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	97.2	4.1e-34
WP_000251073.1|5315089_5315383_+	hypothetical protein	NA	K7P6Y2	Enterobacteria_phage	100.0	2.8e-46
WP_001608293.1|5315563_5316385_+	replication protein	NA	K7PJZ3	Enterobacterial_phage	99.6	2.0e-153
WP_001248388.1|5316381_5317758_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_023351780.1|5317830_5318037_+	hypothetical protein	NA	A0A2I6PIF1	Escherichia_phage	97.1	6.0e-27
WP_085458232.1|5318044_5318491_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	90.5	2.2e-74
WP_106912625.1|5318487_5319015_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	99.4	2.1e-100
WP_001254255.1|5319011_5319188_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_001543886.1|5319190_5319592_+	hypothetical protein	NA	K7PJK0	Enterobacteria_phage	98.5	6.0e-71
WP_021514114.1|5319551_5319761_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.0e-30
WP_033803109.1|5319753_5320476_+	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	94.6	1.6e-122
WP_000002243.1|5320475_5320766_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_001008199.1|5320762_5321125_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000994516.1|5321121_5321310_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001235459.1|5321306_5321930_+	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_032145908.1|5322070_5322253_-	hypothetical protein	NA	A0A088CPS7	Enterobacteria_phage	93.3	4.5e-26
WP_000783734.1|5322363_5322687_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_106912626.1|5322670_5323147_+	glycoside hydrolase family protein	NA	C6ZR65	Salmonella_phage	99.4	4.9e-88
WP_106912627.1|5323143_5323581_+|lysis	lysis protein	lysis	Q9MCN3	Enterobacteria_phage	97.2	1.9e-70
WP_000807788.1|5324187_5324430_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_061089153.1|5324465_5324915_+	hypothetical protein	NA	A0A2K8HN72	Pseudomonas_phage	40.0	3.5e-19
WP_106912693.1|5324883_5326332_+	DNA packaging protein	NA	Q2A0C1	Sodalis_phage	75.8	1.6e-222
WP_096057893.1|5326332_5328498_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.4	0.0e+00
WP_000373006.1|5328511_5329423_+	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	100.0	1.3e-161
WP_001196946.1|5329422_5330718_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	99.3	9.4e-243
WP_106912707.1|5330770_5331349_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	61.0	5.2e-60
WP_106912694.1|5331326_5331827_+	recombinase RmuC	NA	G8EYJ2	Enterobacteria_phage	98.8	2.5e-90
WP_001122391.1|5331826_5333245_+	Packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	99.6	2.7e-275
WP_106912695.1|5333244_5334093_+	hypothetical protein	NA	Q716G6	Shigella_phage	98.6	4.8e-102
WP_106912696.1|5334092_5334548_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	97.4	1.4e-84
WP_106912697.1|5334550_5335246_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	98.3	1.0e-89
WP_106912698.1|5335255_5336662_+	acyltransferase	NA	I6RSG0	Salmonella_phage	55.8	1.1e-127
WP_069190972.1|5336661_5338506_+	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	72.3	8.1e-240
WP_016231948.1|5338520_5339006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106912699.1|5339040_5339406_+	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	98.3	2.4e-66
WP_001085430.1|5339419_5339599_-	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
WP_000090240.1|5339698_5339950_-	Arc family DNA-binding protein	NA	B9UDL4	Salmonella_phage	98.8	4.9e-39
WP_000677939.1|5340040_5340202_+	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	98.1	2.7e-22
WP_033803113.1|5340270_5341200_+	antirepressor	NA	A5VW58	Enterobacteria_phage	90.6	1.1e-160
WP_089519334.1|5343448_5344246_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	39.8	3.8e-16
>prophage 1
NZ_CP027356	Escherichia coli strain 2013C-4991 plasmid unnamed1	71714	4981	16766	71714	transposase,protease	Stx2-converting_phage(83.33%)	9	NA	NA
WP_001034100.1|4981_8884_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_136139077.1|9821_10241_-	DUF1449 family protein	NA	NA	NA	NA	NA
WP_001341423.1|10171_10846_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|10842_11190_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_012917687.1|11193_12762_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000937603.1|13040_14228_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_159032754.1|14285_14585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000612591.1|14830_15178_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000997984.1|15227_16766_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.0e-296
>prophage 2
NZ_CP027356	Escherichia coli strain 2013C-4991 plasmid unnamed1	71714	36443	44524	71714	integrase,transposase	Stx2-converting_phage(85.71%)	9	NA	NA
WP_000381383.1|36443_38015_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.9e-169
WP_000624622.1|38034_38382_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|38381_39059_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001165114.1|39199_39745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000704534.1|40506_41367_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
WP_001066949.1|41493_41880_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001341423.1|41933_42608_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|42604_42952_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_012917687.1|42955_44524_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
>prophage 1
NZ_CP027357	Escherichia coli strain 2013C-4991 plasmid unnamed2	131463	17722	79889	131463	bacteriocin,transposase,integrase,protease	Macacine_betaherpesvirus(25.0%)	41	40018:40032	64127:64141
WP_000016493.1|17722_18514_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
WP_000864812.1|18691_19045_+	colicin M immunity protein	NA	NA	NA	NA	NA
WP_001312845.1|19094_19910_-|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000203272.1|20153_20681_+	colicin B immunity protein	NA	NA	NA	NA	NA
WP_001105066.1|21038_21320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014640552.1|21783_22020_+	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001259758.1|21997_22309_+	colicin V	NA	NA	NA	NA	NA
WP_109045958.1|22478_24593_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	3.6e-34
WP_012006529.1|24567_25809_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_106912713.1|26038_27267_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.0	7.5e-173
WP_000738422.1|27893_28187_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001318220.1|31332_32448_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_001312839.1|32461_36247_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.3e-45
WP_000933675.1|36350_37580_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_000271276.1|37664_38621_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
40018:40032	attL	AGATATTCCCCTGGC	NA	NA	NA	NA
WP_000142437.1|43288_43636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001311056.1|43937_44420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106912714.1|44536_45385_-	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	38.5	8.6e-27
WP_000969990.1|45430_45712_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000079941.1|45708_45978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450494.1|48958_50152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024133197.1|53313_53460_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	7.0e-06
WP_085949156.1|53425_54639_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	6.0e-167
WP_001312823.1|54822_54981_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000280980.1|56253_57207_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_000771475.1|57639_58749_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000175738.1|58811_59720_+	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_014640565.1|60093_60282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066954.1|60402_61143_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_000361611.1|61427_62405_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_001376274.1|63917_64154_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	57.9	3.1e-19
64127:64141	attR	AGATATTCCCCTGGC	NA	NA	NA	NA
WP_000949004.1|65386_66301_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983710.1|66300_67128_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_000992806.1|67124_67982_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968140.1|67978_68836_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000190053.1|70119_70599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000238252.1|70716_71166_+	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	67.1	5.0e-42
WP_000715078.1|71782_73285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001238646.1|74425_75592_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
WP_000817028.1|75591_76563_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
WP_000082154.1|78917_79889_-|transposase	IS110-like element ISEc32 family transposase	transposase	Q75QL1	Wolbachia_phage	32.1	1.1e-25
>prophage 1
NZ_CP027358	Escherichia coli strain 2013C-4991 plasmid unnamed3, complete sequence	110001	581	67048	110001	portal,tRNA	Salmonella_phage(86.96%)	76	NA	NA
WP_033803025.1|581_1457_-	hypothetical protein	NA	J9Q710	Salmonella_phage	93.8	1.2e-153
WP_106912717.1|2383_3964_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	91.8	1.1e-282
WP_021512329.1|3990_5247_-	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	96.7	5.7e-245
WP_000176292.1|6073_6340_-	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_000129633.1|6349_7240_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.6	2.6e-167
WP_001717191.1|7236_7902_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.6	2.8e-110
WP_021512330.1|7898_8567_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	89.6	9.5e-106
WP_096165294.1|8566_9268_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	86.7	1.3e-108
WP_033803020.1|9332_10892_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.5	2.9e-278
WP_001291060.1|10894_11173_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	62.6	2.2e-24
WP_024171469.1|11241_11664_+	hypothetical protein	NA	J9Q806	Salmonella_phage	77.1	4.8e-55
WP_000208379.1|11668_12193_+	hypothetical protein	NA	J9Q6L0	Salmonella_phage	82.4	2.8e-68
WP_001717186.1|12325_12505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033803019.1|12788_13439_+	hypothetical protein	NA	J9Q754	Salmonella_phage	84.7	6.4e-99
WP_000255469.1|13487_13691_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	91.0	5.9e-27
WP_000497809.1|13711_13942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001009193.1|14558_15041_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	7.9e-62
WP_050575777.1|15391_15802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001717183.1|15883_16279_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	53.8	1.6e-31
WP_000749406.1|16405_16717_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	64.1	3.3e-29
WP_021533329.1|16870_17200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047659412.1|18770_19961_-	hypothetical protein	NA	J9Q803	Salmonella_phage	55.6	3.1e-123
WP_052078165.1|20131_20353_-	hypothetical protein	NA	J9Q750	Salmonella_phage	52.2	3.3e-15
WP_001718028.1|20592_22626_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
WP_000004356.1|22783_23884_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_000506720.1|23921_24311_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	93.0	8.6e-67
WP_077777003.1|25107_25776_-	hypothetical protein	NA	A0A0F6TJ66	Escherichia_coli_O157_typing_phage	93.1	5.9e-23
WP_077777002.1|25775_26429_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	78.7	2.0e-44
WP_001355905.1|26428_26614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033803596.1|26610_27141_-	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	73.5	8.2e-36
WP_000213527.1|27137_27461_-	hypothetical protein	NA	A0A222YZB4	Escherichia_phage	90.2	3.8e-44
WP_052080892.1|27457_27859_-	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	50.0	3.0e-30
WP_021533173.1|27855_28356_-	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	57.3	3.8e-14
WP_001718093.1|28355_28898_-	hypothetical protein	NA	J9Q748	Salmonella_phage	86.9	1.0e-86
WP_033803595.1|28894_29536_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	86.9	1.2e-97
WP_021520153.1|29655_30036_-	hypothetical protein	NA	J9Q801	Salmonella_phage	67.4	1.7e-27
WP_033803594.1|30035_30740_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	76.4	1.2e-87
WP_033803593.1|30798_32487_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	92.3	0.0e+00
WP_033803592.1|32628_33195_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	64.2	5.3e-57
WP_000893470.1|33334_33493_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000900261.1|33492_33918_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	78.7	5.7e-56
WP_014962274.1|34011_34200_-	hypothetical protein	NA	J9Q800	Salmonella_phage	51.6	9.4e-11
WP_033803591.1|34209_34704_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	55.4	2.0e-23
WP_001404443.1|34852_35443_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	83.8	3.7e-93
WP_032203380.1|36026_36257_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	85.5	2.0e-31
WP_033803590.1|36441_37035_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.8	1.7e-98
WP_033803589.1|37217_38027_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.2	2.6e-65
WP_021520508.1|38187_38745_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	83.6	3.3e-88
WP_014962280.1|38754_39174_-	hypothetical protein	NA	J9Q743	Salmonella_phage	71.2	9.3e-51
WP_000386470.1|39235_39880_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	81.8	4.6e-97
WP_014962281.1|39879_40356_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	89.2	1.3e-80
WP_033803588.1|40352_40766_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	86.1	3.6e-63
WP_106912718.1|40767_41898_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	87.5	4.6e-193
WP_001011861.1|42042_42912_-	hypothetical protein	NA	J9Q742	Salmonella_phage	80.6	5.3e-133
WP_000122502.1|42989_44132_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
WP_024219431.1|44232_46548_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.4	0.0e+00
WP_000037962.1|46621_47191_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	1.1e-91
WP_033803586.1|47200_47944_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	47.2	6.7e-52
WP_106912719.1|47933_49850_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	72.7	3.2e-247
WP_087507381.1|49846_50038_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	76.2	3.7e-23
WP_000174803.1|50079_51165_-	exonuclease	NA	J9Q7S9	Salmonella_phage	87.5	8.0e-187
WP_000364573.1|51419_52064_-	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
WP_029783995.1|52385_53480_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.1	1.1e-74
WP_001229345.1|54059_54272_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
WP_000644408.1|54271_54607_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	6.6e-39
WP_001265407.1|54822_55098_-	hypothetical protein	NA	J9Q738	Salmonella_phage	75.8	4.0e-34
WP_024219436.1|55153_55570_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	76.9	7.6e-61
WP_000715581.1|55670_56501_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
WP_021533191.1|56504_56705_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	59.1	7.2e-09
WP_001051807.1|56797_59137_-	recombinase RecA	NA	J9Q736	Salmonella_phage	85.1	1.8e-29
WP_000920224.1|59139_59406_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	77.3	2.6e-30
WP_001755518.1|59405_60350_-	5'-3' exonuclease SAM fold family protein	NA	J9Q7S6	Salmonella_phage	88.9	1.0e-161
WP_001717300.1|60410_61439_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	86.3	1.4e-143
WP_033803583.1|61556_61988_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	87.4	4.0e-65
WP_033803582.1|62113_65632_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	94.3	0.0e+00
WP_033803581.1|65812_67048_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	81.3	5.2e-198
>prophage 2
NZ_CP027358	Escherichia coli strain 2013C-4991 plasmid unnamed3, complete sequence	110001	70194	109546	110001	integrase,tail	Salmonella_phage(83.33%)	38	65367:65382	73167:73182
65367:65382	attL	AATGATTCCATACATC	NA	NA	NA	NA
WP_000797845.1|70194_71298_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
WP_033803579.1|71507_71753_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	43.6	1.3e-12
WP_000200984.1|71749_72100_-	hypothetical protein	NA	Q716B1	Shigella_phage	51.7	7.9e-27
WP_000067985.1|73753_74044_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	79.2	2.4e-37
73167:73182	attR	GATGTATGGAATCATT	NA	NA	NA	NA
WP_000636535.1|74189_74405_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.5	3.3e-20
WP_033803578.1|74401_75724_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	90.9	3.4e-240
WP_000989357.1|75720_75978_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	59.0	3.9e-15
WP_032328860.1|76258_77035_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	41.5	1.9e-52
WP_021512314.1|77160_77574_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	47.7	1.5e-24
WP_097292385.1|77807_78953_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_052080890.1|78944_80126_-	DNA primase	NA	J9Q720	Salmonella_phage	91.1	4.6e-204
WP_000137335.1|80207_81548_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	93.7	2.3e-236
WP_001717320.1|81591_82332_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.6	2.2e-127
WP_033803577.1|82510_84205_-	hypothetical protein	NA	X2KLG0	Campylobacter_phage	24.4	9.1e-12
WP_000062085.1|84256_84616_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
WP_000161228.1|84615_85284_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
WP_001717321.1|85460_86213_-	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	31.1	2.7e-16
WP_000931257.1|86197_86581_-	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	43.3	1.3e-11
WP_001717322.1|86953_87205_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	81.9	1.9e-27
WP_000856758.1|87206_87899_-	membrane protein	NA	J9Q7Y7	Salmonella_phage	93.9	1.4e-123
WP_001717323.1|87912_88236_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	89.7	5.9e-45
WP_032328862.1|88558_89167_-	hypothetical protein	NA	J9Q7G0	Salmonella_phage	73.8	4.5e-78
WP_000120168.1|89166_89421_-	hypothetical protein	NA	J9Q7R5	Salmonella_phage	69.0	6.1e-29
WP_033803600.1|89481_91569_-	chaperone of endosialidase	NA	Q71TP5	Escherichia_phage	69.1	2.2e-60
WP_024269791.1|92413_93097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033803030.1|93731_98357_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	76.3	0.0e+00
WP_001293196.1|98374_98965_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	95.4	8.4e-106
WP_001405045.1|98952_99750_-	hypothetical protein	NA	J9Q7R4	Salmonella_phage	94.0	1.3e-154
WP_106912720.1|99742_100474_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	96.6	1.5e-133
WP_000442113.1|100523_100859_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	3.0e-52
WP_033803029.1|100901_105455_-	tape measure protein	NA	J9Q712	Salmonella_phage	84.4	0.0e+00
WP_001351971.1|105462_105732_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.8	1.7e-34
WP_033803028.1|105812_106130_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	95.2	3.3e-48
WP_001717196.1|106185_106932_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	92.7	8.1e-122
WP_021512326.1|107006_107390_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	81.9	2.3e-56
WP_001027663.1|107854_108199_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
WP_033803027.1|108278_109112_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	91.7	1.8e-141
WP_000801186.1|109111_109546_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.9	1.9e-59
