The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027373	Escherichia coli strain 05-3629 chromosome, complete genome	4904151	46888	117341	4904151	portal,terminase,integrase,capsid,tail,head,tRNA,holin	Escherichia_phage(49.12%)	85	74238:74254	125575:125591
WP_001378857.1|46888_47995_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|48030_48672_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|48675_50046_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|50213_50885_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735406.1|50884_52345_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_021292930.1|53195_53477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047087387.1|53732_54275_-|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	3.0e-33
WP_047087385.1|54548_54884_-|head	head decoration protein	head	NA	NA	NA	NA
WP_047083323.1|54895_55951_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.8	2.3e-69
WP_000796963.1|55950_56157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000126680.1|56394_56805_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_106916349.1|56801_57053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|58661_58961_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_033817307.1|58966_59200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106916131.1|59192_59639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086258130.1|59860_60322_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000953271.1|62084_62273_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_000085265.1|62647_63877_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	1.5e-133
WP_001295435.1|64125_65247_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359463.1|65392_66622_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|66871_68008_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000799399.1|67991_68855_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_022581964.1|69020_69350_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001373129.1|69513_70188_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	3.3e-114
WP_000438830.1|70199_70412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106916133.1|70421_72080_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	53.4	5.9e-72
WP_000078853.1|72223_72364_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_106916135.1|72562_76249_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	87.9	0.0e+00
74238:74254	attL	GTGATGGCGCTGGTCAC	NA	NA	NA	NA
WP_136795098.1|77157_77754_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	72.4	4.0e-79
WP_106916139.1|77699_78443_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	97.6	1.7e-148
WP_106916141.1|78453_79152_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.8	2.0e-130
WP_000847280.1|79151_79481_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_106916143.1|79477_82057_-|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	83.7	0.0e+00
WP_071532372.1|82037_82451_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	2.3e-41
WP_001299690.1|82477_82909_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000235126.1|82924_83674_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.4	1.6e-130
WP_000683074.1|83681_84077_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	2.2e-57
WP_001571311.1|84073_84649_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.3	1.7e-50
WP_001204531.1|84664_85018_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.8e-40
WP_001373367.1|85010_85394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044803575.1|85445_86474_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
WP_000256803.1|86531_86879_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_106916145.1|86915_88421_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	5.1e-99
WP_001441764.1|88410_90003_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.8e-185
WP_000259002.1|89999_90206_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_094083981.1|90189_92160_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	2.1e-262
WP_001102148.1|92089_92638_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.7	1.0e-57
WP_032308174.1|93077_93302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|93387_93573_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|93794_93908_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_062878145.1|94128_94662_-	lysozyme	NA	A0A2R2Z343	Escherichia_phage	94.9	6.9e-99
WP_106916150.1|94796_95084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001041949.1|95172_95964_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000284490.1|95967_96183_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_001290214.1|96260_96506_-	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
WP_000143458.1|96546_96726_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_106916152.1|96875_98813_-	SASA family carbohydrate esterase	NA	S5MDQ7	Escherichia_phage	94.0	0.0e+00
WP_000738072.1|99677_99947_-	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_000649753.1|99958_100918_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_106916154.1|101300_102359_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.6	2.0e-206
WP_000917735.1|102509_102707_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_001367730.1|102949_103480_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	71.4	6.0e-71
WP_106916156.1|103488_103848_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.7	9.5e-36
WP_106916158.1|103860_104910_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	4.5e-110
WP_106916160.1|104911_105184_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	1.1e-12
WP_001398985.1|105350_105563_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	67.1	6.4e-16
WP_001289995.1|105796_106312_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.6	9.5e-37
WP_032284905.1|106477_106660_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	95.0	1.0e-25
WP_072095369.1|106807_107113_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.1	5.8e-50
WP_000017341.1|107109_107427_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.0	1.4e-35
WP_050877165.1|107423_108140_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	3.9e-73
WP_072130322.1|108173_108716_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_028985607.1|108627_109659_-	phage replisome organiser	NA	A0A0U2RT81	Escherichia_phage	69.5	9.9e-86
WP_000693925.1|109727_110153_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_032279888.1|110149_110452_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	1.1e-05
WP_001169685.1|110548_110920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302048.1|110940_111132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|111133_111412_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000367379.1|111702_111855_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.1e-06
WP_032284904.1|111968_112484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|113012_113201_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092784.1|113197_113386_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_032284903.1|113478_115923_+	exonuclease	NA	V5UQJ3	Shigella_phage	57.9	4.2e-175
WP_000003742.1|115984_116254_+	excisionase	NA	NA	NA	NA	NA
WP_000074972.1|116222_117341_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.6	1.5e-82
125575:125591	attR	GTGACCAGCGCCATCAC	NA	NA	NA	NA
>prophage 2
NZ_CP027373	Escherichia coli strain 05-3629 chromosome, complete genome	4904151	699914	754526	4904151	portal,lysis,terminase,protease,integrase,tail,head,tRNA	Enterobacteria_phage(46.15%)	63	699446:699492	744320:744366
699446:699492	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|699914_700868_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_060659252.1|701054_702539_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937502.1|702722_703028_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239874.1|703084_703753_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_120795384.1|704118_704232_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836765.1|704300_704534_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
WP_106916181.1|704850_705441_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.2e-24
WP_072144121.1|705538_705658_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	84.6	3.1e-12
WP_106916183.1|705712_708985_-|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	75.8	0.0e+00
WP_106916185.1|709049_709649_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	9.7e-110
WP_106916187.1|709715_713114_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.8	0.0e+00
WP_000090902.1|713173_713806_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	87.1	1.3e-91
WP_000140738.1|713742_714486_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	3.4e-144
WP_001152619.1|714490_715189_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000847379.1|715188_715518_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_106916189.1|715514_718076_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.5	0.0e+00
WP_106916191.1|718068_718503_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	9.0e-65
WP_000479153.1|718484_718907_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_106916353.1|718922_719663_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	2.9e-132
WP_041124088.1|719670_720066_-	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_106916193.1|720062_720641_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	87.0	4.6e-80
WP_000753019.1|720652_721006_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_087601582.1|721017_721413_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	5.3e-56
WP_001299443.1|722535_722868_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_106916195.1|722877_724197_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	5.8e-232
WP_001356819.1|724177_725779_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000198149.1|725775_725982_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_106916197.1|725978_727904_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453587.1|727878_728424_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001415975.1|728812_729007_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000738423.1|729369_729663_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_106916200.1|729753_729936_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.9e-16
WP_001135274.1|730152_730650_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_000839596.1|730649_730865_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737275.1|731454_732537_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
WP_001204780.1|732725_733109_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_071830202.1|733126_734116_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	3.6e-194
WP_052892388.1|734123_734933_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	5.3e-151
WP_000767113.1|734952_735342_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_052892386.1|735338_735665_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	1.0e-52
WP_072127330.1|735664_736159_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	7.3e-87
WP_052892384.1|736155_737097_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.7	8.6e-153
WP_001250269.1|737086_737266_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_052892383.1|737441_737993_-	hypothetical protein	NA	S5FXP0	Shigella_phage	97.8	7.1e-99
WP_001191674.1|737985_738246_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|738343_739036_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000559922.1|739355_739871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135680.1|740340_740703_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_106916202.1|740768_741593_+	DUF2303 family protein	NA	U5P439	Shigella_phage	98.5	3.6e-147
WP_106916204.1|741721_742258_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	8.2e-100
WP_096220604.1|742248_742611_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.4	1.7e-64
WP_000206811.1|742610_742916_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	4.9e-49
WP_000433949.1|742915_743287_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.8e-46
WP_052892382.1|743142_744306_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	6.8e-200
WP_000805422.1|744640_745273_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
744320:744366	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001250424.1|745275_745791_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_097447631.1|746820_749430_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000988366.1|749460_750153_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|750372_750915_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729160.1|751395_752262_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|752263_752476_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|752583_753105_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|753140_754526_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 4
NZ_CP027373	Escherichia coli strain 05-3629 chromosome, complete genome	4904151	3148044	3155184	4904151		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|3148044_3148683_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|3148679_3149942_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|3149938_3150847_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|3151042_3151810_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|3151860_3152517_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272898.1|3152622_3155184_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 5
NZ_CP027373	Escherichia coli strain 05-3629 chromosome, complete genome	4904151	3779354	3788796	4904151		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569329.1|3779354_3780281_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.0e-08
WP_000783120.1|3780285_3781017_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|3780997_3781105_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|3781164_3781896_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|3782117_3783803_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|3783799_3784519_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|3784565_3785036_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|3785076_3785538_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001349936.1|3785662_3787663_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_097447575.1|3787659_3788796_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 6
NZ_CP027373	Escherichia coli strain 05-3629 chromosome, complete genome	4904151	3801306	3866416	4904151	portal,lysis,plate,terminase,integrase,capsid,tail,head,tRNA,holin	Escherichia_phage(41.86%)	72	3828542:3828571	3861877:3861906
WP_001295427.1|3801306_3803340_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|3803471_3804581_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|3804843_3805125_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|3805417_3805960_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677395.1|3806040_3806715_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945411.1|3806730_3809211_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001026151.1|3809224_3810259_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|3810340_3810679_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134575.1|3810897_3811722_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|3811841_3812114_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_097447622.1|3812336_3813125_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|3813121_3813922_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_097447621.1|3813986_3814805_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000434038.1|3814856_3815603_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011973.1|3815576_3816542_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846218.1|3816538_3817543_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	1.3e-13
WP_000858484.1|3817539_3818817_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000129551.1|3819073_3820126_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_032178622.1|3820433_3821288_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_032178621.1|3821316_3822579_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_032178620.1|3822588_3823041_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823272.1|3823071_3823356_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|3823359_3824715_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844200.1|3824762_3825803_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|3825902_3826682_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|3826763_3827663_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001352710.1|3828068_3828386_+	hypothetical protein	NA	NA	NA	NA	NA
3828542:3828571	attL	CGTAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985256.1|3828650_3829664_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
WP_001306384.1|3829779_3830079_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|3830193_3830469_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_000217677.1|3830646_3831147_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001277898.1|3831435_3831735_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113264.1|3831737_3831962_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027664.1|3831958_3832234_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_097123866.1|3832223_3834506_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.8	0.0e+00
WP_096252006.1|3834505_3834949_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	91.1	4.1e-73
WP_097123867.1|3835102_3835864_-	hypothetical protein	NA	P79670	Escherichia_phage	83.0	2.2e-114
WP_097123868.1|3836047_3837808_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016233349.1|3838190_3839225_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.1	1.3e-199
WP_000156861.1|3839224_3840997_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085952.1|3841170_3842025_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_001661061.1|3842083_3843157_+|capsid	phage major capsid protein, P2 family	capsid	Q778Z0	Enterobacteria_phage	99.7	1.9e-201
WP_106916275.1|3843160_3843904_+|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	99.6	3.6e-122
WP_000988633.1|3844003_3844513_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|3844512_3844716_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|3844719_3845001_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001530534.1|3845000_3845498_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	9.0e-93
WP_097123873.1|3845512_3845938_+	protein lysA	NA	A0A0F7LDU9	Escherichia_phage	97.2	1.6e-58
WP_001585210.1|3845925_3846351_+|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	95.7	6.1e-66
WP_001406878.1|3846458_3846926_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	6.7e-82
WP_097123874.1|3846918_3847371_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	4.5e-75
WP_089563489.1|3847442_3848228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047669225.1|3848311_3848947_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.2	4.2e-111
WP_047669227.1|3848943_3849291_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	5.0e-58
WP_047669228.1|3849295_3850204_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.3	9.8e-162
WP_001285331.1|3850196_3850727_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	99.4	1.5e-101
WP_097317347.1|3850737_3852924_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	72.0	9.1e-222
WP_047669232.1|3852927_3853455_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	92.6	8.3e-89
WP_047669234.1|3853819_3854845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001286727.1|3855174_3856365_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
WP_032225642.1|3856377_3856896_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
WP_001031303.1|3856952_3857228_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|3857260_3857380_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_106916277.1|3857372_3859820_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.4	0.0e+00
WP_000978889.1|3859834_3860314_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_001597966.1|3860313_3861477_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.7	3.5e-204
WP_000468308.1|3861558_3861777_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476011.1|3862050_3863412_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
3861877:3861906	attR	CGTAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001220181.1|3863514_3863811_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|3863812_3864109_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_032211001.1|3864317_3864653_-	YegP family protein	NA	NA	NA	NA	NA
WP_000125552.1|3864715_3866416_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.4	1.1e-171
>prophage 7
NZ_CP027373	Escherichia coli strain 05-3629 chromosome, complete genome	4904151	4415396	4489794	4904151	portal,lysis,bacteriocin,terminase,protease,integrase,capsid,tail,holin	Shigella_phage(62.34%)	87	4419501:4419517	4447141:4447157
WP_001260828.1|4415396_4416218_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233092.1|4416317_4416401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743946.1|4416493_4416829_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|4417225_4418479_-	MFS transporter	NA	NA	NA	NA	NA
WP_097447590.1|4418585_4419479_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
4419501:4419517	attL	CCGAAAAATGTGCTGTT	NA	NA	NA	NA
WP_000225276.1|4419613_4420834_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|4420958_4421654_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|4421606_4422899_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|4423057_4423672_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|4423714_4424569_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000254426.1|4424570_4425125_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.7	1.4e-62
WP_000051896.1|4425162_4426326_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	100.0	2.2e-227
WP_124034985.1|4426181_4426628_-	helix-turn-helix domain-containing protein	NA	S5FM74	Shigella_phage	73.1	4.2e-41
WP_000497813.1|4426587_4426839_-	DUF4222 domain-containing protein	NA	A0A088CBN9	Shigella_phage	100.0	1.3e-39
WP_000187058.1|4426886_4427567_-	YqaJ viral recombinase family protein	NA	V5UT69	Shigella_phage	100.0	2.1e-132
WP_000100858.1|4427563_4428349_-	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	99.6	1.8e-148
WP_000995035.1|4428354_4428651_-	hypothetical protein	NA	V5URU8	Shigella_phage	99.0	3.3e-50
WP_033814559.1|4428647_4430699_-	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	98.4	0.0e+00
WP_106916288.1|4430807_4431194_-	hypothetical protein	NA	A0A088CBP0	Shigella_phage	95.3	3.0e-64
WP_000560215.1|4431284_4431500_-	cell division protein FtsZ	NA	A0A088CE40	Shigella_phage	98.6	2.8e-35
WP_001005965.1|4431831_4432188_-	hypothetical protein	NA	A0A088CBI5	Shigella_phage	100.0	1.3e-56
WP_000211195.1|4432219_4432933_-	hypothetical protein	NA	A0A088CC14	Shigella_phage	99.6	1.2e-127
WP_000088198.1|4432936_4433209_-	hypothetical protein	NA	A0A088CD31	Shigella_phage	100.0	3.3e-41
WP_106916356.1|4433186_4433318_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	79.1	8.5e-11
WP_000239215.1|4433603_4434374_-	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	100.0	1.5e-147
WP_001068241.1|4434458_4434686_+	hypothetical protein	NA	A0A088CE43	Shigella_phage	100.0	5.4e-37
WP_000084292.1|4434829_4435126_+	hypothetical protein	NA	A0A088CBI6	Shigella_phage	100.0	2.3e-48
WP_050866384.1|4435289_4436372_+	DNA-binding protein	NA	V5URT9	Shigella_phage	99.4	7.0e-207
WP_000790394.1|4436378_4437119_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	100.0	2.5e-139
WP_106888958.1|4437144_4437915_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	99.2	9.5e-134
WP_001151119.1|4437929_4438361_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	100.0	2.5e-75
WP_106916290.1|4438393_4439068_-	DUF4145 domain-containing protein	NA	V5URE2	Shigella_phage	99.6	5.1e-123
WP_000354190.1|4439066_4439312_+	hypothetical protein	NA	A0A088CC19	Shigella_phage	100.0	6.2e-39
WP_001240641.1|4439359_4439665_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	100.0	3.4e-50
WP_000597785.1|4439664_4439943_-	hypothetical protein	NA	A0A2L1IV28	Escherichia_phage	97.8	2.2e-48
WP_032330641.1|4440277_4440592_+	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	75.0	7.0e-35
WP_033817290.1|4440857_4441520_+	antirepressor	NA	A0A088CD42	Shigella_phage	74.4	2.4e-85
WP_047199906.1|4441574_4441985_+	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	100.0	4.2e-72
WP_001254268.1|4441981_4442173_+	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	87.7	8.9e-25
WP_000002239.1|4442196_4442487_+	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	99.0	1.1e-50
WP_106916292.1|4442483_4442846_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A088CBJ1	Shigella_phage	99.2	3.2e-63
WP_000992060.1|4442845_4443040_+	protein ninH	NA	A0A088CC23	Shigella_phage	100.0	1.4e-30
WP_001204882.1|4443032_4443413_+	antitermination protein	NA	A0A088CD47	Shigella_phage	99.2	5.3e-69
WP_106888961.1|4443544_4444138_+	hypothetical protein	NA	V5UT42	Shigella_phage	99.0	7.6e-107
WP_000691354.1|4444713_4445661_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_106916294.1|4445670_4445940_+	Shiga toxin Stx1 subunit B	NA	Q7AYI7	Enterobacteria_phage	98.9	6.0e-43
WP_106916296.1|4446432_4448373_+	SASA family carbohydrate esterase	NA	S5MDQ7	Escherichia_phage	92.0	0.0e+00
4447141:4447157	attR	CCGAAAAATGTGCTGTT	NA	NA	NA	NA
WP_000143458.1|4448510_4448690_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|4448730_4448976_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284510.1|4449053_4449269_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000087453.1|4449273_4449807_+	lysozyme	NA	A0A088CC28	Shigella_phage	99.4	3.0e-102
WP_001056877.1|4450079_4450679_+	hypothetical protein	NA	A0A088CD55	Shigella_phage	97.9	1.5e-105
WP_000455400.1|4450650_4450800_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	5.3e-17
WP_001082567.1|4450807_4451245_+|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	100.0	6.9e-73
WP_001086073.1|4452515_4453322_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_040078182.1|4453302_4455009_+|terminase	terminase	terminase	A0A0H4IT14	Shigella_phage	99.6	0.0e+00
WP_106916298.1|4455008_4457153_+|portal	portal protein	portal	A0A0P0ZGR1	Escherichia_phage	99.9	0.0e+00
WP_047091030.1|4457310_4458318_+	hypothetical protein	NA	A0A0H4J3F0	Shigella_phage	100.0	3.0e-180
WP_000214474.1|4458341_4459556_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140444.1|4459610_4460000_+	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_106916300.1|4460050_4460512_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	98.7	8.7e-74
WP_106916302.1|4460495_4461059_+	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	99.5	1.2e-101
WP_106889001.1|4461058_4461709_+	hypothetical protein	NA	A0A0H4J3F2	Shigella_phage	99.5	2.3e-120
WP_106916304.1|4461705_4463901_+|tail	phage tail protein	tail	A0A1I9LJS9	Stx_converting_phage	99.2	1.6e-61
WP_000438829.1|4463910_4464123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106916358.1|4464134_4464809_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	89.2	3.6e-113
WP_106916306.1|4464887_4466513_+	hypothetical protein	NA	A0A0H4IT21	Shigella_phage	98.3	0.0e+00
WP_106888968.1|4466509_4467778_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	99.8	1.9e-219
WP_000455635.1|4467792_4468071_+	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_106916308.1|4468076_4468694_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	99.5	5.7e-121
WP_000835361.1|4468784_4469519_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZH34	Escherichia_phage	100.0	9.7e-136
WP_000078907.1|4469749_4469890_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035557.1|4469946_4470348_+	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
WP_000509020.1|4470443_4471100_+	hypothetical protein	NA	A0A0H4IPM7	Shigella_phage	100.0	6.7e-104
WP_000455652.1|4471102_4471549_+	hypothetical protein	NA	V5UT82	Shigella_phage	100.0	1.1e-76
WP_000540391.1|4471558_4471810_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_032330628.1|4471820_4473086_+	hypothetical protein	NA	V5URW4	Shigella_phage	100.0	9.9e-205
WP_106916310.1|4473155_4481537_+	hypothetical protein	NA	A0A088CC40	Shigella_phage	99.3	0.0e+00
WP_000481379.1|4481660_4481852_+	hypothetical protein	NA	A0A088CD78	Shigella_phage	95.2	8.0e-26
WP_106916312.1|4481985_4482657_-	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	100.0	3.4e-103
WP_000020908.1|4482643_4482928_-	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	100.0	1.2e-46
WP_000763356.1|4482924_4483146_-	TraR/DksA family transcriptional regulator	NA	V5USD3	Shigella_phage	100.0	1.3e-35
WP_000211516.1|4483193_4483817_-	phage antirepressor Ant	NA	A0A088CBR4	Shigella_phage	100.0	1.0e-114
WP_024199258.1|4484066_4484354_-	hypothetical protein	NA	A0A088CEA0	Shigella_phage	98.9	3.5e-49
WP_000213043.1|4484759_4484873_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	72.0	2.1e-05
WP_001433342.1|4484883_4487307_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.8e-208
WP_000041556.1|4487367_4489794_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
>prophage 8
NZ_CP027373	Escherichia coli strain 05-3629 chromosome, complete genome	4904151	4778340	4846892	4904151	terminase,protease,integrase,capsid,tail,head,holin	Escherichia_phage(36.84%)	77	4792119:4792146	4847029:4847056
WP_000422045.1|4778340_4779390_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559283.1|4779609_4780368_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
WP_001278904.1|4780364_4780955_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_032178397.1|4780994_4781867_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_032178396.1|4781967_4782588_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_097447578.1|4782584_4783466_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|4783603_4783648_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194590.1|4783739_4785302_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|4785301_4786897_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|4786900_4788259_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|4788270_4789464_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443056.1|4789463_4790270_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|4790650_4790830_+	general stress protein	NA	NA	NA	NA	NA
WP_001056490.1|4790915_4791416_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|4791461_4791968_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
4792119:4792146	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_000211405.1|4792614_4793175_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	5.4e-54
WP_001049902.1|4793582_4794254_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	83.9	2.5e-106
WP_106916327.1|4794322_4795591_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	99.1	6.5e-55
WP_000078853.1|4795735_4795876_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_106916329.1|4796074_4799761_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	88.4	0.0e+00
WP_071532098.1|4800671_4801316_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	73.5	8.6e-88
WP_050878055.1|4801213_4801957_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	95.1	3.7e-143
WP_106916331.1|4801967_4802666_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.8	6.8e-131
WP_000738904.1|4802876_4804040_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.9	1.6e-140
WP_000343408.1|4804238_4804580_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	81.2	7.6e-51
WP_000212873.1|4804572_4807815_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.5	0.0e+00
WP_122993267.1|4807863_4808073_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_000710936.1|4808168_4808543_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	3.9e-64
WP_001275414.1|4808557_4809274_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	98.7	1.5e-125
WP_000133383.1|4809340_4809685_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_106916333.1|4809681_4810128_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	3.4e-75
WP_001007905.1|4810124_4810475_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|4810484_4810811_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001063099.1|4813337_4813559_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172990.1|4813603_4815541_-|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_001373204.1|4815604_4817266_-|terminase	terminase large subunit	terminase	Q6H9U9	Enterobacteria_phage	99.5	0.0e+00
WP_000958387.1|4817262_4817826_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000829192.1|4818114_4818480_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|4818521_4818722_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|4818853_4819180_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_032308174.1|4819524_4819749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071974579.1|4819813_4820020_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	63.2	4.6e-11
WP_001280928.1|4820242_4820374_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	95.3	4.5e-12
WP_106916335.1|4820468_4821164_-	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	98.7	1.4e-123
WP_032308173.1|4821437_4821971_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	91.5	6.0e-95
WP_044808592.1|4822482_4823274_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000284506.1|4823277_4823493_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290214.1|4823570_4823816_-	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
WP_000142780.1|4823856_4824036_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	93.2	5.4e-24
WP_052903709.1|4824172_4826137_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	78.8	3.2e-295
WP_000382066.1|4827731_4828457_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000271629.1|4829153_4829582_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_106916337.1|4830061_4831120_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.9	1.5e-206
WP_000917733.1|4831271_4831469_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_000342737.1|4831642_4832356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106916339.1|4832609_4833275_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.0	1.6e-60
WP_000904164.1|4833267_4833630_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
WP_106916341.1|4833642_4834692_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	6.5e-109
WP_032296757.1|4834693_4834966_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	1.6e-11
WP_000902691.1|4835134_4835347_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	72.9	6.9e-18
WP_001367885.1|4835580_4836282_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.0	3.5e-34
WP_000137949.1|4836278_4836647_-	hypothetical protein	NA	A5LH60	Enterobacteria_phage	71.9	2.6e-41
WP_001376361.1|4836796_4837102_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.1	2.9e-49
WP_048267405.1|4837098_4837380_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	74.7	6.1e-30
WP_106916343.1|4837412_4838129_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.0	7.4e-72
WP_157915717.1|4838162_4838705_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.7e-79
WP_159032334.1|4838616_4839654_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	81.4	8.7e-82
WP_000705379.1|4839625_4840177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000017544.1|4840160_4840427_-	DNA-binding protein	NA	A0A2I6PIE5	Escherichia_phage	60.6	1.9e-17
WP_000233318.1|4840506_4840926_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	58.7	2.1e-18
WP_000380318.1|4841220_4841373_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_000559919.1|4841486_4842002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450221.1|4842530_4842719_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092783.1|4842715_4842904_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_106916345.1|4842999_4845471_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	2.0e-55
WP_000113186.1|4845535_4845784_+	excisionase	NA	NA	NA	NA	NA
WP_000113694.1|4845761_4846892_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	2.0e-103
4847029:4847056	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 1
NZ_CP027375	Escherichia coli strain 05-3629 plasmid unnamed2, complete sequence	118863	34793	43625	118863	integrase	Cronobacter_phage(25.0%)	12	39990:40002	45575:45587
WP_000125552.1|34793_36494_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.4	1.1e-171
WP_032236829.1|36723_37029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106916408.1|37032_37935_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618108.1|38210_38459_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	46.7	4.1e-14
WP_000109074.1|38455_38893_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	3.7e-26
WP_001365565.1|38892_39885_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	59.5	8.0e-101
WP_001365560.1|39914_40163_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	59.0	1.5e-19
39990:40002	attL	CCCCGTAAAAACA	NA	NA	NA	NA
WP_000340836.1|40167_40560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103695.1|40564_41536_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	1.3e-66
WP_000633912.1|41764_42409_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	1.9e-39
WP_000239527.1|42402_42678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052892429.1|42815_43625_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
45575:45587	attR	CCCCGTAAAAACA	NA	NA	NA	NA
