The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027387	Escherichia coli strain 2014C-3057 chromosome, complete genome	5645983	196859	282026	5645983	protease,tail,terminase,portal,holin,lysis,integrase,head,transposase	Enterobacteria_phage(50.0%)	99	197985:198019	283460:283494
WP_000399685.1|196859_197840_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
197985:198019	attL	GTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
WP_001145128.1|198099_198582_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_001218655.1|198701_200852_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	4.8e-42
WP_000386551.1|200879_201842_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443534.1|201982_203068_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000007094.1|203298_204663_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|204891_205563_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001296990.1|205565_206561_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996091.1|206553_208290_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_000070131.1|208282_209416_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|209426_210533_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|210494_210905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001113363.1|211037_211799_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650337.1|211795_213037_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045454.1|213036_213993_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000446932.1|214028_214742_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000373624.1|214946_215651_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852287.1|215787_216240_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598619.1|216241_216487_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|216479_216965_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084632.1|216967_217480_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001295301.1|217501_218491_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|218887_219796_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|219987_222009_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044868.1|222587_223265_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246805.1|223257_224013_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118840.1|223999_225154_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|225150_226191_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001307065.1|226277_227567_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000767389.1|227625_228102_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001121571.1|228605_229259_+	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_000354291.1|229271_229493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002868.1|229576_229957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001448642.1|230157_230733_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
WP_001339397.1|230793_231471_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|231470_231818_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|231837_233409_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_021351651.1|233883_234255_+	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_000652081.1|234378_235206_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.2	3.1e-154
WP_000950982.1|235429_236311_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001023459.1|236416_236686_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000268998.1|236687_237902_-	short-chain dehydrogenase	NA	B6DZB7	Enterobacteria_phage	95.8	6.6e-81
WP_001230449.1|237966_238566_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_106875055.1|238633_242110_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_122993493.1|242355_242988_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	7.1e-103
WP_001429308.1|242933_243677_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_001375577.1|243682_244381_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
WP_000847304.1|244380_244710_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082320.1|244706_247286_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
WP_000533431.1|247266_247680_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|247706_248138_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_001143027.1|248151_248904_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	94.0	2.0e-128
WP_032284507.1|248911_249280_-	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	88.0	2.4e-50
WP_000099160.1|249276_250815_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|250863_251211_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|251207_251612_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001254029.1|251689_251866_-	hypothetical protein	NA	E4WL22	Enterobacteria_phage	56.4	1.1e-08
WP_001432013.1|251855_253448_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.2e-184
WP_000259002.1|253444_253651_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_009442816.1|253634_255563_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
WP_000235451.1|255534_256044_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_085947969.1|256133_257347_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
WP_052924637.1|257752_257947_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.2	2.2e-26
WP_000881326.1|258134_258752_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092330.1|258901_259339_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.2	1.1e-70
WP_000075132.1|259335_259833_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|259832_260039_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000499454.1|262649_262808_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_159032314.1|262893_263637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|263821_264511_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|264525_264648_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|264986_265946_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_000994516.1|266157_266346_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008193.1|266342_266705_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_000002261.1|266701_266992_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_001003989.1|266991_267714_-	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
WP_001341811.1|267706_267916_-	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.6e-30
WP_085947969.1|268136_269349_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
WP_001254255.1|269592_269769_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000814611.1|269765_270176_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_000344573.1|270147_270504_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_000145926.1|270800_271091_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788880.1|271087_271789_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	3.8e-129
WP_001341800.1|273533_274394_+	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	99.3	2.4e-37
WP_000638547.1|274418_274550_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243354.1|274534_274687_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
WP_000031370.1|274943_275549_+	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_000951334.1|275548_275932_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_001111278.1|275955_276249_+	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_001214436.1|276259_276424_+	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
WP_000812206.1|276420_276978_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
WP_000034231.1|276974_277532_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
WP_000104414.1|277533_278151_+	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
WP_012817743.1|278147_278450_+	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	97.0	9.4e-53
WP_085947969.1|278603_279816_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
WP_000545733.1|280112_280280_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_001281774.1|280308_280653_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_001303849.1|280759_280978_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533654.1|280955_282026_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
283460:283494	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 2
NZ_CP027387	Escherichia coli strain 2014C-3057 chromosome, complete genome	5645983	501548	560200	5645983	protease,tail,portal,terminase,lysis,transposase,integrase,head,capsid	Enterobacteria_phage(59.65%)	71	510029:510075	560214:560260
WP_000420938.1|501548_502685_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383941.1|502953_505191_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001375368.1|505177_508150_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224569.1|508150_509041_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177453.1|509223_509985_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
510029:510075	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|510497_511451_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226384.1|511637_513122_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937502.1|513305_513611_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239881.1|513667_514336_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885569.1|514390_514975_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_000268807.1|514974_517935_-	membrane protein	NA	A0A2D1UII2	Escherichia_phage	97.4	6.6e-58
WP_001230523.1|517999_518599_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
WP_000515439.1|518669_522083_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_000090884.1|522143_522776_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_001152557.1|523461_524160_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	3.4e-130
WP_000847347.1|524159_524489_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_000840236.1|524485_527047_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
WP_000459457.1|527039_527474_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479169.1|527455_527878_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_001342267.1|527893_528634_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000683110.1|528641_529037_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_000985132.1|529033_529612_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752961.1|529602_529977_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
WP_000158868.1|529988_530384_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063244.1|530425_531451_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_001345004.1|531506_531839_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000088640.1|531848_532727_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.0	1.7e-147
WP_001339397.1|532767_533445_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|533444_533792_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|533811_535383_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_106875060.1|535855_537457_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	4.9e-310
WP_000198149.1|537453_537660_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027297.1|537656_539582_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000453558.1|539556_540102_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001427981.1|540490_540685_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_101750776.1|540802_542015_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	2.3e-166
WP_157825797.1|541981_542149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000738423.1|542355_542649_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|542739_542922_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135274.1|543138_543636_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_000839596.1|543635_543851_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737278.1|544439_545522_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
WP_001204791.1|545710_546094_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971074.1|546179_546320_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001099712.1|546316_546679_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774477.1|546675_546966_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_000224914.1|546958_547129_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053023.1|547128_547584_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_072097617.1|547580_547682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000520500.1|547805_548207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038620.1|548185_548602_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_001415151.1|548901_549510_-	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_000152742.1|550262_550610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000788789.1|550814_551516_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
WP_001342088.1|551512_552442_-	replication protein	NA	M1FN81	Enterobacteria_phage	67.0	4.4e-109
WP_001182773.1|552528_553068_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001067458.1|553137_553368_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|553472_554162_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000066829.1|554243_554507_+	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
WP_001444023.1|554642_554963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206913.1|555429_555720_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	82.4	2.5e-26
WP_000995439.1|555795_556092_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|556097_556883_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000611716.1|556879_557560_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000149544.1|557556_557739_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|557711_557903_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001443983.1|557913_558195_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763390.1|558293_558512_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_000488407.1|558559_558838_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|558809_559181_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000051902.1|559036_560200_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
560214:560260	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 3
NZ_CP027387	Escherichia coli strain 2014C-3057 chromosome, complete genome	5645983	856762	873232	5645983	integrase	Sodalis_phage(14.29%)	18	848970:848983	876243:876256
848970:848983	attL	CGGCTTACAGAGCA	NA	NA	NA	NA
WP_000246961.1|856762_858184_-	DNA transfer protein	NA	B6SCW4	Bacteriophage	53.0	2.8e-123
WP_000909176.1|858183_858861_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
WP_032312028.1|858854_859316_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.2e-61
WP_001719727.1|860087_862844_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.2	8.9e-299
WP_001208878.1|862830_863202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000628967.1|863194_863536_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_001058740.1|863546_864149_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	2.6e-25
WP_000181940.1|864141_864363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032341460.1|864359_864623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077757964.1|864619_865873_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	36.8	1.0e-12
WP_000476150.1|865866_866049_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032312024.1|866041_866875_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000412538.1|866887_867319_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	3.9e-28
WP_000035054.1|867318_867522_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_016234638.1|867950_869165_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.2	8.3e-132
WP_000893255.1|869520_870774_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001285288.1|870785_871889_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749860.1|872176_873232_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	3.5e-118
876243:876256	attR	CGGCTTACAGAGCA	NA	NA	NA	NA
>prophage 4
NZ_CP027387	Escherichia coli strain 2014C-3057 chromosome, complete genome	5645983	1310710	1362714	5645983	transposase,tRNA,integrase	Stx2-converting_phage(37.5%)	44	1321764:1321779	1353904:1353919
WP_085948186.1|1310710_1311867_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_085948184.1|1313285_1314442_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
WP_000177060.1|1315964_1316222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|1316779_1317547_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|1317547_1318504_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125190.1|1318500_1319499_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879164.1|1319495_1320398_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188267.1|1320442_1322767_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
1321764:1321779	attL	TGCAGCAGGCTGTTGA	NA	NA	NA	NA
WP_001068910.1|1322853_1323807_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|1323803_1324325_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555341.1|1326074_1326332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823243.1|1327064_1328423_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000998019.1|1328661_1330047_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|1330096_1330444_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|1330440_1330821_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001221615.1|1331175_1331610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271003.1|1331597_1331999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221529.1|1332164_1332734_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000381395.1|1333473_1335045_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1335064_1335412_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1335411_1336089_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000091133.1|1336378_1337965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356577.1|1338103_1338943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772685.1|1339186_1340449_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	2.8e-74
WP_000061768.1|1340892_1341912_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
WP_032341555.1|1342041_1343544_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_001295681.1|1343662_1344745_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584109.1|1344744_1345845_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|1346111_1347623_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786398.1|1347977_1348421_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416407.1|1348420_1351276_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_001059398.1|1352718_1353222_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|1353267_1353684_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000012897.1|1353845_1354859_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
1353904:1353919	attR	TCAACAGCCTGCTGCA	NA	NA	NA	NA
WP_001074121.1|1355035_1356547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000583470.1|1356669_1357122_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000256681.1|1357266_1357860_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000500687.1|1357930_1358644_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000230273.1|1358774_1359170_+	RidA family protein	NA	NA	NA	NA	NA
WP_001296693.1|1359450_1359585_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000013046.1|1359588_1360524_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|1360536_1360998_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|1361070_1361457_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000399685.1|1361733_1362714_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP027387	Escherichia coli strain 2014C-3057 chromosome, complete genome	5645983	1422029	1480324	5645983	protease,transposase,integrase,tRNA	Vibrio_phage(15.38%)	57	1447532:1447546	1479593:1479607
WP_000811566.1|1422029_1422305_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001299838.1|1422421_1424047_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943991.1|1424130_1425294_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_000101670.1|1425296_1425935_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|1425944_1426343_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012553.1|1426360_1427020_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|1427070_1427769_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|1427787_1428189_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|1428315_1429047_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|1429226_1431668_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|1431706_1432132_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|1432336_1433635_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|1433738_1433936_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|1434017_1435022_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|1435024_1436284_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460361.1|1436369_1437650_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|1437726_1438035_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280349.1|1438120_1439071_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122519.1|1439063_1440911_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_000990321.1|1440920_1442258_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|1442276_1442738_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001307537.1|1442709_1444257_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294203.1|1444255_1445395_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_100699686.1|1445377_1445431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|1446294_1446840_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|1446934_1447987_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
1447532:1447546	attL	CCGCTGGAAGAGGCG	NA	NA	NA	NA
WP_000934920.1|1448083_1449052_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236850.1|1449073_1452397_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001276180.1|1452425_1452740_-	YjeO family protein	NA	NA	NA	NA	NA
WP_000342867.1|1452736_1453051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001346081.1|1453102_1454605_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|1454823_1455801_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192991.1|1456125_1457934_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|1457926_1458661_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000208757.1|1458671_1459067_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|1459077_1459437_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001299193.1|1459499_1460633_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|1460721_1461255_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|1461251_1461569_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|1461750_1461897_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|1462007_1462133_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|1462184_1462751_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|1462792_1463821_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008073.1|1464210_1465080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000399685.1|1465328_1466309_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000558209.1|1466561_1466915_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|1467052_1468699_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|1468742_1469036_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015837.1|1469311_1470568_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|1470583_1471060_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|1471396_1472833_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|1472950_1474252_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000883338.1|1474367_1474706_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068905.1|1474681_1476379_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|1476415_1476991_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218841.1|1477370_1478636_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_000704132.1|1478752_1480324_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.6	5.8e-295
1479593:1479607	attR	CGCCTCTTCCAGCGG	NA	NA	NA	NA
>prophage 6
NZ_CP027387	Escherichia coli strain 2014C-3057 chromosome, complete genome	5645983	1899623	1912956	5645983	transposase,integrase	Enterobacteria_phage(66.67%)	15	1899441:1899463	1913441:1913463
1899441:1899463	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001218979.1|1899623_1900793_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.1	1.7e-198
WP_000119815.1|1900812_1902672_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
WP_000186475.1|1902668_1903094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446132.1|1903421_1903994_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638629.1|1904067_1904568_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283024.1|1904564_1905299_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.0	5.7e-128
WP_001149160.1|1905850_1906117_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980227.1|1906113_1906713_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
WP_001244665.1|1906705_1906993_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459320.1|1906985_1907441_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	6.1e-64
WP_000381395.1|1907516_1909088_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1909107_1909455_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1909454_1910132_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000856729.1|1910287_1910608_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783645.1|1910622_1912956_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
1913441:1913463	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 7
NZ_CP027387	Escherichia coli strain 2014C-3057 chromosome, complete genome	5645983	3192281	3297298	5645983	tail,terminase,holin,integrase,head,capsid,tRNA	Stx2-converting_phage(35.29%)	104	3196003:3196017	3208060:3208074
WP_000577251.1|3192281_3194000_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	100.0	6.5e-308
WP_000214985.1|3194001_3195750_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	100.0	0.0e+00
WP_000448925.1|3195821_3196238_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
3196003:3196017	attL	ATATCGCCTTGATCA	NA	NA	NA	NA
WP_001448712.1|3196276_3197512_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	99.5	6.5e-233
WP_001431537.1|3197810_3198719_-	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	100.0	2.3e-171
WP_000516611.1|3199201_3200377_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	91.2	4.6e-204
WP_000557643.1|3200549_3200696_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	90.9	1.7e-20
WP_000457722.1|3200699_3200942_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	82.5	1.8e-30
WP_000206753.1|3201026_3201890_-	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	53.6	3.2e-69
WP_000034210.1|3201891_3202221_-	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	37.5	1.1e-25
WP_000476199.1|3202217_3202457_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	3.7e-36
WP_000158004.1|3202449_3202653_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
WP_000335005.1|3202649_3203528_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	94.9	1.9e-170
WP_000008174.1|3203518_3204055_-	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
WP_000081319.1|3204183_3205008_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	5.0e-149
WP_000135680.1|3205073_3205436_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000859462.1|3206102_3206777_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000649477.1|3206867_3207068_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000521508.1|3207111_3207663_+	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_001087337.1|3207659_3208496_+	hypothetical protein	NA	Q8SBF3	Shigella_phage	98.6	8.7e-149
3208060:3208074	attR	TGATCAAGGCGATAT	NA	NA	NA	NA
WP_001444024.1|3208500_3208725_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	94.6	2.5e-34
WP_000061512.1|3208721_3209540_+	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	95.6	3.0e-117
WP_001447905.1|3209536_3210031_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	1.2e-86
WP_001427609.1|3210030_3210684_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	2.1e-126
WP_000210162.1|3210680_3211007_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	99.1	1.2e-53
WP_000767105.1|3211003_3211393_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	2.1e-68
WP_001061413.1|3211412_3212210_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
WP_001427606.1|3212217_3213207_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.6e-194
WP_001205460.1|3213224_3213566_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131907.1|3213578_3214127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868396.1|3214113_3215040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153244796.1|3216030_3216174_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	97.4	3.7e-15
WP_106875073.1|3216159_3218097_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	97.2	0.0e+00
WP_000143462.1|3218232_3218412_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290231.1|3218452_3218725_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284519.1|3218801_3219017_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731236.1|3219021_3219366_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992122.1|3219416_3219950_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_047091958.1|3220468_3220654_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.3	1.3e-17
WP_000736096.1|3220739_3220964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095736.1|3221332_3221560_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_001365481.1|3221601_3221967_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	98.3	5.8e-65
WP_000958402.1|3222258_3222822_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_000173032.1|3224544_3226482_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.5	0.0e+00
WP_001063025.1|3226526_3226748_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|3229274_3229601_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|3229611_3229962_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|3229958_3230405_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|3230401_3230746_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275471.1|3230811_3231528_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_001030067.1|3231533_3231908_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|3232003_3232213_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212961.1|3232260_3235503_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.9	0.0e+00
WP_000807964.1|3235495_3235837_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001448747.1|3235836_3236535_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	99.1	1.6e-132
WP_000194790.1|3236545_3237289_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	8.3e-151
WP_133253367.1|3237234_3237867_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.2	2.5e-103
WP_000514836.1|3238105_3241579_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.4	0.0e+00
WP_001427270.1|3241646_3242246_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.7e-109
WP_000268987.1|3242310_3243624_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
WP_001023420.1|3243625_3243895_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_115801847.1|3244001_3244091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|3244110_3246459_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001370486.1|3247051_3250453_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.3e-219
WP_000938110.1|3250829_3252191_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_000162574.1|3253945_3254428_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|3254560_3255037_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|3255026_3255317_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|3255378_3255720_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|3255868_3257530_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|3257615_3258494_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|3258616_3259210_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|3259264_3260551_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|3260571_3261363_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000256450.1|3263138_3263387_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|3263405_3263954_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|3263984_3264752_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|3264793_3265141_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|3265217_3265700_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969036.1|3265715_3266942_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|3266931_3267450_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|3267599_3267965_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168054.1|3268174_3269245_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000225221.1|3269255_3270377_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200116.1|3270419_3271580_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|3271678_3271726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|3271829_3272171_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|3272441_3273179_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079094.1|3273313_3274294_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040115.1|3274290_3275022_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|3275151_3277725_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841103.1|3283578_3284877_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|3284873_3285197_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|3285242_3286598_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000083007.1|3286711_3289372_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001341635.1|3289403_3290102_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|3290170_3290590_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|3290796_3291834_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|3291881_3292571_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|3292875_3293259_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|3293314_3293902_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001341633.1|3294004_3294886_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|3295094_3296429_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001298974.1|3296560_3297298_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP027387	Escherichia coli strain 2014C-3057 chromosome, complete genome	5645983	3540875	3595097	5645983	portal,terminase,holin,lysis,integrase,head,transposase	Enterobacteria_phage(47.62%)	68	3552083:3552098	3594014:3594029
WP_000381395.1|3540875_3542447_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|3542466_3542814_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|3542813_3543491_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000100143.1|3543963_3544980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839828.1|3545623_3547984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000160236.1|3549296_3549452_-	hypothetical protein	NA	NA	NA	NA	NA
3552083:3552098	attL	ATGGTGTCCCCTGCAG	NA	NA	NA	NA
WP_001163428.1|3552171_3552372_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000545713.1|3552429_3552597_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.2e-25
WP_001368678.1|3552632_3552932_-	hypothetical protein	NA	Q9G076	Enterobacteria_phage	100.0	2.4e-53
WP_000376716.1|3553089_3553368_-	DUF4752 family protein	NA	K7P6P7	Enterobacteria_phage	98.9	5.4e-47
WP_000156090.1|3553367_3553955_-	DUF551 domain-containing protein	NA	Q9G077	Enterobacteria_phage	100.0	7.5e-115
WP_001375782.1|3553951_3554569_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	100.0	3.7e-112
WP_000060377.1|3554572_3554761_-	hypothetical protein	NA	Q9G079	Enterobacteria_phage	100.0	1.7e-28
WP_000052365.1|3554762_3555431_-	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	79.7	9.3e-69
WP_000812180.1|3555427_3556015_-	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	97.5	5.0e-58
WP_001111303.1|3556186_3556480_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	100.0	5.0e-51
WP_000951323.1|3556503_3556887_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	99.2	8.5e-67
WP_000031004.1|3556886_3557492_-	ERF family protein	NA	O48415	Enterobacteria_phage	100.0	2.4e-108
WP_064551585.1|3557581_3557791_-	hypothetical protein	NA	K7PH22	Enterobacteria_phage	100.0	2.8e-24
WP_085948186.1|3557806_3558962_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001243355.1|3559015_3559168_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|3559152_3559287_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_000776959.1|3559362_3559674_-	superinfection exclusion protein	NA	O48416	Enterobacteria_phage	99.0	9.3e-56
WP_000167585.1|3559817_3560288_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.1e-87
WP_000382838.1|3560488_3560983_+	hypothetical protein	NA	K7PK22	Enterobacteria_phage	99.4	1.6e-89
WP_001430488.1|3561013_3561376_-	hypothetical protein	NA	K7P6R2	Enterobacteria_phage	100.0	6.2e-59
WP_012817806.1|3561378_3561651_-	hypothetical protein	NA	K7PH69	Enterobacterial_phage	98.9	1.0e-26
WP_000394868.1|3562084_3562381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092874.1|3562421_3563096_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	83.9	1.2e-103
WP_001054987.1|3563240_3563465_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	86.3	1.4e-29
WP_001375758.1|3563574_3563853_+	transcriptional regulator	NA	K7P7A2	Enterobacteria_phage	96.7	1.5e-41
WP_000539347.1|3564036_3564858_+	replication protein	NA	K7PJZ3	Enterobacterial_phage	99.3	1.7e-152
WP_001248395.1|3564854_3566231_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.1	5.3e-252
WP_000103674.1|3566317_3566533_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	98.6	2.2e-32
WP_000344573.1|3566998_3567355_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_000814611.1|3567326_3567737_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_001254255.1|3567733_3567910_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000924601.1|3567912_3568314_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_072189684.1|3568273_3568483_+	protein ninF	NA	G9L691	Escherichia_phage	95.6	2.2e-29
WP_001107956.1|3568475_3569081_+	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	98.0	5.6e-97
WP_000144614.1|3569077_3569284_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001271146.1|3569261_3569927_+	serine/threonine protein phosphatase	NA	K7P721	Enterobacteria_phage	97.7	1.6e-129
WP_001235461.1|3569923_3570547_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000783734.1|3571619_3571943_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229392.1|3571926_3572403_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_000092296.1|3572399_3572837_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	97.2	1.1e-70
WP_001016387.1|3573042_3573561_+	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	99.4	1.2e-92
WP_000999682.1|3573844_3574216_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	88.6	3.2e-55
WP_000807788.1|3574319_3574562_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000179910.1|3574641_3575067_+	hypothetical protein	NA	Q716H4	Shigella_phage	87.9	1.8e-65
WP_000200776.1|3575063_3576476_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.6	2.2e-277
WP_000852339.1|3576478_3578605_+|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.3	0.0e+00
WP_000426731.1|3578618_3579503_+	hypothetical protein	NA	Q716H1	Shigella_phage	98.6	3.4e-143
WP_001133481.1|3579514_3580786_+|head	head protein	head	Q716H0	Shigella_phage	99.8	6.6e-241
WP_000375639.1|3580828_3581014_+	hypothetical protein	NA	Q716G9	Shigella_phage	98.4	4.6e-26
WP_000246750.1|3580988_3581471_+	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
WP_001122374.1|3581479_3582898_+	Packaged DNA stabilization protein gp10	NA	Q716G7	Shigella_phage	99.2	2.3e-274
WP_000785546.1|3582897_3583746_+	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	97.9	1.5e-100
WP_000614047.1|3583745_3584201_+	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.0	3.3e-86
WP_000964882.1|3584203_3584896_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000246938.1|3584905_3586312_+	DNA transfer protein	NA	I6RSG0	Salmonella_phage	55.8	1.1e-127
WP_000868968.1|3586311_3588156_+	hypothetical protein	NA	A0A192Y934	Salmonella_phage	72.1	4.0e-239
WP_000749284.1|3588170_3588656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000287055.1|3588726_3588993_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	90.5	9.5e-33
WP_001280420.1|3589114_3591238_+	hypothetical protein	NA	A0A2D1GLP5	Escherichia_phage	36.7	2.5e-59
WP_000440209.1|3591308_3592451_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.9	9.2e-24
WP_000958687.1|3592695_3593853_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	1.1e-221
WP_000368131.1|3594164_3595097_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
3594014:3594029	attR	ATGGTGTCCCCTGCAG	NA	NA	NA	NA
>prophage 9
NZ_CP027387	Escherichia coli strain 2014C-3057 chromosome, complete genome	5645983	3696090	3809867	5645983	protease,tail,terminase,portal,holin,lysis,integrase,head,transposase	Enterobacteria_phage(35.71%)	118	3705081:3705099	3779316:3779334
WP_000140570.1|3696090_3696993_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
WP_001000358.1|3697186_3698377_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_001209920.1|3698373_3699633_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_032341452.1|3699622_3701251_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_000948732.1|3701523_3702882_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_000779084.1|3702886_3703963_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301050.1|3704425_3705076_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
3705081:3705099	attL	TGTAGGCCAGATAAGACGC	NA	NA	NA	NA
WP_000135040.1|3705129_3705384_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|3705383_3706514_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001075177.1|3706602_3708888_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_001341569.1|3709583_3713318_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.5	2.0e-19
WP_000990754.1|3713445_3714168_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001281242.1|3714314_3716942_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000012302.1|3717090_3718779_+	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001215756.1|3718775_3719381_+	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000533670.1|3719395_3720466_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001444001.1|3720443_3720662_-	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_001281192.1|3720767_3721112_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_000457736.1|3721230_3721473_-	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	96.2	3.7e-36
WP_001345188.1|3721547_3721898_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	80.2	3.3e-33
WP_001289868.1|3721894_3722500_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	96.9	1.7e-45
WP_000763358.1|3722496_3722718_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_001444000.1|3722816_3723098_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|3723108_3723300_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|3723272_3723455_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|3723454_3724132_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|3724128_3724914_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|3724919_3725216_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372926.1|3725270_3725435_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.1	3.2e-23
WP_001198860.1|3725403_3725568_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065385.1|3725640_3726009_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
WP_000167595.1|3726158_3726629_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000930321.1|3726762_3727101_-	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
WP_000256573.1|3727103_3727409_-	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
WP_001095982.1|3727723_3728374_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_000276885.1|3728454_3728640_+	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_000035947.1|3728749_3729046_+	hypothetical protein	NA	A0A0N7C1W0	Escherichia_phage	96.9	1.3e-46
WP_000185462.1|3729078_3730017_+	replication protein	NA	C1JJ53	Enterobacteria_phage	99.4	1.1e-171
WP_000788878.1|3730013_3730715_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_000145926.1|3730711_3731002_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000229807.1|3731074_3731281_+	hypothetical protein	NA	G8C7M4	Escherichia_phage	97.1	1.8e-26
WP_000810176.1|3731288_3731735_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000153270.1|3731731_3732259_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_001254228.1|3732255_3732438_+	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001429269.1|3732941_3734777_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
WP_001108084.1|3735288_3735855_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001223927.1|3735829_3736432_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001028854.1|3736428_3737094_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235460.1|3737090_3737714_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001302581.1|3737966_3738710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|3738795_3738954_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|3739034_3739433_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|3739575_3739791_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075153.1|3739790_3740288_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	96.4	1.6e-89
WP_001228695.1|3740504_3740687_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|3740777_3741071_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001427981.1|3741430_3741625_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000235436.1|3742019_3742529_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_106875076.1|3742500_3744210_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.1	5.4e-238
WP_001238637.1|3744222_3744429_+|terminase	terminase	terminase	A0A2I6TC92	Escherichia_phage	59.4	1.1e-12
WP_000258991.1|3744412_3744619_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_000827572.1|3744615_3746208_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	8.4e-185
WP_001254039.1|3746197_3747703_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256849.1|3747739_3748087_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
WP_000522643.1|3748144_3749029_+	hypothetical protein	NA	C6ZCY2	Enterobacteria_phage	54.1	6.5e-94
WP_000201528.1|3749080_3749455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204544.1|3749447_3749801_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000975037.1|3749815_3750391_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_000683071.1|3750387_3750783_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_001143013.1|3750790_3751543_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000479086.1|3751556_3751988_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533403.1|3752014_3752428_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_100037251.1|3752408_3754970_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.8	0.0e+00
WP_000847413.1|3754966_3755296_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
WP_001152619.1|3755295_3755994_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_012817801.1|3755999_3756743_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	5.2e-145
WP_000090884.1|3756679_3757312_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_001375477.1|3757372_3760672_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	95.2	0.0e+00
WP_000839165.1|3760700_3761105_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.5e-69
WP_000612626.1|3761101_3761449_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|3761497_3763036_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_001230644.1|3763098_3763314_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	95.8	2.9e-32
WP_001228241.1|3763381_3763981_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_106875077.1|3764045_3765359_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	2.8e-77
WP_001023380.1|3765360_3765630_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	7.3e-41
WP_001448330.1|3765839_3766487_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.3	2.4e-37
WP_001025664.1|3767180_3768503_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.7	2.5e-227
WP_001676637.1|3769304_3773699_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001104541.1|3773699_3775349_+	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_001225855.1|3775353_3776130_+	YfaP family protein	NA	NA	NA	NA	NA
WP_000876007.1|3776404_3779254_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.0	1.7e-42
WP_001061917.1|3779339_3779990_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
3779316:3779334	attR	GCGTCTTATCTGGCCTACA	NA	NA	NA	NA
WP_001249127.1|3780006_3782679_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_000865576.1|3783417_3784509_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_000406116.1|3784620_3785676_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000786386.1|3785749_3786814_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000884922.1|3786813_3787464_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422231.1|3787539_3789183_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000758074.1|3789400_3791047_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000849214.1|3791195_3791684_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000686723.1|3792092_3792587_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000557378.1|3792576_3792840_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778069.1|3792836_3795323_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091291.1|3795329_3796025_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013509.1|3796011_3796875_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835177.1|3796871_3797321_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000528376.1|3797330_3797933_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888560.1|3797951_3798569_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000971723.1|3798565_3799228_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_001295447.1|3799269_3800007_+	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000186540.1|3800003_3800213_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001026418.1|3800209_3800689_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982426.1|3800685_3802629_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000824439.1|3802625_3803183_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001211567.1|3803179_3804232_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001113637.1|3804266_3804914_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000624042.1|3808292_3809216_-	hypothetical protein	NA	A0A0R6PHC6	Moraxella_phage	24.9	6.9e-14
WP_001229487.1|3809378_3809867_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	4.6e-25
>prophage 10
NZ_CP027387	Escherichia coli strain 2014C-3057 chromosome, complete genome	5645983	3888577	3898505	5645983	transposase	Enterobacteria_phage(62.5%)	9	NA	NA
WP_001240401.1|3888577_3889309_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|3889530_3891216_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|3891212_3891932_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950404.1|3891978_3892449_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_000998019.1|3892880_3894266_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|3894315_3894663_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|3894659_3895040_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001342301.1|3895371_3897372_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001292774.1|3897368_3898505_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 11
NZ_CP027387	Escherichia coli strain 2014C-3057 chromosome, complete genome	5645983	3989947	3996249	5645983		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001116073.1|3989947_3991342_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	2.2e-19
WP_000183038.1|3991516_3992410_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_000699427.1|3992781_3993867_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	1.4e-101
WP_001023633.1|3993866_3994766_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	5.7e-29
WP_000857547.1|3994823_3995702_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.5e-106
WP_001100797.1|3995706_3996249_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	1.9e-51
>prophage 12
NZ_CP027387	Escherichia coli strain 2014C-3057 chromosome, complete genome	5645983	4029884	4038913	5645983	transposase	Stx2-converting_phage(42.86%)	11	NA	NA
WP_000692345.1|4029884_4030106_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186725.1|4030174_4030651_-	RadC family protein	NA	NA	NA	NA	NA
WP_000849582.1|4030666_4031152_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
WP_001234620.1|4031206_4032025_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_001119729.1|4032124_4032358_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000378676.1|4032436_4032868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839179.1|4032866_4033271_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|4033267_4033615_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099148.1|4033663_4035202_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.6	3.3e-295
WP_085948191.1|4035117_4035354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|4037757_4038913_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
>prophage 13
NZ_CP027387	Escherichia coli strain 2014C-3057 chromosome, complete genome	5645983	4156191	4192353	5645983	tail,terminase,portal,holin,plate,integrase,head,capsid	Enterobacteria_phage(87.18%)	46	4155129:4155188	4192460:4192580
4155129:4155188	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_000078921.1|4156191_4156332_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	5.9e-18
WP_000488107.1|4156522_4156783_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001317900.1|4157069_4158209_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_000132847.1|4158608_4159709_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.1e-203
WP_000005439.1|4159866_4161051_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	3.4e-223
WP_000290450.1|4161050_4161563_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|4161617_4161983_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000763327.1|4162018_4162147_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000853455.1|4162133_4164941_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.7	0.0e+00
WP_000979950.1|4164953_4165442_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.1	7.5e-84
WP_000954196.1|4165598_4166171_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144010.1|4166214_4166793_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.2e-95
WP_000108514.1|4166792_4168925_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.2	8.0e-130
WP_000071738.1|4168927_4169458_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
WP_001111967.1|4169450_4170347_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.9e-154
WP_000213447.1|4170350_4170701_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271909.1|4170697_4171279_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.2e-101
WP_000356339.1|4171275_4171911_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001342220.1|4171903_4172371_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
WP_000202151.1|4172394_4174272_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	82.2	1.1e-305
WP_000780555.1|4174410_4174818_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_000072343.1|4174814_4175207_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	2.9e-70
WP_001342221.1|4175203_4175527_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864911.1|4175529_4175730_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
WP_000063100.1|4175729_4176224_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632311.1|4176325_4177126_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	1.5e-126
WP_001055094.1|4177171_4178224_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_001262641.1|4178247_4179084_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	7.9e-150
WP_000613774.1|4179238_4180990_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_000087812.1|4180989_4182036_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_001289969.1|4182525_4183116_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.7	1.8e-31
WP_000211289.1|4183179_4183491_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_000686499.1|4183495_4184455_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
WP_001272083.1|4184531_4187372_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
WP_000564224.1|4187368_4187758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000985152.1|4188081_4188285_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000021647.1|4188371_4188485_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	2.4e-09
WP_000357025.1|4188481_4188724_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000158976.1|4188735_4189014_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	6.9e-34
WP_000742491.1|4189024_4189375_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.0	1.2e-48
WP_000014504.1|4189396_4189600_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|4189671_4189809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|4189898_4190303_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290352.1|4190318_4190969_+	membrane protein	NA	NA	NA	NA	NA
WP_000865208.1|4190998_4191346_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001342226.1|4191351_4192353_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.2	9.3e-105
4192460:4192580	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTT	NA	NA	NA	NA
>prophage 14
NZ_CP027387	Escherichia coli strain 2014C-3057 chromosome, complete genome	5645983	4276387	4360520	5645983	protease,tail,terminase,portal,holin,lysis,transposase,integrase,head,capsid,tRNA	Escherichia_phage(31.25%)	98	4268658:4268672	4289411:4289425
4268658:4268672	attL	TCCGGCGCTTCAGGT	NA	NA	NA	NA
WP_000916763.1|4276387_4276618_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204699.1|4276756_4277131_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879280.1|4277134_4278007_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976492.1|4278019_4278361_+	YebY family protein	NA	NA	NA	NA	NA
WP_001189092.1|4278713_4279829_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.1	9.4e-98
WP_001443927.1|4279794_4280076_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001356607.1|4280182_4280371_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_042853000.1|4280363_4280558_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_000166317.1|4280614_4281424_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_000105101.1|4281416_4284068_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.6	0.0e+00
WP_001307773.1|4284166_4284442_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	3.0e-42
WP_001427414.1|4284515_4284686_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_000560218.1|4284685_4284907_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
WP_001427316.1|4285327_4285480_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_001448501.1|4285766_4286045_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|4286046_4286238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169687.1|4286258_4286630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|4286727_4287030_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|4287026_4287452_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001444941.1|4287474_4288437_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.5	2.7e-69
WP_000450872.1|4289210_4289972_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.2	3.9e-79
4289411:4289425	attR	ACCTGAAGCGCCGGA	NA	NA	NA	NA
WP_000603384.1|4290004_4290286_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|4290282_4290510_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|4290502_4290814_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|4290941_4291160_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|4291161_4291719_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|4291952_4292165_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|4292284_4292629_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|4292750_4293023_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|4293024_4294074_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217413.1|4294086_4294461_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_000762928.1|4294457_4295279_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000143050.1|4296449_4298300_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.0	0.0e+00
WP_000411802.1|4298747_4298954_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|4298953_4299451_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092325.1|4299447_4299885_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000881326.1|4300034_4300652_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001307652.1|4300839_4301034_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|4301422_4301968_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027379.1|4301942_4303868_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|4303864_4304071_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001443752.1|4304067_4305669_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000123251.1|4305649_4306969_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001365129.1|4306978_4307311_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|4307366_4308392_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|4308433_4308829_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|4308840_4309194_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975096.1|4309205_4309784_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683137.1|4309780_4310176_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235098.1|4310183_4310936_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479045.1|4310949_4311372_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|4311398_4311812_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081762.1|4311792_4314405_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	91.9	0.0e+00
WP_000847298.1|4314401_4314731_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032363306.1|4314730_4315429_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	6.8e-131
WP_053892383.1|4315439_4316183_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	1.7e-148
WP_050439450.1|4316128_4316761_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_064551593.1|4317104_4320500_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	83.5	0.0e+00
WP_106875079.1|4320702_4321044_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	99.1	1.4e-57
WP_000612626.1|4321040_4321388_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099148.1|4321436_4322975_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.6	3.3e-295
WP_001230428.1|4323030_4323630_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_000268926.1|4323694_4325008_+|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.3	2.8e-77
WP_001023379.1|4325009_4325279_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_000491545.1|4325419_4326295_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
WP_001121225.1|4326519_4327170_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000812724.1|4328124_4328781_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_001296140.1|4328781_4328973_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|4329077_4329314_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000057024.1|4329431_4330871_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001299674.1|4330950_4333584_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207284.1|4333552_4334836_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|4334965_4335463_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431370.1|4335559_4336258_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001431407.1|4336277_4338326_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.4e-86
WP_000984517.1|4338517_4339399_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001127210.1|4339444_4340818_-	MFS transporter	NA	NA	NA	NA	NA
WP_001262174.1|4340994_4341786_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001211011.1|4341928_4342168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|4342326_4342470_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001006866.1|4342544_4342832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295496.1|4343500_4343644_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|4343656_4343866_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_000010107.1|4344031_4344841_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001296134.1|4344837_4345404_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000156255.1|4345832_4346291_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_000228655.1|4346345_4347197_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000406926.1|4347209_4348010_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000150551.1|4348072_4349044_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_001295494.1|4351065_4352664_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000624298.1|4352794_4354159_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000456725.1|4354342_4354921_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000854972.1|4354924_4356286_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|4356359_4356539_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|4356658_4357018_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|4357380_4357725_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|4357856_4359767_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001221003.1|4359824_4360520_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP027387	Escherichia coli strain 2014C-3057 chromosome, complete genome	5645983	4526843	4702577	5645983	protease,tail,portal,terminase,holin,lysis,transposase,integrase,head,capsid,tRNA	Enterobacteria_phage(38.6%)	202	4652007:4652066	4675526:4676791
WP_001295400.1|4526843_4528118_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
WP_000789751.1|4528179_4529040_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_000765749.1|4529083_4529689_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100931.1|4529794_4531297_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030346.1|4531907_4532543_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289657.1|4532542_4533238_-	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_000920784.1|4533241_4533862_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_000231922.1|4533865_4534924_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000915761.1|4534924_4537147_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000991805.1|4537139_4537718_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133188.1|4537717_4538299_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_000214176.1|4538375_4538816_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217950.1|4538901_4539117_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_001300888.1|4539389_4539515_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_001282516.1|4539757_4540798_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000567490.1|4540832_4541834_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000459381.1|4541937_4543110_-	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000125607.1|4543119_4544712_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_000179510.1|4544886_4545915_+	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_000483353.1|4546026_4546794_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_001342191.1|4547014_4547605_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000945880.1|4547993_4549805_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.8	0.0e+00
WP_001075858.1|4549801_4551175_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_001227023.1|4551213_4552479_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_001043314.1|4552523_4554032_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170683.1|4554132_4555308_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066628.1|4555506_4557153_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_001099107.1|4557295_4558699_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000135186.1|4558695_4559625_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000732497.1|4559700_4561002_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	4.2e-17
WP_001092519.1|4561005_4561725_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524868.1|4561853_4562189_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000513673.1|4562185_4562908_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412379.1|4562944_4564327_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769322.1|4564512_4565457_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001295398.1|4565980_4567513_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014036.1|4567523_4568912_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000085277.1|4570018_4571248_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.4	1.6e-130
WP_000953271.1|4571622_4571811_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_001496008.1|4571863_4572790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024184083.1|4572722_4573013_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001113156.1|4573005_4573326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261488.1|4573332_4573632_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032341440.1|4573628_4575446_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.7	4.4e-129
WP_000125509.1|4575733_4575979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126691.1|4575975_4576386_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233310.1|4576396_4576669_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132080.1|4576794_4577019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137345.1|4577310_4578468_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_000504055.1|4578507_4579080_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	4.7e-61
WP_001398592.1|4579117_4580293_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	4.8e-185
WP_001020674.1|4580289_4580628_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
WP_000134113.1|4580624_4580921_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145905.1|4580920_4581361_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000174068.1|4581344_4581527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|4581650_4582007_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000127891.1|4581990_4583652_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	2.0e-277
WP_000133423.1|4583665_4583947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303517.1|4584983_4585154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000276149.1|4585260_4585626_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000046661.1|4585612_4585942_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260840.1|4585980_4586802_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|4586901_4586985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|4587077_4587413_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|4587809_4589063_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019545.1|4589169_4590063_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|4590197_4591418_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|4591542_4592238_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|4592190_4593483_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|4593641_4594256_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|4594298_4595153_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|4595154_4595772_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001342196.1|4595782_4598206_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_001307224.1|4600890_4601196_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|4601303_4602014_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138576.1|4602016_4602577_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|4602611_4602953_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|4603087_4603414_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|4603619_4604834_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|4604845_4605865_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001360138.1|4605922_4606033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877011.1|4606052_4607333_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	61.8	4.3e-155
WP_001339397.1|4607587_4608265_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4608264_4608612_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|4608631_4610203_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_106875080.1|4610398_4612870_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083280.1|4612963_4613155_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|4613151_4613340_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000347171.1|4613826_4614402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|4614403_4614559_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001003381.1|4614751_4615159_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|4615236_4615464_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|4615447_4615969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054507.1|4615949_4616915_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.3	6.5e-55
WP_001151195.1|4616955_4617375_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.3e-55
WP_000589012.1|4617408_4618749_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001317460.1|4619185_4619518_-	protein flxA	NA	NA	NA	NA	NA
WP_001326990.1|4619720_4620026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|4620050_4620290_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|4620289_4620577_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|4620648_4620804_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|4621020_4621272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|4621338_4621617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|4621618_4622668_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_001047133.1|4622681_4623434_+	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	1.3e-130
WP_120795389.1|4623711_4623801_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|4623855_4624068_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066483.1|4624368_4624584_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	4.5e-25
WP_000839590.1|4625337_4625553_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189915.1|4625557_4625869_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|4625865_4626399_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|4626395_4626893_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|4627255_4627468_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|4627478_4627667_+	cold-shock protein	NA	NA	NA	NA	NA
WP_122134696.1|4627669_4627735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|4627814_4627970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|4628141_4628315_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000035577.1|4628466_4628877_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001031435.1|4629177_4629384_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	3.9e-26
WP_000421825.1|4629944_4630484_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_000507036.1|4630492_4632592_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.6	0.0e+00
WP_001072975.1|4632588_4632801_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985929.1|4632800_4634309_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	4.5e-289
WP_001136588.1|4634253_4636281_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097041.1|4636367_4636691_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	98.1	5.5e-51
WP_001283148.1|4636683_4636959_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
WP_000677128.1|4636970_4637549_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	98.4	3.0e-100
WP_001079398.1|4637545_4637947_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211132.1|4637957_4638701_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001341514.1|4638761_4639148_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_001161009.1|4639156_4639486_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372024.1|4639457_4642523_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447251.1|4642522_4642852_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.0e-60
WP_001152371.1|4642861_4643560_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	1.9e-133
WP_000140707.1|4643564_4644308_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.9	1.8e-145
WP_000741589.1|4644205_4644853_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_000515505.1|4644913_4648327_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_001233114.1|4648397_4648997_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	2.5e-105
WP_100005742.1|4649061_4652010_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	54.0	2.9e-53
4652007:4652066	attL	TTGAGGTAGCCTGAGTTTAACGGACACTCCTTCCTGAAATAGAATGGCATCAGAAGGAGC	NA	NA	NA	NA
WP_085948186.1|4652071_4653227_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000885616.1|4653288_4653864_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086514.1|4653961_4654552_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000836768.1|4654868_4655102_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|4655170_4655284_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001206147.1|4655932_4657228_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.2	1.3e-154
WP_001368608.1|4657247_4657484_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000102117.1|4657571_4660034_-	exonuclease	NA	V5UQJ3	Shigella_phage	47.7	4.0e-125
WP_000199475.1|4660126_4660315_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|4660311_4660500_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|4661064_4661274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|4661274_4661913_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380321.1|4661924_4662077_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.9e-06
WP_000379972.1|4662243_4662651_-	helix-turn-helix domain-containing protein	NA	B1B6L9	Salmonella_phage	58.7	3.1e-14
WP_000920571.1|4662734_4662965_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705368.1|4662948_4663470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054520.1|4663450_4664416_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
WP_000790460.1|4664422_4665163_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	4.7e-114
WP_000450895.1|4665192_4665954_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	63.6	2.4e-73
WP_000215512.1|4666013_4666199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211993.1|4666550_4667102_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000882662.1|4667316_4667529_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000042395.1|4667631_4667949_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001217944.1|4667941_4668313_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001452497.1|4668536_4668764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012817785.1|4668817_4669087_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	3.0e-10
WP_001375683.1|4669088_4670138_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	4.6e-115
WP_001047111.1|4670151_4670904_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	2.6e-136
WP_000735807.1|4671748_4671973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000498121.1|4672025_4672235_+	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.5e-20
WP_001299632.1|4672424_4672856_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	98.6	7.8e-69
WP_153244796.1|4673205_4673349_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	97.4	3.7e-15
WP_032325211.1|4673334_4675185_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.0	0.0e+00
WP_085948186.1|4675590_4676746_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000411809.1|4676899_4677106_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
4675526:4676791	attR	TTGAGGTAGCCTGAGTTTAACGGACACTCCTTCCTGAAATAGAATGGCATCAGAAGGAGCTAATAATGAGCAGAAAAACCCAACGTTACTCTAAAGAGTTCAAAGCCGAAGCTGTCAGAACGGTTCTTGAAAATCAACTTTCGATCAGTGAAGGCGCTTCCCGATTATCTCTTCCTGAAGGCACTTTAGGACAATGGGTTACCGCCGCCAGAAAAGGGCTCGGTACTCCTGGTTCCCGCACGGTGGCTGAACTGGAATCTGAAATTCTGCAACTGCGTAAGGCGTTAAATGAAGCTCGCCTTGAGCGAGATATATTAAAAAAAGCAACAGCGTATTTTGCACAGGAGTCGCTGAAAAATACGCGTTAATCGAACAATGGCGACAACAATTTCCCATTGAAGCGATGTGTCAGGTATTTGGTGTATCCAGGAGCGGTTATTACAACTGGGTACAGCATGAACCCTCAGACAGAAAACAAAGTGATGAGCGGCTAAAACTGGAGATTAAGGTGGCACATATCCGCACTCGCGAAACATATGGAACCCGGCGGCTCCAGACGGAGCTGGCAGAGAATGGCATCATCGTTGGTCGTGACCGACTGGCACGTCTTCGTAAGGAGCTAAGGCTACGCTGTAAGCAGAAACGCAAGTTCAGAGCGACTACGAACTCGAACCACAATCTGCCAGTTGCGCCAAATCTGCTGAACCAGACGTTCGCTCCTACAGCACCAAATCAGGTCTGGGTGGCGGACCTGACGTATGTTGCCACACAGGAGGGATGGTTGTACCTCGCTGGCATCAAAGATGTTTATACGTGCGAAATTGTCGGCTACGCCATGGGAGAGCGCATGACAAAAGAGCTGACAGGTAAAGCTCTGTTTATGGCGCTCAGGAGCCAGCGCCCACCTGCCGGGCTAATCCACCACTCTGATCGAGGTTCACAGTACTGCGCATACGATTACCGGGTCATACAGGAGCAGTTTGGTCTGAAAACATCAATGTCGCGTAAAGGTAACTGTTACGACAACGCTCCGATGGAAAGCTTCTGGGGAACGCTGAAAAATGAGAGCCTGAGCCACTATCGTTTTAATAACCGGGATGAAGCCATCTCAGTAATACGGGAATACATTGAGATTTTCTACAATCGTCAGCGTCGTCACTCTCGTCTGGGGAATATCTCCCCGGCAGCCTTCAGGGAAAAATATCATCAGATGGCTGCTTAAAAAAAGAACAAATGGTAGTGTCCGCTATTGCCAGTACACCTCAA	NA	NA	NA	NA
WP_001041949.1|4677109_4677901_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000992045.1|4678412_4678946_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.6	8.1e-100
WP_001208680.1|4679497_4679683_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|4680210_4680525_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001431375.1|4680606_4680831_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	5.9e-20
WP_000867498.1|4681217_4681763_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|4681737_4683663_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|4683659_4683866_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|4683862_4685464_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|4685444_4686764_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|4686773_4687106_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063258.1|4687161_4688187_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158901.1|4688228_4688624_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	90.2	7.2e-53
WP_000752969.1|4688635_4688989_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	2.5e-57
WP_000975020.1|4689003_4689537_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|4689533_4689929_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235099.1|4689936_4690689_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.6	3.8e-135
WP_000479045.1|4690702_4691125_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|4691151_4691565_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081792.1|4691545_4694158_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
WP_000847298.1|4694154_4694484_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001357740.1|4694483_4695182_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000194802.1|4695192_4695936_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	2.4e-150
WP_133253573.1|4695881_4696514_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	95.2	3.1e-106
WP_106875081.1|4696759_4700236_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.9	0.0e+00
WP_001456919.1|4700304_4700928_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	5.1e-69
WP_000279009.1|4700992_4702306_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_001023433.1|4702307_4702577_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	6.4e-45
>prophage 16
NZ_CP027387	Escherichia coli strain 2014C-3057 chromosome, complete genome	5645983	4905498	4961685	5645983	tail,terminase,portal,holin,lysis,transposase,integrase,head,capsid,tRNA	Escherichia_phage(44.78%)	69	4946550:4946565	4962037:4962052
WP_000837943.1|4905498_4906632_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	4.1e-117
WP_001295593.1|4906772_4907207_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|4908147_4908789_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|4908870_4909500_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131657.1|4909572_4910148_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	1.8e-89
WP_001023379.1|4910260_4910530_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_000279018.1|4910531_4911845_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	2.8e-77
WP_001233130.1|4911909_4912509_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	97.5	1.8e-108
WP_106875083.1|4912576_4916053_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_122993493.1|4916298_4916931_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	7.1e-103
WP_001375575.1|4916876_4917620_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
WP_001375577.1|4917625_4918324_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
WP_000847304.1|4918323_4918653_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082320.1|4918649_4921229_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
WP_000533431.1|4921209_4921623_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|4921649_4922081_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000235067.1|4922094_4922847_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683137.1|4922854_4923250_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000975098.1|4923246_4923825_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
WP_000752994.1|4923836_4924190_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|4924201_4924597_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|4924638_4925664_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|4925719_4926052_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123251.1|4926061_4927381_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001443752.1|4927361_4928963_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000198153.1|4928959_4929166_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027379.1|4929162_4931088_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453587.1|4931062_4931608_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001307652.1|4931996_4932191_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881326.1|4932378_4932996_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092325.1|4933145_4933583_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000075132.1|4933579_4934077_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|4934076_4934283_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000143049.1|4934730_4936581_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000762928.1|4937751_4938573_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217413.1|4938569_4938944_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_001265080.1|4938956_4940006_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	3.4e-110
WP_001341382.1|4940007_4940286_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_000018421.1|4940453_4940666_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001278454.1|4940855_4940960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207986.1|4941075_4941945_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_000224233.1|4941955_4942219_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_042350895.1|4942220_4942385_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000935420.1|4942470_4942683_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000403777.1|4942733_4943090_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_001209480.1|4943067_4943529_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266134.1|4943525_4943822_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001151124.1|4943818_4944241_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.0e-64
WP_000450672.1|4944256_4945018_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	89.7	3.8e-119
WP_000788968.1|4945040_4945787_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_106875084.1|4946216_4947429_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	98.0	1.3e-164
4946550:4946565	attL	TGCTGGATAAGCTGCG	NA	NA	NA	NA
WP_001432368.1|4947432_4947912_-	YdaU family protein	NA	A0A0U2RT81	Escherichia_phage	82.4	3.2e-63
WP_000693802.1|4947975_4948398_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
WP_001072343.1|4948394_4948649_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233320.1|4948728_4949148_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001427316.1|4949446_4949599_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_000560223.1|4950019_4950241_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|4950240_4950411_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|4950485_4950761_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105151.1|4950862_4953463_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.2	2.6e-247
WP_000166313.1|4953455_4954265_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|4954320_4954470_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|4954507_4954696_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|4954795_4955011_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040851.1|4955012_4956248_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	3.0e-238
WP_001157407.1|4956299_4957235_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123745.1|4957363_4958737_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|4959214_4960198_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|4960452_4961685_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
4962037:4962052	attR	CGCAGCTTATCCAGCA	NA	NA	NA	NA
>prophage 17
NZ_CP027387	Escherichia coli strain 2014C-3057 chromosome, complete genome	5645983	5064635	5076771	5645983	holin,tail	Escherichia_phage(41.67%)	15	NA	NA
WP_001023357.1|5064635_5064905_-|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_106875085.1|5064925_5065471_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	2.0e-93
WP_000992088.1|5065741_5066275_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_000731221.1|5066325_5066670_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|5066674_5066890_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000023141.1|5067039_5068893_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
WP_001059384.1|5070417_5071107_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000140002.1|5071103_5071469_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001265290.1|5071469_5072525_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	4.9e-88
WP_010917803.1|5072526_5072805_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|5072874_5073132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|5073352_5073565_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001449026.1|5073843_5074602_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|5075300_5075465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157825328.1|5076228_5076771_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
>prophage 18
NZ_CP027387	Escherichia coli strain 2014C-3057 chromosome, complete genome	5645983	5189445	5343627	5645983	protease,tail,terminase,holin,transposase,integrase,head,capsid,tRNA	Stx2-converting_phage(30.0%)	189	5197736:5197750	5344052:5344066
WP_001297484.1|5189445_5190552_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|5190587_5191229_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|5191232_5192603_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|5192770_5193442_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|5193441_5194902_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|5194977_5196099_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359438.1|5196244_5197474_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|5197723_5198860_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
5197736:5197750	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799399.1|5198843_5199707_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_106875087.1|5199980_5200571_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_001144080.1|5200753_5201404_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001299273.1|5201478_5202537_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_012816780.1|5202664_5203300_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001118085.1|5203367_5203949_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_001131642.1|5204239_5204815_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023435.1|5204928_5205198_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	2.4e-44
WP_000279008.1|5205199_5206522_-|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	97.5	1.2e-75
WP_001216290.1|5206586_5207210_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_106875088.1|5207278_5210755_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.8	0.0e+00
WP_122993786.1|5211000_5211633_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	3.4e-105
WP_064551617.1|5211578_5212322_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	1.6e-149
WP_096954176.1|5212332_5213031_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	97.0	3.8e-129
WP_000807940.1|5213030_5213372_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_000212983.1|5213364_5216607_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.6	0.0e+00
WP_001513217.1|5216654_5216864_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030060.1|5216959_5217334_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275459.1|5217339_5218056_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	9.5e-128
WP_000133388.1|5218121_5218466_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|5218462_5218909_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007892.1|5218905_5219256_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	3.5e-59
WP_000125984.1|5219266_5219593_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|5222119_5222341_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173033.1|5222385_5224323_-|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.5	0.0e+00
WP_001341975.1|5224386_5226048_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
WP_000958402.1|5226044_5226608_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_001303046.1|5226897_5227263_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000095749.1|5227304_5227532_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_012816791.1|5227956_5228142_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|5228369_5228516_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|5228515_5229085_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_001092890.1|5229355_5229889_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	100.0	1.6e-103
WP_000731236.1|5229939_5230284_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000284518.1|5230288_5230504_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001290217.1|5230580_5230853_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000143462.1|5230893_5231073_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_000142998.1|5231208_5233146_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	100.0	0.0e+00
WP_000752026.1|5233645_5233915_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|5233924_5234872_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204852.1|5235378_5235813_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000144759.1|5235805_5236000_-	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001107963.1|5235996_5236602_-	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_001004024.1|5236601_5237324_-	DNA-binding protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_000211422.1|5237398_5238133_-	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001254256.1|5238407_5238590_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153280.1|5238586_5239114_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|5239110_5239557_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|5239513_5239750_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|5239760_5239976_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|5240108_5240387_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000145907.1|5240457_5240748_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	99.0	1.6e-46
WP_000788927.1|5240744_5241446_-	Replication protein P	NA	C1JJ58	Enterobacteria_phage	99.6	1.3e-129
WP_000185454.1|5241442_5242381_-	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000438542.1|5242413_5242710_-	hypothetical protein	NA	Q6H9X8	Enterobacteria_phage	100.0	5.2e-48
WP_000064148.1|5242848_5243082_-	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_000428098.1|5243195_5243900_+	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000866443.1|5244036_5244324_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	100.0	1.6e-49
WP_001082382.1|5244320_5244977_+	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	100.0	2.6e-116
WP_000687675.1|5244973_5245378_+	hypothetical protein	NA	A0A0P0ZDD3	Stx2-converting_phage	100.0	1.6e-68
WP_000198444.1|5245885_5246269_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167595.1|5246327_5246798_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_001198866.1|5246991_5247132_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q9AZ26	Salmonella_phage	100.0	3.3e-21
WP_000361831.1|5247124_5247238_+	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	100.0	2.7e-13
WP_000613346.1|5247234_5247423_+	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
WP_000536228.1|5247431_5248112_+	AAA family ATPase	NA	G9L667	Escherichia_phage	100.0	3.4e-127
WP_000073098.1|5248108_5248696_+	hypothetical protein	NA	G9L666	Escherichia_phage	99.5	4.9e-106
WP_001111290.1|5248719_5249016_+	DUF2856 family protein	NA	G9L665	Escherichia_phage	98.0	2.3e-48
WP_001214439.1|5249026_5249191_+	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	9.3e-23
WP_000812200.1|5249187_5249817_+	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	73.9	3.1e-58
WP_000034212.1|5249813_5250221_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_001014298.1|5250222_5250414_+	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_106875089.1|5250416_5250875_+	hypothetical protein	NA	V5UT79	Shigella_phage	54.5	2.1e-19
WP_000224734.1|5250880_5251078_+	hypothetical protein	NA	A0A222YWL3	Escherichia_phage	93.4	3.2e-25
WP_085948186.1|5251220_5252377_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000628762.1|5252858_5253770_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	94.4	3.6e-164
WP_042357761.1|5253702_5253918_+	DUF1382 family protein	NA	G3CFH1	Escherichia_phage	100.0	6.7e-29
WP_000994788.1|5253953_5254325_+	DUF1627 domain-containing protein	NA	A0A0P0ZH73	Escherichia_phage	88.6	8.3e-51
WP_021351637.1|5254468_5254702_+	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
WP_000497812.1|5254689_5254941_+	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_001208773.1|5254986_5255271_+	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000013656.1|5255323_5256634_+|integrase	site-specific integrase	integrase	A0A0P0ZGA8	Escherichia_phage	99.5	6.0e-253
WP_000607021.1|5256630_5257209_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|5257229_5257457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044313.1|5257494_5258736_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000097601.1|5259027_5260287_-	YccE family protein	NA	NA	NA	NA	NA
WP_000420629.1|5260546_5261467_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
WP_000024561.1|5261466_5261772_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209869.1|5261864_5262464_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062101.1|5262460_5265007_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_001230242.1|5265006_5266179_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|5266308_5267001_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264955.1|5266973_5268002_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001444338.1|5268084_5270829_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_000818472.1|5270900_5271974_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|5272021_5272195_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001316982.1|5272184_5272415_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|5272389_5272578_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|5272588_5272801_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|5273086_5273299_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001295358.1|5273740_5274046_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001247610.1|5274152_5274797_+	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001038062.1|5274793_5275540_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742348.1|5275539_5277636_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|5277681_5278821_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|5278808_5279255_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208650.1|5279274_5281455_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001300464.1|5281569_5282868_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000270305.1|5282947_5283040_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460810.1|5283052_5284189_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_071999646.1|5284200_5285697_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004899.1|5285879_5286737_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063971.1|5286733_5287132_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003671.1|5287128_5287716_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186421.1|5287712_5288420_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|5288438_5290232_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|5290228_5291347_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_095585410.1|5291942_5292095_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
WP_000938122.1|5292471_5293833_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	39.8	4.4e-49
WP_001443842.1|5293895_5294171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001023483.1|5294287_5294557_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
WP_000381395.1|5294594_5296166_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|5296185_5296533_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|5296532_5297210_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000279108.1|5297265_5298579_-|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	96.3	1.2e-72
WP_001230532.1|5298643_5299243_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
WP_044869064.1|5299309_5299504_-	hypothetical protein	NA	A0A0P0ZCI5	Stx2-converting_phage	98.4	4.6e-29
WP_106875090.1|5299505_5302784_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.8	0.0e+00
WP_122993493.1|5303029_5303662_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	7.1e-103
WP_001429308.1|5303607_5304351_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_001335877.1|5304361_5305060_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000807940.1|5305059_5305401_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_000212983.1|5305393_5308636_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.6	0.0e+00
WP_001513217.1|5308684_5308894_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030060.1|5308989_5309364_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275459.1|5309369_5310086_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	9.5e-128
WP_000133388.1|5310151_5310496_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|5310492_5310939_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007892.1|5310935_5311286_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	3.5e-59
WP_000125984.1|5311296_5311623_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|5314149_5314371_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173033.1|5314415_5316353_-|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.5	0.0e+00
WP_001341975.1|5316416_5318078_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
WP_000958402.1|5318074_5318638_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_001365481.1|5318927_5319293_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	98.3	5.8e-65
WP_001341372.1|5319334_5319520_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	88.5	6.4e-20
WP_000347013.1|5319649_5319790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|5320146_5320371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|5320435_5320642_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_001443546.1|5321019_5321211_-	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	63.9	7.8e-05
WP_001003112.1|5321288_5321822_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_000138558.1|5321981_5322254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411804.1|5322509_5322716_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_000143031.1|5323006_5324857_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000466957.1|5325427_5325859_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000611213.1|5326330_5327380_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	88.5	4.0e-183
WP_000917767.1|5327530_5327728_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000640023.1|5328040_5328583_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.3	1.4e-67
WP_000140011.1|5328591_5328957_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	6.7e-37
WP_001265089.1|5328957_5330013_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	1.5e-89
WP_001341382.1|5330014_5330293_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_000902687.1|5330460_5330673_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|5330859_5330964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137957.1|5331073_5331637_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	93.9	2.9e-47
WP_001273106.1|5331763_5332075_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001375713.1|5332071_5332224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|5332590_5333746_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000702797.1|5333876_5334101_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450612.1|5334122_5334821_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.1	4.7e-71
WP_000373320.1|5334855_5335278_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_001262408.1|5335309_5336347_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	67.1	1.7e-85
WP_000693816.1|5336415_5336841_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|5336837_5337065_-	cell division protein	NA	NA	NA	NA	NA
WP_000444615.1|5337162_5337807_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|5338082_5338235_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449192.1|5338724_5338913_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|5338909_5339101_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048520.1|5339193_5341665_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000003742.1|5341726_5341996_+	excisionase	NA	NA	NA	NA	NA
WP_000074974.1|5341964_5343083_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	2.6e-84
WP_001113310.1|5343159_5343627_-	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
5344052:5344066	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 19
NZ_CP027387	Escherichia coli strain 2014C-3057 chromosome, complete genome	5645983	5487272	5590814	5645983	protease,tail,terminase,capsid,holin,integrase,head,transposase	Escherichia_phage(32.88%)	114	5501740:5501757	5560265:5560282
WP_001182418.1|5487272_5488352_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|5488351_5489308_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506898.1|5489318_5490527_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|5490544_5491012_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|5491272_5491602_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957249.1|5491588_5491969_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|5492872_5494486_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|5494516_5494867_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|5494863_5495289_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000397130.1|5497476_5498148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135715.1|5499018_5499159_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000803992.1|5499460_5499724_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001021388.1|5500933_5501551_-	urease accessory protein UreG	NA	NA	NA	NA	NA
5501740:5501757	attL	CAGCCTGACGCCCGCCAT	NA	NA	NA	NA
WP_000966485.1|5502238_5502703_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000467898.1|5502712_5504383_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_000612148.1|5504408_5504729_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|5504737_5505040_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_000886249.1|5505049_5505829_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000134927.1|5506209_5506485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000591994.1|5506709_5508329_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|5508421_5508781_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_001304211.1|5509466_5509757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303891.1|5509780_5510032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028913479.1|5510079_5510685_-	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_001171554.1|5512076_5512457_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|5512453_5512801_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000997978.1|5512850_5514383_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	4.6e-297
WP_000909011.1|5514708_5514978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233452.1|5515139_5517500_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000282084.1|5517654_5518218_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335696.1|5519038_5520472_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|5520690_5520888_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|5521114_5521411_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000282206.1|5522522_5524340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279869.1|5524526_5525729_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_001297190.1|5526354_5526810_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_071531009.1|5527621_5528545_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.2	7.8e-90
WP_001199164.1|5529028_5530300_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154411.1|5530305_5531433_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497942.1|5531490_5532321_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_001018496.1|5532986_5534495_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000979516.1|5534653_5534863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001341463.1|5534917_5538880_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000191700.1|5538919_5539558_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001297176.1|5539845_5540937_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001307708.1|5540936_5541629_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126777.1|5541640_5542027_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001341462.1|5542034_5542835_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001171.1|5542844_5543435_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028095.1|5543445_5543940_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001240628.1|5543960_5545289_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
WP_001273658.1|5545371_5545545_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_122988840.1|5546912_5546990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023986.1|5547100_5547370_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	96.6	4.2e-44
WP_000268971.1|5547371_5548685_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	4.8e-77
WP_001230400.1|5548749_5549349_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	1.3e-109
WP_106875092.1|5549415_5552892_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.3	0.0e+00
WP_122993786.1|5553137_5553770_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	3.4e-105
WP_001375566.1|5553715_5554453_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.8	7.2e-147
WP_001432327.1|5554507_5555431_-	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	98.0	6.6e-174
WP_001154345.1|5555501_5555675_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|5555782_5556103_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001448747.1|5556119_5556818_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	99.1	1.6e-132
WP_000807964.1|5556817_5557159_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212984.1|5557151_5560394_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.6	0.0e+00
5560265:5560282	attR	CAGCCTGACGCCCGCCAT	NA	NA	NA	NA
WP_001513217.1|5560441_5560651_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_032345945.1|5560746_5561121_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	98.4	6.6e-64
WP_001275471.1|5561126_5561843_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_000133388.1|5561908_5562253_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|5562249_5562696_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007892.1|5562692_5563043_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	3.5e-59
WP_000125984.1|5563053_5563380_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|5565906_5566128_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173033.1|5566172_5568110_-|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.5	0.0e+00
WP_001341975.1|5568173_5569835_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
WP_000958402.1|5569831_5570395_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_000279807.1|5570684_5571050_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	5.4e-63
WP_001448509.1|5571091_5571316_+	YlcI/YnfO family protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_001302717.1|5571397_5571712_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|5572237_5572423_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000455402.1|5572650_5572800_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_001056882.1|5572799_5573369_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	98.9	3.4e-104
WP_000087714.1|5573643_5574177_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001072901.1|5574181_5574397_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|5574474_5574720_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143463.1|5574760_5574940_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_000023293.1|5575075_5577013_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_000466957.1|5577490_5577922_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000301785.1|5578371_5579085_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917770.1|5579219_5579417_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640048.1|5579658_5580189_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904103.1|5580197_5580557_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_001265113.1|5580569_5581616_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_001342259.1|5581617_5581890_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_001260977.1|5582025_5582283_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_000220601.1|5582288_5582588_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_000206830.1|5582792_5583137_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	1.7e-58
WP_001229304.1|5583133_5583499_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.5e-68
WP_000209152.1|5583500_5583719_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
WP_001289353.1|5583806_5584442_-	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_001224662.1|5584607_5584790_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000935422.1|5584823_5585036_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_000403783.1|5585086_5585443_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_001209480.1|5585420_5585882_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266133.1|5585878_5586175_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_001040234.1|5586171_5586564_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
WP_000450641.1|5586579_5587305_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.2e-77
WP_072096947.1|5587338_5587881_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	1.8e-78
WP_000729535.1|5587792_5588803_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.8	4.9e-170
WP_000693932.1|5588889_5589327_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
WP_001172789.1|5589323_5589584_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
WP_000578360.1|5589710_5590103_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_001022415.1|5590149_5590509_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
WP_000692026.1|5590511_5590814_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
>prophage 20
NZ_CP027387	Escherichia coli strain 2014C-3057 chromosome, complete genome	5645983	5595929	5644441	5645983	protease,tail,portal,terminase,holin,transposase,integrase,head,capsid	Enterobacteria_phage(38.3%)	60	5592272:5592290	5641356:5641374
5592272:5592290	attL	CACCGCATCACAAAATTCA	NA	NA	NA	NA
WP_106875093.1|5595929_5597143_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	1.1e-168
WP_077630526.1|5597218_5597845_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	55.0	8.2e-59
WP_012817749.1|5598648_5599401_+	type III effector	NA	NA	NA	NA	NA
WP_001023445.1|5599525_5599795_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_000268933.1|5599796_5601110_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	4.8e-77
WP_001216290.1|5601174_5601798_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_106875088.1|5601866_5605343_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.8	0.0e+00
WP_122993493.1|5605588_5606221_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	7.1e-103
WP_064551617.1|5606166_5606910_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	1.6e-149
WP_001448659.1|5606920_5607619_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	97.4	3.4e-130
WP_000847298.1|5607618_5607948_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_106875094.1|5607944_5610557_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.1	0.0e+00
WP_000533442.1|5610537_5610951_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|5610977_5611400_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235067.1|5611413_5612166_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683137.1|5612173_5612569_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000975098.1|5612565_5613144_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
WP_000752994.1|5613155_5613509_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|5613520_5613916_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|5613957_5614983_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|5615038_5615371_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123251.1|5615380_5616700_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001443752.1|5616680_5618282_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000198153.1|5618278_5618485_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027379.1|5618481_5620407_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453587.1|5620381_5620927_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001300236.1|5621323_5621548_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|5621629_5621944_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|5622470_5622656_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|5622877_5622991_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|5623211_5623745_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|5623904_5624177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411814.1|5624432_5624639_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000874350.1|5625086_5626937_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000261909.1|5627704_5628418_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917737.1|5628555_5628753_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000265267.1|5629039_5629858_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090265.1|5630009_5630381_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|5630370_5630742_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265141.1|5630754_5631804_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.5e-110
WP_001341382.1|5631805_5632084_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_000018421.1|5632251_5632464_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_000955173.1|5632508_5632646_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|5633011_5633785_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|5634136_5634550_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000451007.1|5634565_5635336_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_000788742.1|5635357_5636104_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.6	5.6e-115
WP_001205821.1|5636110_5637226_-	hypothetical protein	NA	V5URT9	Shigella_phage	68.4	3.4e-132
WP_000273724.1|5637304_5637760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|5637966_5638392_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|5638375_5638648_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|5638756_5639158_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|5639185_5639377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|5639376_5639664_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000380316.1|5639940_5640093_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394543.1|5640104_5640743_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	3.3e-07
WP_001133037.1|5640743_5640953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|5641520_5641709_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
5641356:5641374	attR	TGAATTTTGTGATGCGGTG	NA	NA	NA	NA
WP_001098307.1|5641705_5641897_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048583.1|5641990_5644441_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
