The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027388	Escherichia coli strain 2011C-4251 chromosome, complete genome	5440026	169170	178612	5440026		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569329.1|169170_170097_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|170101_170833_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|170813_170921_-	protein YohO	NA	NA	NA	NA	NA
WP_001240402.1|170980_171712_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|171933_173619_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|173615_174335_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|174381_174852_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|174892_175354_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001298843.1|175478_177479_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001292774.1|177475_178612_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 2
NZ_CP027388	Escherichia coli strain 2011C-4251 chromosome, complete genome	5440026	191048	254277	5440026	capsid,tRNA,terminase,head,tail,portal,transposase,integrase,holin	Cronobacter_phage(56.25%)	64	218298:218319	252745:252766
WP_001295427.1|191048_193082_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005457.1|193213_194323_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|194585_194867_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|195159_195702_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677385.1|195782_196457_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945416.1|196472_198953_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001026151.1|198966_200001_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|200082_200421_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134575.1|200639_201464_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|201584_201857_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195605.1|202079_202868_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|202864_203665_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001368724.1|203729_204548_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.9	4.5e-25
WP_000434035.1|204599_205346_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011952.1|205319_206285_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846217.1|206281_207286_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000858482.1|207282_208560_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|208816_209869_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289787.1|210178_211021_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853892.1|211061_212324_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|212333_212786_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823285.1|212816_213101_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490714.1|213104_214460_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|214506_215547_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178548.1|215646_216426_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|216507_217407_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000716757.1|217821_218139_+	hypothetical protein	NA	NA	NA	NA	NA
218298:218319	attL	AAAAAATAAGCCCGTGTAAGGG	NA	NA	NA	NA
WP_000152889.1|218403_219411_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	86.3	1.8e-169
WP_000106734.1|219556_219856_-	helix-turn-helix transcriptional regulator	NA	Q1JS83	Enterobacteria_phage	71.7	3.0e-35
WP_000043870.1|219979_220255_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	85.6	2.3e-42
WP_000379072.1|220277_220592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947970.1|220643_221856_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000671519.1|221942_222422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366435.1|222560_222782_+	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	50.0	1.7e-11
WP_000928405.1|222797_223187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621309.1|223257_224148_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	59.7	9.1e-96
WP_000180138.1|224144_226757_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	38.5	5.7e-130
WP_032363470.1|227121_229914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000247826.1|230176_230452_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	56.0	4.9e-24
WP_000163094.1|230499_231561_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	61.0	4.0e-122
WP_001151936.1|231557_233369_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	54.4	1.3e-184
WP_001298853.1|233545_234607_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	44.8	1.3e-32
WP_001177621.1|234635_235658_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	55.4	5.0e-98
WP_001251931.1|235660_236362_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	57.1	3.4e-69
WP_000016519.1|236464_236938_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	54.3	1.6e-30
WP_000080428.1|236934_237411_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_042854138.1|237446_238103_+	phage protein	NA	F1BUL6	Cronobacter_phage	59.4	2.9e-67
WP_000220190.1|238105_239248_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	60.8	6.2e-129
WP_000140064.1|239251_239707_+	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	51.7	7.5e-38
WP_000980879.1|239711_240023_+|holin	holin	holin	NA	NA	NA	NA
WP_000777034.1|240009_240348_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	84.2	5.2e-44
WP_001245144.1|240347_240731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000045611.1|240833_241103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018644.1|241292_243407_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	41.5	2.4e-142
WP_000102748.1|243403_243739_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	60.6	4.3e-30
WP_000136916.1|243731_244916_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	69.2	2.0e-154
WP_000134372.1|244908_245502_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	62.2	3.0e-71
WP_000076019.1|245513_247478_+|tail	tail protein	tail	F1BUK3	Cronobacter_phage	67.2	1.3e-126
WP_077627876.1|247699_248065_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	55.2	3.2e-31
WP_000267977.1|248054_248783_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	39.9	2.2e-39
WP_000083769.1|248754_249297_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	56.0	4.2e-43
WP_000802615.1|249304_251029_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	62.1	1.6e-173
WP_000780870.1|251613_252579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476011.1|252915_254277_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
252745:252766	attR	AAAAAATAAGCCCGTGTAAGGG	NA	NA	NA	NA
>prophage 3
NZ_CP027388	Escherichia coli strain 2011C-4251 chromosome, complete genome	5440026	364159	503165	5440026	capsid,protease,terminase,head,tail,portal,transposase,integrase,holin	Escherichia_phage(36.28%)	151	364185:364244	444381:444950
WP_071998452.1|364159_364261_-|transposase	transposase	transposase	A0A0N7BTS3	Escherichia_phage	83.9	3.4e-07
364185:364244	attL	TGAACCGCCCCGGTTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
WP_106913050.1|364756_364936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221623.1|364923_365331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000656344.1|367645_368680_-	phosphotriesterase	NA	NA	NA	NA	NA
WP_000739825.1|368682_369648_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001066367.1|369704_370463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973179.1|375358_375904_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|375900_376644_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193798.1|376655_377735_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986308.1|377796_378732_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011461.1|379188_380106_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011007.1|380207_381158_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122994120.1|381275_382919_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532923.1|383546_384263_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|384605_386060_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378571.1|386161_387478_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000477878.1|387792_388845_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_085947970.1|395023_396236_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001300307.1|397986_398784_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533625.1|399019_400045_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.0e-103
WP_000096346.1|400044_400248_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000048403.1|400306_402778_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.2	1.7e-59
WP_001090200.1|402870_403062_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|403058_403247_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|403817_404027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023982533.1|404027_404666_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001345283.1|404677_404830_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_024173647.1|405122_405461_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	1.5e-06
WP_000747951.1|405852_406095_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693883.1|406078_406504_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262348.1|406575_407658_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000788760.1|407664_408411_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_000450617.1|408432_409149_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_042353845.1|409181_409463_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	72.5	3.9e-29
WP_000699809.1|409459_409687_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000034815.1|409679_409991_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000683609.1|410118_410337_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|410338_410896_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|411129_411342_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|411461_411806_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|411927_412200_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|412201_413251_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217447.1|413263_413623_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_000640035.1|413631_414186_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|414411_414609_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|414744_415458_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001368722.1|415908_416340_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_106913051.1|416818_418669_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000731192.1|419180_419525_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_000992157.1|419575_420109_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	95.5	3.1e-99
WP_001303555.1|420264_420447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|420459_420591_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|420818_421004_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_106913052.1|421531_421846_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|421927_422152_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000235436.1|422546_423056_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_012816790.1|423027_424956_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	5.5e-263
WP_000259008.1|424939_425146_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	1.8e-10
WP_000831765.1|425142_426735_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
WP_001253961.1|426724_428230_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.2	1.0e-99
WP_000256809.1|428266_428614_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000522615.1|428671_429700_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
WP_000201523.1|429751_430126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204554.1|430118_430472_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000975041.1|430486_431020_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	1.3e-57
WP_000683066.1|431016_431412_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_000106786.1|431419_432172_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	4.6e-133
WP_000479070.1|432185_432617_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	1.4e-41
WP_000533415.1|432643_433057_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	6.0e-42
WP_000082502.1|433037_435617_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.1	0.0e+00
WP_000847304.1|435613_435943_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_106913053.1|435942_436641_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.4e-131
WP_106913054.1|436646_437390_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	1.2e-146
WP_096220578.1|437335_437968_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	96.7	2.5e-103
WP_000649829.1|438158_438686_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_032362343.1|438819_442296_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.9	0.0e+00
WP_001230425.1|442362_442962_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	1.3e-109
WP_032362342.1|443026_444340_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.2	8.5e-82
WP_085947970.1|444422_445636_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
444381:444950	attR	TGAACCGCCCCGGTTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATCGTTTCTGATGGAAGCATAATAAGCTTTTTCTGCTTCTGCCGGAGGGATATGACCCAGCCTTCCCAGCAATCGTCGATTGTTATACCAGTCCACCCACGTGAGTGTGGCCAGTTCCACTTCTGCACGGTTTTTCCAGCTCTTACGGTGTATTACCTCCGCTTTGTAAAGACCATTGATGCTCTCCGCCATCGCGTTGTCATACGAGTCACCTGTACTCCCTGTTGATGCCAGCAGTTTTGCTTCTTTTAGTCGCTCCGTATAGGCCAGTGATACATACTGAGAACCTTTATCACTGTGATGGACTGTGCCGGACGGCCGACGGGCCCACAACGCCTGCTCCAGTGCATCCAGCACGAATGTCGTTTCCATAGACGATGAGACTCGCCACCCCACGATACATCCGGCAAACACATCAATGATGAACGCCACATAGACGAAGCCCTGCCATGTGCTGACGTAAGTAAAATCAGCCACCCACAGCTGGTCAGGACGTTCTGCCACGAACTGACG	NA	NA	NA	NA
WP_000273151.1|446514_446757_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_106913055.1|446824_449275_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000199475.1|449369_449558_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|449554_449743_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001331716.1|450143_450308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171921.1|450311_450530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024182289.1|450622_450823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000692026.1|451236_451539_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_001022415.1|451541_451901_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
WP_000578360.1|451947_452340_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_001172789.1|452466_452727_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
WP_000693932.1|452723_453161_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
WP_000729535.1|453247_454258_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.8	4.9e-170
WP_072096947.1|454169_454712_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	1.8e-78
WP_001040234.1|455486_455879_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
WP_001266133.1|455875_456172_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_001209480.1|456168_456630_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403783.1|456607_456964_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_000935422.1|457014_457227_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_001224662.1|457260_457443_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_001289353.1|457608_458244_+	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_000209152.1|458331_458550_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
WP_001229296.1|458551_458917_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000206830.1|458913_459258_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	1.7e-58
WP_000220601.1|459462_459762_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_001260977.1|459767_460025_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_001342259.1|460160_460433_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_001265113.1|460434_461481_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_000904103.1|461493_461853_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_000640048.1|461861_462392_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917770.1|462633_462831_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301785.1|462965_463679_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|464128_464560_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000023293.1|465037_466975_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_000143463.1|467110_467290_+	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_001290230.1|467330_467576_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|467653_467869_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087714.1|467873_468407_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001056883.1|468681_469251_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000455402.1|469250_469400_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_001208680.1|469627_469813_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|470338_470653_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001448509.1|470734_470959_-	YlcI/YnfO family protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_001400346.1|471000_471366_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	98.3	3.8e-64
WP_000958380.1|471655_472219_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001399867.1|472215_473877_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_001063099.1|475922_476144_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125984.1|478670_478997_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|479007_479358_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|479354_479801_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|479797_480142_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|480208_480925_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710954.1|480939_481314_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	8.6e-64
WP_122993730.1|481409_481619_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	92.8	2.6e-30
WP_000212998.1|481669_484912_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.5	0.0e+00
WP_000807922.1|484904_485246_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	6.2e-61
WP_032362322.1|485245_485944_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	96.1	1.6e-127
WP_032362323.1|485949_486693_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	1.8e-145
WP_047085664.1|486638_487271_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.7	2.5e-103
WP_106913056.1|487509_490983_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.6	0.0e+00
WP_001434935.1|491050_491650_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	4.4e-110
WP_000268886.1|491714_493028_+	hypothetical protein	NA	Q9EYE8	Enterobacteria_phage	99.3	4.8e-77
WP_001339397.1|493083_493761_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|493760_494108_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381372.1|494127_495699_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
WP_001023483.1|495736_496006_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
WP_000938124.1|496460_497822_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_095585410.1|498198_498351_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
WP_023982790.1|498946_500065_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107389.1|500061_501855_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186416.1|501873_502581_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003672.1|502577_503165_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP027388	Escherichia coli strain 2011C-4251 chromosome, complete genome	5440026	649506	724415	5440026	capsid,tRNA,terminase,head,tail,transposase,integrase,holin	Stx2-converting_phage(31.37%)	81	689751:689765	713038:713052
WP_001113310.1|649506_649974_+	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
WP_000074973.1|650050_651169_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	2.0e-84
WP_000003742.1|651137_651407_-	excisionase	NA	NA	NA	NA	NA
WP_000048411.1|651468_653940_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_001090200.1|654032_654224_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|654220_654409_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|654809_654974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171966.1|654977_655196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001443692.1|655355_655511_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	5.7e-06
WP_000948452.1|655829_656306_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|656430_656754_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693916.1|656737_657163_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|657185_658148_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000788938.1|658154_658895_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000450874.1|658920_659691_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.3	2.2e-82
WP_000627694.1|660158_660743_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	86.1	1.0e-34
WP_001278450.1|660858_660963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000884071.1|661151_661364_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	67.1	1.2e-17
WP_001341388.1|661531_661810_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265175.1|661811_662861_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	9.4e-108
WP_000904098.1|662873_663248_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	3.2e-34
WP_000762928.1|663244_664066_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000143049.1|665236_667087_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000411804.1|667379_667586_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_000138558.1|667841_668114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003112.1|668273_668807_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_001208682.1|669453_669660_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|669724_669949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|670305_670446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302977.1|670575_670761_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000279814.1|670802_671168_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	1.7e-64
WP_000958380.1|671458_672022_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001399867.1|672018_673680_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_001063099.1|675725_675947_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125984.1|678473_678800_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|678810_679161_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|679157_679604_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|679600_679945_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|680011_680728_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710954.1|680742_681117_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	8.6e-64
WP_122993730.1|681212_681422_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	92.8	2.6e-30
WP_000212998.1|681472_684715_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.5	0.0e+00
WP_000807922.1|684707_685049_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	6.2e-61
WP_032362331.1|685048_685705_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	96.8	7.9e-121
WP_106913058.1|685744_686958_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.0	2.7e-167
WP_032362323.1|687065_687809_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	1.8e-145
WP_047085664.1|687754_688387_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.7	2.5e-103
WP_106913059.1|688625_692099_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.3	0.0e+00
689751:689765	attL	GTGGTGGTGGATGAT	NA	NA	NA	NA
WP_001434935.1|692166_692766_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	4.4e-110
WP_106913060.1|692830_694144_+|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	98.9	1.1e-76
WP_001023420.1|694145_694415_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_115801847.1|694521_694611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|694630_696979_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_024201799.1|697570_700972_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	2.3e-219
WP_000938111.1|701348_702710_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_000799400.1|703072_703936_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|703919_705056_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359439.1|705305_706535_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|706680_707802_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000085258.1|708050_709280_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	8.4e-132
WP_000953272.1|709635_709824_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_012816761.1|709881_710910_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000336166.1|710899_711364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204981.1|711356_711590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770175.1|711595_711895_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833618.1|711891_713292_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	9.6e-116
713038:713052	attR	GTGGTGGTGGATGAT	NA	NA	NA	NA
WP_000192401.1|713492_713744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126687.1|713740_714151_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|714161_714434_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|714560_714785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796962.1|715036_715243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907455.1|715242_716298_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.7	3.5e-70
WP_000380886.1|716310_716646_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224599.1|716658_717072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816762.1|717277_717820_+|terminase	terminase	terminase	O64316	Escherichia_phage	43.6	1.5e-32
WP_000133424.1|718075_718357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735406.1|718958_720419_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|720418_721090_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|721257_722628_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|722631_723273_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|723308_724415_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP027388	Escherichia coli strain 2011C-4251 chromosome, complete genome	5440026	827856	888753	5440026	protease,lysis,terminase,tail,portal,transposase,integrase,holin	Enterobacteria_phage(32.0%)	68	827693:827720	874949:874976
827693:827720	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|827856_828987_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|828964_829213_-	excisionase	NA	NA	NA	NA	NA
WP_106913061.1|829277_831749_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_001090200.1|831841_832033_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|832029_832218_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000379610.1|832705_832858_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_001003379.1|833047_833455_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000476986.1|833532_833760_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705378.1|833743_834295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020532.1|834266_835307_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	1.8e-90
WP_157837342.1|835218_835761_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	2.9e-84
WP_000450846.1|835794_836565_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.4	1.4e-84
WP_001118156.1|836580_836961_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.5	4.1e-29
WP_000403785.1|837033_837390_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_000789359.1|837918_838635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373318.1|838618_839413_-	protein kinase	NA	A0A1S5V1U4	Saudi_moumouvirus	29.7	7.3e-12
WP_000967408.1|839766_839979_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_077625879.1|840195_840456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032156506.1|840525_840804_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.3e-11
WP_001265167.1|840805_841855_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.9e-108
WP_032362334.1|841867_842242_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.8	2.1e-33
WP_000762909.1|842238_843060_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.5e-81
WP_000917735.1|843286_843484_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000935552.1|843634_844693_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	1.5e-206
WP_000142957.1|845196_847143_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
WP_000143462.1|847278_847458_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290230.1|847498_847744_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|847821_848037_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_085947970.1|848142_849356_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_106913062.1|849354_849888_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	100.0	4.3e-93
WP_000539792.1|850732_850879_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001082574.1|850886_851354_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	99.4	2.0e-78
WP_000373407.1|851767_852244_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077608.1|852240_854364_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|854360_854573_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974567.1|854572_856075_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	1.2e-289
WP_001365078.1|856064_858044_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.9	0.0e+00
WP_001097065.1|858131_858458_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|858450_858732_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|858734_859358_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|859370_859769_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|859776_860529_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479059.1|860542_860965_+|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	97.9	1.3e-71
WP_000532073.1|860991_861300_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918272.1|861343_863989_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.6	0.0e+00
WP_000847298.1|863985_864315_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001303033.1|864314_865013_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	7.6e-130
WP_001303030.1|865023_865767_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.3e-148
WP_077775224.1|865712_866342_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	6.4e-104
WP_000514950.1|866582_870059_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.2	0.0e+00
WP_001230517.1|870125_870725_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	1.7e-109
WP_106913063.1|870789_872103_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.2	8.5e-82
WP_001023406.1|872104_872374_+|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_032243391.1|873504_874089_+	protein kinase	NA	NA	NA	NA	NA
WP_001079494.1|875126_875633_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
874949:874976	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|875678_876179_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|876264_876444_-	general stress protein	NA	NA	NA	NA	NA
WP_000443056.1|876824_877631_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209519.1|877630_878824_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001434952.1|878835_880194_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763511.1|880197_881793_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001700591.1|883445_883490_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|883627_884509_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|884505_885126_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|885226_886099_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278904.1|886138_886729_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559280.1|886725_887484_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_000422045.1|887703_888753_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
NZ_CP027388	Escherichia coli strain 2011C-4251 chromosome, complete genome	5440026	965044	1017673	5440026	tRNA,protease,lysis,terminase,tail,portal,integrase,holin	Escherichia_phage(39.66%)	63	970381:970406	1015740:1015765
WP_000628065.1|965044_966277_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387395.1|966531_967515_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001296046.1|967789_967963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123745.1|967992_969366_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157382.1|969494_970430_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.6	5.4e-147
970381:970406	attL	TTGTTCAGGTTGTATTGTTCTTTCTT	NA	NA	NA	NA
WP_000040845.1|970481_971717_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	1.1e-237
WP_000079604.1|971718_971934_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001356607.1|972033_972222_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_042853000.1|972214_972409_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_000166315.1|972465_973275_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000102194.1|973267_975937_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	61.3	4.2e-205
WP_001427414.1|976017_976188_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_000560226.1|976187_976409_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_000887681.1|976455_977304_-	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	60.8	5.9e-60
WP_000379547.1|977715_977868_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000410105.1|978174_978594_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_001033914.1|978690_978933_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000702017.1|978929_979352_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	5.9e-69
WP_001356605.1|979429_980218_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.0	5.1e-42
WP_000788984.1|980224_980971_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	4.8e-114
WP_000450718.1|980993_981755_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	1.0e-116
WP_001151116.1|981770_982193_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.8e-63
WP_000014164.1|982189_982420_+	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	76.8	4.1e-16
WP_001138877.1|982574_983225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000418464.1|983211_984333_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000902698.1|984455_984668_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.2e-17
WP_071525388.1|984904_985156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940305.1|985227_985827_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	1.0e-106
WP_000228017.1|985826_986117_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	8.2e-46
WP_000640110.1|986113_986656_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.3	3.9e-73
WP_106913064.1|987357_989304_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.3	0.0e+00
WP_000143462.1|989439_989619_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290230.1|989659_989905_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072899.1|989982_990198_+|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_000087714.1|990202_990736_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_000539792.1|991580_991727_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001082574.1|991734_992202_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	99.4	2.0e-78
WP_000348565.1|992657_993134_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077608.1|993130_995254_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102414.1|995250_995463_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|995462_996965_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|996909_998934_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|999021_999348_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|999340_999622_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|999624_1000248_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1000260_1000659_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1000666_1001419_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1001432_1001855_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|1001881_1002190_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918276.1|1002233_1004879_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.4	0.0e+00
WP_000847298.1|1004875_1005205_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001356552.1|1005204_1005903_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	3.6e-132
WP_000194798.1|1005913_1006657_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_096851774.1|1006602_1007232_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	2.3e-101
WP_000514990.1|1007472_1010946_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_001228289.1|1011013_1011613_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_000279065.1|1011677_1013000_+|tail	tail fiber protein	tail	Q687E6	Enterobacteria_phage	98.6	2.0e-75
WP_001023406.1|1013001_1013271_+|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_001131659.1|1013383_1013959_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001443810.1|1014031_1014661_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|1014742_1015384_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001082294.1|1015964_1016399_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
1015740:1015765	attR	TTGTTCAGGTTGTATTGTTCTTTCTT	NA	NA	NA	NA
WP_000837924.1|1016539_1017673_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 7
NZ_CP027388	Escherichia coli strain 2011C-4251 chromosome, complete genome	5440026	1219274	1251420	5440026	holin,transposase,integrase	Escherichia_phage(38.46%)	39	1241349:1241365	1257228:1257244
WP_016241229.1|1219274_1219589_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001299329.1|1221060_1221951_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	97.2	1.6e-153
WP_000391471.1|1222550_1222721_-	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	96.4	1.5e-23
WP_077625880.1|1222728_1222818_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	96.4	2.7e-08
WP_085947970.1|1222783_1223997_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000284491.1|1224579_1224795_-|holin	holin	holin	G9L6J5	Escherichia_phage	98.6	2.0e-33
WP_001289716.1|1224870_1225140_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	76.4	1.6e-08
WP_001213059.1|1225177_1225360_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_032362301.1|1225507_1227481_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	74.8	9.5e-287
WP_000762928.1|1228558_1229380_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_032362300.1|1229376_1229751_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	8.7e-32
WP_001265265.1|1229763_1230813_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	1.2e-107
WP_012816774.1|1230814_1231093_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001299354.1|1231159_1231420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|1231640_1231853_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001815900.1|1232134_1232893_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001443694.1|1233591_1233756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001368628.1|1233752_1234499_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	85.9	7.6e-112
WP_157904138.1|1234531_1235074_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.0	1.7e-84
WP_000020574.1|1234985_1236026_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705373.1|1235997_1236549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912290.1|1236532_1236760_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787426.1|1236836_1237244_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	48.1	8.3e-28
WP_000379598.1|1237445_1237601_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.2e-06
WP_001368621.1|1237760_1238000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001399959.1|1238115_1238460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449172.1|1239112_1239301_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_001369006.1|1239297_1239486_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000990639.1|1239578_1241996_+	exonuclease	NA	V5UQJ3	Shigella_phage	59.8	4.4e-177
1241349:1241365	attL	CAACATGCCAATGGCAA	NA	NA	NA	NA
WP_001368608.1|1242082_1242319_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001369004.1|1242338_1243634_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_072095801.1|1243653_1243764_-	transporter	NA	NA	NA	NA	NA
WP_032363338.1|1243821_1244841_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	9.7e-17
WP_001295394.1|1244852_1246067_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1246272_1246599_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|1246733_1247075_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1247109_1247670_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001443598.1|1247672_1248383_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_000041687.1|1248993_1251420_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
1257228:1257244	attR	TTGCCATTGGCATGTTG	NA	NA	NA	NA
>prophage 8
NZ_CP027388	Escherichia coli strain 2011C-4251 chromosome, complete genome	5440026	1496506	1593774	5440026	protease,tRNA,terminase,lysis,tail,portal,integrase,holin	Enterobacteria_phage(52.38%)	104	1516379:1516394	1589466:1589481
WP_000984517.1|1496506_1497388_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001315679.1|1497579_1499628_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|1499647_1500346_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|1500442_1500940_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207283.1|1501069_1502353_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001297532.1|1502321_1504955_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057022.1|1505034_1506474_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|1506591_1506828_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|1506932_1507124_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812712.1|1507124_1507781_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
WP_000976472.1|1508176_1508518_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|1508530_1509403_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204700.1|1509406_1509781_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1509919_1510150_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|1510251_1510908_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|1510931_1511594_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000936935.1|1511590_1513651_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|1513859_1514519_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|1514845_1515202_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|1515268_1515559_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173511.1|1515692_1516871_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
1516379:1516394	attL	CTACCGTGAATCCTGG	NA	NA	NA	NA
WP_000800512.1|1516926_1517568_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|1517604_1519416_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301729.1|1519650_1521126_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	3.4e-79
WP_001056706.1|1521463_1522333_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091148.1|1522460_1523903_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|1524033_1525005_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|1525124_1526447_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|1526462_1527395_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|1527473_1528229_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571465.1|1528225_1529011_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|1529157_1530168_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|1530176_1530788_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|1530926_1530992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295503.1|1531666_1532188_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907248.1|1532222_1532963_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001443602.1|1532991_1533444_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|1533561_1535334_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891620.1|1535643_1536210_+	hydrolase	NA	NA	NA	NA	NA
WP_001217551.1|1536563_1536812_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	93.9	3.8e-36
WP_099561169.1|1536948_1537071_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
WP_001132098.1|1537057_1537648_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_001144084.1|1537831_1538482_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	40.7	1.1e-37
WP_001434995.1|1538560_1539619_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_012816780.1|1539746_1540382_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001023420.1|1541143_1541413_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_106913068.1|1541414_1542728_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.2e-77
WP_032162956.1|1542792_1543392_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	3.7e-109
WP_106913069.1|1543458_1546935_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_096851774.1|1547175_1547805_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	2.3e-101
WP_000194798.1|1547750_1548494_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001356552.1|1548504_1549203_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	3.6e-132
WP_000847298.1|1549202_1549532_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918276.1|1549528_1552174_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.4	0.0e+00
WP_000479043.1|1552553_1552976_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|1552989_1553742_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|1553749_1554148_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|1554160_1554784_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|1554786_1555068_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|1555060_1555387_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|1555474_1557499_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974554.1|1557443_1558946_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	99.8	3.1e-290
WP_000102415.1|1558945_1559158_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077625.1|1559154_1561278_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000373407.1|1561274_1561751_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_000735654.1|1562169_1562394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001255337.1|1562417_1562885_-|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	85.3	6.3e-64
WP_000087734.1|1562881_1563415_-	lysozyme	NA	G9L6J6	Escherichia_phage	97.7	1.3e-100
WP_000284510.1|1563419_1563635_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290217.1|1563711_1563984_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000143457.1|1564024_1564204_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	98.3	3.7e-25
WP_106913070.1|1564340_1566287_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	97.8	0.0e+00
WP_000738072.1|1566797_1567067_-	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_000649753.1|1567078_1568038_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000483505.1|1568420_1569479_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.0	2.9e-205
WP_000917741.1|1569630_1569828_-	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_001202271.1|1570441_1571431_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	8.9e-193
WP_001065352.1|1571482_1571740_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
WP_000203852.1|1571736_1573137_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.4	1.7e-245
WP_000988196.1|1573133_1574012_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.0	2.0e-140
WP_001247844.1|1574022_1574931_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	94.0	2.4e-59
WP_153021255.1|1574995_1575169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587259.1|1575147_1575810_-	hypothetical protein	NA	Q8W643	Enterobacteria_phage	92.5	3.7e-110
WP_001090254.1|1575918_1576626_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	90.2	1.6e-114
WP_000944728.1|1576707_1576941_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
WP_000800140.1|1577097_1577787_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	88.2	5.2e-115
WP_000387836.1|1577935_1578637_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	59.7	1.5e-37
WP_000147364.1|1578633_1578834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000553977.1|1579032_1579215_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	52.7	2.9e-09
WP_001365075.1|1579220_1579793_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	71.3	5.5e-78
WP_106913071.1|1580162_1580990_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	97.8	9.0e-130
WP_001091864.1|1581031_1581403_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	98.4	3.8e-64
WP_000492057.1|1581434_1581677_+	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	92.5	2.4e-35
WP_001030139.1|1581680_1581827_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	3.1e-22
WP_000073102.1|1581835_1582072_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	98.7	8.4e-41
WP_000362001.1|1582127_1583441_+|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	97.0	2.8e-250
WP_042854221.1|1583422_1584193_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.7e-72
WP_000252979.1|1584245_1584641_+	membrane protein	NA	NA	NA	NA	NA
WP_000019588.1|1584681_1585425_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564746.1|1585421_1586393_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176771.1|1586557_1588987_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214304.1|1589011_1590112_-	cytochrome c	NA	NA	NA	NA	NA
1589466:1589481	attR	CCAGGATTCACGGTAG	NA	NA	NA	NA
WP_001300190.1|1591258_1591825_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025336.1|1592040_1593774_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
>prophage 9
NZ_CP027388	Escherichia coli strain 2011C-4251 chromosome, complete genome	5440026	1623177	1659643	5440026	capsid,terminase,head,plate,tail,portal,transposase,integrase,holin	Enterobacteria_phage(87.8%)	50	1622948:1623007	1659821:1659944
1622948:1623007	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001300279.1|1623177_1624179_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865207.1|1624184_1624532_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290349.1|1624561_1625212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|1625227_1625632_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|1625721_1625859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|1625930_1626134_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|1626155_1626506_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159456.1|1626516_1626795_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000357028.1|1626806_1627049_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000021659.1|1627045_1627159_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	4.0e-09
WP_000543032.1|1627252_1627663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|1627686_1627890_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153700.1|1627886_1628153_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000104293.1|1628149_1628449_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	4.0e-40
WP_001372767.1|1628460_1629078_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	37.8	2.1e-06
WP_000564228.1|1629074_1629464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288348.1|1629460_1632301_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.9	0.0e+00
WP_000686553.1|1632377_1633337_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	6.4e-180
WP_000211256.1|1633341_1633653_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	97.1	5.0e-49
WP_000711113.1|1634189_1634720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087812.1|1635250_1636297_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613800.1|1636296_1638048_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
WP_001262654.1|1638201_1639038_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	7.9e-150
WP_001055104.1|1639061_1640114_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_000632362.1|1640159_1640960_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.7	1.3e-130
WP_000063094.1|1641061_1641556_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.2	3.0e-88
WP_000864901.1|1641555_1641756_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|1641758_1642082_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072346.1|1642078_1642471_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	1.4e-69
WP_000780544.1|1642467_1642875_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	96.3	3.2e-64
WP_000920586.1|1643012_1643480_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	4.5e-86
WP_000356339.1|1643472_1644108_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001271910.1|1644104_1644686_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.6e-101
WP_000213447.1|1644682_1645033_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111953.1|1645036_1645933_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.0	1.6e-153
WP_000071720.1|1645925_1646456_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_000108490.1|1646458_1648729_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.7	1.3e-146
WP_000885642.1|1648728_1649307_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	87.4	5.5e-94
WP_000954201.1|1649350_1649923_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979946.1|1650079_1650568_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_000853415.1|1650580_1653388_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	91.0	0.0e+00
WP_000333503.1|1653374_1653530_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651570.1|1653538_1653913_-	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	72.4	5.8e-36
WP_000290462.1|1653968_1654481_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005405.1|1654480_1655665_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	4.0e-224
WP_000132840.1|1655822_1656932_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	8.2e-195
WP_000488107.1|1656974_1657235_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|1657424_1657565_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_071529678.1|1657754_1658036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947970.1|1658430_1659643_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
1659821:1659944	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 10
NZ_CP027388	Escherichia coli strain 2011C-4251 chromosome, complete genome	5440026	1709517	1761856	5440026	capsid,protease,terminase,head,tail,portal,transposase,holin	Enterobacteria_phage(37.5%)	63	NA	NA
WP_085947970.1|1709517_1710731_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000938105.1|1711519_1712089_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_095111390.1|1713218_1713350_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
WP_000950813.1|1713696_1714677_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001023997.1|1714853_1715123_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	95.5	6.0e-43
WP_077759223.1|1715124_1716114_-|tail	phage tail protein	tail	A0A0P0ZDE7	Stx2-converting_phage	98.7	4.3e-38
WP_106913074.1|1716174_1717388_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	98.3	8.7e-166
WP_000279039.1|1717439_1717751_-|tail	tail fiber protein	tail	Q687E6	Enterobacteria_phage	98.1	3.1e-51
WP_001435161.1|1717815_1718439_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.9e-68
WP_000515001.1|1718507_1721984_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.9	0.0e+00
WP_000649829.1|1722117_1722645_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_096220578.1|1722835_1723468_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	96.7	2.5e-103
WP_106913075.1|1723413_1724157_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	8.6e-148
WP_001357740.1|1724162_1724861_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847304.1|1724860_1725190_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082502.1|1725186_1727766_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.1	0.0e+00
WP_000533415.1|1727746_1728160_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	6.0e-42
WP_000479070.1|1728186_1728618_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	1.4e-41
WP_000106786.1|1728631_1729384_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	4.6e-133
WP_000683066.1|1729391_1729787_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_000975041.1|1729783_1730317_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	1.3e-57
WP_001204554.1|1730331_1730685_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201512.1|1730677_1731061_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522623.1|1731112_1732141_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000256723.1|1732198_1732546_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_078316698.1|1732582_1734088_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.9e-99
WP_001397759.1|1734077_1735670_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	5.5e-184
WP_000259002.1|1735666_1735873_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_012816750.1|1735856_1737785_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	3.6e-262
WP_000235436.1|1737756_1738266_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001303878.1|1738973_1739288_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1739815_1740001_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1740222_1740336_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003111.1|1740556_1741090_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	1.4e-99
WP_000138558.1|1741249_1741522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411814.1|1741777_1741984_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_106913076.1|1742432_1744283_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.8	0.0e+00
WP_106913077.1|1745049_1745763_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917770.1|1745897_1746095_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000265267.1|1746381_1747200_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090265.1|1747351_1747723_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|1747712_1748084_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265133.1|1748096_1749146_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001341388.1|1749147_1749426_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013636.1|1749593_1749806_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_000955173.1|1749850_1749988_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|1750353_1751127_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|1751478_1751892_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|1751907_1752678_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788749.1|1752759_1753446_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.6	9.8e-106
WP_001205820.1|1753452_1754568_-	hypothetical protein	NA	V5URT9	Shigella_phage	68.4	2.2e-131
WP_000273724.1|1754646_1755102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|1755308_1755734_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|1755717_1755990_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|1756098_1756500_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|1756527_1756719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|1756718_1757006_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|1757282_1757438_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|1757579_1757969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|1758155_1758341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|1758914_1759103_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|1759099_1759291_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034468.1|1759384_1761856_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	8.5e-59
>prophage 11
NZ_CP027388	Escherichia coli strain 2011C-4251 chromosome, complete genome	5440026	1998580	2041625	5440026	capsid,terminase,head,lysis,tail,portal,transposase,integrase,holin	Enterobacteria_phage(53.66%)	47	1994217:1994231	2050019:2050033
1994217:1994231	attL	CAGGCCATCTTCCAG	NA	NA	NA	NA
WP_001399730.1|1998580_1999870_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	6.5e-18
WP_000767413.1|1999928_2000405_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001102750.1|2001083_2002322_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	82.3	3.6e-207
WP_001131649.1|2002659_2003235_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	76.4	1.8e-76
WP_000652078.1|2003786_2004611_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.5	5.8e-153
WP_000950986.1|2004834_2005716_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.1	2.3e-147
WP_096150060.1|2005879_2006011_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
WP_000950792.1|2006357_2007338_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	1.7e-87
WP_001023455.1|2007514_2007784_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_072004822.1|2007785_2009099_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	98.4	1.5e-75
WP_001230425.1|2009163_2009763_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	1.3e-109
WP_106913080.1|2009830_2013226_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.4	0.0e+00
WP_000090913.1|2013286_2013889_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	3.6e-88
WP_012816751.1|2013825_2014569_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	95.9	1.7e-143
WP_001152517.1|2014574_2015273_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	88.4	5.4e-120
WP_000847379.1|2015272_2015602_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_032362273.1|2015598_2018178_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.5	0.0e+00
WP_000533411.1|2018158_2018572_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.2	5.1e-41
WP_000479115.1|2018598_2019030_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_001143022.1|2019043_2019796_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.1e-126
WP_000683065.1|2019803_2020199_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_000975031.1|2020195_2020729_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.0e-57
WP_001204560.1|2020743_2021097_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.5e-41
WP_000201513.1|2021089_2021473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522623.1|2021524_2022553_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000256723.1|2022610_2022958_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253918.1|2022994_2024500_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	3.6e-100
WP_000831809.1|2024489_2026082_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	61.2	9.3e-184
WP_000259002.1|2026078_2026285_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|2028154_2028664_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001307652.1|2029058_2029253_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881322.1|2029440_2030058_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	86.4	3.8e-93
WP_000092314.1|2030207_2030645_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	95.9	9.4e-70
WP_000075135.1|2030641_2031139_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	1.3e-91
WP_000411802.1|2031138_2031345_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000023266.1|2031792_2033643_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000499453.1|2033941_2034100_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|2034185_2034929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|2035113_2035803_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|2035817_2035940_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|2036278_2037238_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028841.1|2037449_2038115_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.4	4.4e-127
WP_001108024.1|2038111_2038723_-	recombination protein NinG	NA	Q716C3	Shigella_phage	99.0	8.7e-98
WP_000566868.1|2038715_2038886_-	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	98.2	1.2e-25
WP_001254222.1|2038882_2039065_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_085947970.1|2039340_2040553_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_042094857.1|2040605_2041625_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	3.9e-191
2050019:2050033	attR	CAGGCCATCTTCCAG	NA	NA	NA	NA
>prophage 12
NZ_CP027388	Escherichia coli strain 2011C-4251 chromosome, complete genome	5440026	2254751	2321230	5440026	capsid,protease,tRNA,terminase,head,lysis,tail,portal,transposase,integrase	Enterobacteria_phage(56.36%)	71	2263232:2263278	2311024:2311070
WP_000394594.1|2254751_2255888_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383945.1|2256156_2258394_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662366.1|2258380_2261353_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224569.1|2261353_2262244_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177469.1|2262426_2263188_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
2263232:2263278	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|2263700_2264654_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226378.1|2264840_2266325_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937478.1|2266508_2266814_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239874.1|2266870_2267539_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_120795384.1|2267904_2268018_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836765.1|2268086_2268320_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
WP_000087133.1|2268638_2269229_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.9	2.1e-24
WP_000885588.1|2269326_2269902_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	6.9e-105
WP_000279113.1|2269901_2272817_-	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	2.5e-57
WP_001230323.1|2272881_2273481_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	2.6e-110
WP_000515573.1|2273547_2276946_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.4	0.0e+00
WP_001309913.1|2277006_2277654_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	2.5e-111
WP_000140729.1|2277551_2278295_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	7.0e-150
WP_001152638.1|2278300_2278999_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	6.6e-134
WP_000847379.1|2278998_2279328_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000459457.1|2281797_2282232_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|2282213_2282636_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001298904.1|2282651_2283392_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	1.7e-132
WP_000683105.1|2283399_2283795_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975070.1|2283791_2284370_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000752979.1|2284381_2284735_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000158905.1|2284746_2285145_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	1.2e-63
WP_000063280.1|2285186_2286212_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_001297109.1|2286267_2286600_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000123319.1|2286609_2287929_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	1.5e-235
WP_001297098.1|2287909_2289511_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.2e-311
WP_000198149.1|2289507_2289714_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027292.1|2289710_2291636_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
WP_000453580.1|2291610_2292156_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001298906.1|2292544_2292739_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	9.7e-27
WP_001031427.1|2292903_2293110_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001298896.1|2293395_2293806_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738500.1|2294096_2294390_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|2294480_2294663_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|2294879_2295377_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000670959.1|2295376_2295592_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_000737283.1|2296180_2297278_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_000332834.1|2297467_2297851_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	3.4e-55
WP_001360050.1|2297868_2298858_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061438.1|2298865_2299675_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_000767117.1|2299694_2300084_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	100.0	7.1e-69
WP_000210187.1|2300080_2300407_-	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
WP_000066917.1|2300403_2301057_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_001305611.1|2301056_2301551_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_000104954.1|2301547_2302489_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_001250269.1|2302478_2302658_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001191674.1|2303376_2303637_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001400137.1|2303734_2304427_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.6	3.9e-126
WP_000559922.1|2304746_2305262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|2305732_2306095_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081287.1|2306160_2306985_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008165.1|2307112_2307649_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_001242707.1|2307639_2308002_+	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_106913081.1|2308001_2308190_+	hypothetical protein	NA	U5P0J0	Shigella_phage	94.3	9.4e-19
WP_085947970.1|2308215_2309428_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_077625877.1|2309535_2309991_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	85.4	5.5e-65
WP_032357809.1|2309846_2311010_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	1.2e-199
WP_000805428.1|2311344_2311977_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
2311024:2311070	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001250422.1|2311979_2312495_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000691050.1|2312505_2313513_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000988366.1|2316164_2316857_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001400141.1|2317076_2317619_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729160.1|2318099_2318966_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|2318967_2319180_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|2319287_2319809_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|2319844_2321230_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 13
NZ_CP027388	Escherichia coli strain 2011C-4251 chromosome, complete genome	5440026	2876223	2970418	5440026	capsid,tRNA,protease,terminase,head,tail,transposase,integrase,holin	Stx2-converting_phage(38.46%)	106	2904091:2904106	2977778:2977793
WP_000399648.1|2876223_2877204_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000738721.1|2877463_2877760_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000781067.1|2877973_2879260_-	threonine synthase	NA	NA	NA	NA	NA
WP_000241660.1|2879260_2880193_-	homoserine kinase	NA	NA	NA	NA	NA
WP_001264697.1|2880194_2882657_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_001386572.1|2882737_2882803_-	thr operon leader peptide	NA	NA	NA	NA	NA
WP_001223177.1|2883016_2883703_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|2884102_2884243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|2884338_2885055_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920337.1|2885114_2886467_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219604.1|2886524_2887949_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
WP_001188666.1|2887948_2888638_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
WP_000875487.1|2888650_2889124_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|2889334_2890204_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|2890200_2890848_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001300180.1|2890899_2891421_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068679.1|2891505_2891832_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409451.1|2891921_2893859_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|2894069_2895737_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|2896043_2897276_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_001029698.1|2897296_2898679_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132949.1|2898727_2899696_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124615.1|2899801_2900446_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105865.1|2900473_2901490_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000224877.1|2901945_2902665_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|2902744_2903968_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477808.1|2904019_2905342_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.4e-79
2904091:2904106	attL	TCACCGCTTTCGCCGC	NA	NA	NA	NA
WP_001295412.1|2905468_2906248_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143237.1|2906505_2908056_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088403.1|2908027_2908891_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563079.1|2909305_2910088_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001299187.1|2910084_2911158_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|2911279_2911441_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|2911567_2912173_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202566.1|2912565_2914152_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001217548.1|2914371_2914632_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	95.3	8.1e-37
WP_001121225.1|2915224_2915875_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001101699.1|2916159_2916429_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	98.9	1.9e-44
WP_015740448.1|2916430_2917744_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	2.7e-80
WP_001230466.1|2917808_2918408_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_032362361.1|2918477_2921891_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	85.8	0.0e+00
WP_047085664.1|2922129_2922762_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.7	2.5e-103
WP_032362323.1|2922707_2923451_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	1.8e-145
WP_032362363.1|2923456_2924155_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	96.6	1.9e-128
WP_000807922.1|2924154_2924496_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	6.2e-61
WP_032357963.1|2924488_2927731_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.4	0.0e+00
WP_122993730.1|2927781_2927991_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	92.8	2.6e-30
WP_000710954.1|2928086_2928461_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	8.6e-64
WP_001275441.1|2928475_2929192_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133388.1|2929258_2929603_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2929599_2930046_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2930042_2930393_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|2930403_2930730_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063096.1|2933256_2933478_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000173093.1|2933522_2935460_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.8	0.0e+00
WP_001399867.1|2935523_2937185_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_000958390.1|2937181_2937745_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	98.9	1.5e-88
WP_000279817.1|2938034_2938400_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	99.2	4.4e-65
WP_000095749.1|2938441_2938669_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_012816791.1|2939093_2939279_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539794.1|2939506_2939653_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	95.8	1.7e-15
WP_001056806.1|2939652_2940222_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992166.1|2940492_2941026_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.7	5.6e-101
WP_000731236.1|2941076_2941421_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411802.1|2941425_2941632_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_032362364.1|2942079_2943930_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.5	0.0e+00
WP_000752026.1|2944429_2944699_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|2944708_2945656_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204852.1|2946162_2946597_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000144759.1|2946589_2946784_-	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001108022.1|2946780_2947386_-	recombination protein NinG	NA	G9L693	Escherichia_phage	100.0	8.6e-98
WP_001292290.1|2947385_2948108_-	phage regulatory/antirepressor protein	NA	G9L692	Escherichia_phage	100.0	9.2e-131
WP_001563210.1|2948100_2948310_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	1.4e-31
WP_000924600.1|2948269_2948671_-	hypothetical protein	NA	G9L690	Escherichia_phage	100.0	1.4e-72
WP_000201603.1|2948745_2949420_-	phage antirepressor Ant	NA	G9L689	Escherichia_phage	100.0	1.6e-129
WP_001254258.1|2949676_2949871_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	2.9e-31
WP_000638184.1|2949867_2950425_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	3.7e-95
WP_106913058.1|2950408_2951622_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.0	2.7e-167
WP_000814577.1|2951705_2952152_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	99.3	2.1e-80
WP_000103678.1|2952356_2952572_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|2952704_2952983_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000145906.1|2953053_2953344_-	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	97.9	2.8e-46
WP_000788876.1|2953340_2954042_-	hypothetical protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_000185456.1|2954038_2954977_-	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000438528.1|2955009_2955306_-	hypothetical protein	NA	Q08J40	Stx2-converting_phage	100.0	5.2e-48
WP_001180318.1|2955444_2955672_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|2955750_2956458_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885202.1|2956518_2956860_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	100.0	5.1e-63
WP_085947970.1|2957185_2958399_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000957426.1|2958695_2959742_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000198445.1|2960397_2960781_+	hypothetical protein	NA	Q08J47	Stx2-converting_phage	100.0	3.9e-64
WP_000167584.1|2960839_2961310_+	hypothetical protein	NA	G9L670	Escherichia_phage	99.4	1.1e-87
WP_001198858.1|2961501_2961642_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000361828.1|2961634_2961799_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.1	5.5e-23
WP_000995464.1|2961853_2962150_+	host-nuclease inhibitor protein Gam	NA	A0A0P0ZCL3	Stx2-converting_phage	100.0	2.1e-49
WP_000100845.1|2962155_2962941_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000186879.1|2962937_2963618_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	99.6	6.0e-132
WP_000682315.1|2963614_2963797_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	100.0	9.7e-29
WP_000548531.1|2963769_2963961_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_077630063.1|2963971_2964253_+	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	97.8	2.7e-46
WP_000763383.1|2964351_2964573_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289923.1|2964569_2965340_+	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	97.7	4.0e-140
WP_155701557.1|2965524_2965857_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	98.2	4.9e-63
WP_001400035.1|2965853_2966672_+	hypothetical protein	NA	A0A0H4IU61	Shigella_phage	96.5	1.7e-120
WP_000501170.1|2967475_2969023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001218294.1|2969194_2970418_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.0	1.3e-233
2977778:2977793	attR	TCACCGCTTTCGCCGC	NA	NA	NA	NA
>prophage 14
NZ_CP027388	Escherichia coli strain 2011C-4251 chromosome, complete genome	5440026	4431524	4478932	5440026	tRNA,transposase,protease,integrase	Stx2-converting_phage(23.08%)	37	4422339:4422354	4473752:4473767
4422339:4422354	attL	CGACCTGTGCCGGAAT	NA	NA	NA	NA
WP_000450589.1|4431524_4431857_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000627213.1|4431898_4433389_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000094682.1|4433695_4435216_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000018000.1|4435369_4435993_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001065895.1|4436269_4437034_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000290297.1|4437330_4438647_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.8	6.6e-34
WP_000268402.1|4438776_4439373_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	88.9	5.9e-99
WP_000248064.1|4439465_4441079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000270113.1|4441808_4442036_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000335713.1|4442131_4443565_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282106.1|4444577_4445141_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000233443.1|4445295_4447656_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	31.8	2.6e-33
WP_000035067.1|4447673_4447862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997983.1|4447928_4449467_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.9e-296
WP_000612591.1|4449516_4449864_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_024182560.1|4449860_4450241_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	3.5e-65
WP_001034024.1|4450972_4455064_-|protease	serine protease autotransporter EspI	protease	Q9LA58	Enterobacterial_phage	44.6	2.6e-310
WP_001021388.1|4457718_4458336_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001142971.1|4458347_4459022_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966484.1|4459022_4459487_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000065686.1|4459496_4461200_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_000612150.1|4461192_4461513_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|4461521_4461824_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_085947970.1|4463017_4464231_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000134819.1|4464308_4464584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000591999.1|4464808_4466428_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|4466520_4466880_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000803992.1|4468875_4469139_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001135714.1|4469440_4469581_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	3.1e-11
WP_001443493.1|4470447_4471119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000355324.1|4472651_4474193_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	36.6	1.5e-77
4473752:4473767	attR	CGACCTGTGCCGGAAT	NA	NA	NA	NA
WP_000957247.1|4474235_4474616_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000042918.1|4474602_4474932_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_001176766.1|4475192_4475660_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506894.1|4475677_4476886_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797372.1|4476896_4477853_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182418.1|4477852_4478932_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
>prophage 15
NZ_CP027388	Escherichia coli strain 2011C-4251 chromosome, complete genome	5440026	4971342	4978482	5440026		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|4971342_4971981_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590407.1|4971977_4973240_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	1.4e-134
WP_000847985.1|4973236_4974145_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|4974340_4975108_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|4975158_4975815_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272924.1|4975920_4978482_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 16
NZ_CP027388	Escherichia coli strain 2011C-4251 chromosome, complete genome	5440026	5114264	5155340	5440026	holin,terminase,tail,integrase	Salmonella_phage(48.89%)	50	5114478:5114495	5157186:5157203
WP_000054752.1|5114264_5114525_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
5114478:5114495	attL	TTCACACATATCACAATT	NA	NA	NA	NA
WP_001138330.1|5114739_5116137_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001135919.1|5116330_5117725_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.4	3.2e-212
WP_001288450.1|5117835_5118765_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	38.1	2.5e-48
WP_085954671.1|5118767_5119784_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	52.6	3.3e-102
WP_000312945.1|5119753_5120047_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	67.1	6.6e-27
WP_000637723.1|5120036_5120336_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	64.2	4.2e-29
WP_000008820.1|5120332_5120548_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000065469.1|5120553_5122617_-	DNA polymerase	NA	Q775A3	Bordetella_phage	67.8	8.7e-275
WP_000551021.1|5122663_5123293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000769005.1|5123345_5123894_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	2.1e-66
WP_001113516.1|5123909_5125211_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	56.4	4.0e-132
WP_000051355.1|5125213_5126116_-	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_001288046.1|5126486_5127011_+	hypothetical protein	NA	K7P861	Enterobacteria_phage	47.5	1.4e-35
WP_000567466.1|5127429_5128104_-	helix-turn-helix transcriptional regulator	NA	B6SCU0	Bacteriophage	51.1	1.8e-59
WP_000016209.1|5128245_5128446_+	transcriptional regulator	NA	K7RWG7	Bacteriophage	50.0	1.0e-07
WP_001520086.1|5128449_5130636_+	replication protein	NA	B6SD37	Bacteriophage	72.4	2.4e-174
WP_001244506.1|5130922_5131345_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	8.8e-41
WP_001174014.1|5131376_5131718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000781776.1|5132163_5132505_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_001194119.1|5132508_5132985_+	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.2	2.1e-86
WP_000779566.1|5132968_5133493_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
WP_000162796.1|5133554_5134127_+|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	1.4e-60
WP_001130793.1|5134129_5135752_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_000113491.1|5135751_5137218_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	3.9e-261
WP_000873185.1|5137858_5139079_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.3	1.1e-200
WP_001066733.1|5139082_5139589_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	80.5	9.8e-71
WP_000627490.1|5139600_5140542_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	1.4e-155
WP_001040697.1|5140582_5140951_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	88.5	1.4e-53
WP_000042170.1|5140916_5141324_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	4.3e-69
WP_000008726.1|5141320_5141875_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	71.7	2.5e-67
WP_001142484.1|5141861_5142251_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	1.1e-66
WP_012816811.1|5142225_5142789_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	2.0e-80
WP_000046933.1|5142792_5143938_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	6.1e-161
WP_000109249.1|5143948_5144389_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_000393954.1|5144392_5144845_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	4.7e-56
WP_000990884.1|5145022_5147011_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	74.8	1.0e-272
WP_001300247.1|5147010_5147598_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	2.6e-83
WP_001007341.1|5147597_5147900_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	91.0	8.2e-49
WP_000081745.1|5147902_5148967_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.7	3.0e-154
WP_000832849.1|5148969_5149317_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	81.1	3.5e-27
WP_001121391.1|5149657_5149879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001007933.1|5150115_5150868_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	66.3	5.9e-88
WP_001270633.1|5150867_5151221_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	9.0e-55
WP_001197085.1|5151220_5152420_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.4	8.3e-185
WP_000049950.1|5152416_5153097_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	2.6e-103
WP_001096968.1|5153096_5153795_+	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	68.9	2.4e-27
WP_000376434.1|5153798_5154218_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.7	4.2e-35
WP_001030532.1|5154189_5154792_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	92.0	4.6e-99
WP_032164189.1|5154791_5155340_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	59.1	1.1e-54
5157186:5157203	attR	TTCACACATATCACAATT	NA	NA	NA	NA
