The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027454	Escherichia coli strain 2014C-4423 chromosome, complete genome	5338915	970335	1021788	5338915	tail,transposase,holin,terminase,portal,capsid,tRNA,integrase,head	Enterobacteria_phage(36.84%)	61	981215:981229	1022390:1022404
WP_001093921.1|970335_970617_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	95.7	4.1e-42
WP_001061339.1|970653_971226_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_001094871.1|971225_971960_-	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	98.8	1.4e-139
WP_001014294.1|971962_972154_-	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_000829413.1|972155_972623_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.1	1.1e-36
WP_000145671.1|972769_973243_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
WP_001242740.1|973239_973590_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|973580_974117_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_000081294.1|974244_975069_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	100.0	3.5e-150
WP_000135680.1|975134_975497_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000981537.1|975954_976608_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_001231956.1|976703_976901_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000514174.1|976928_977513_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
WP_001087349.1|977509_978676_+	peptidase	NA	A0A1C9IHV9	Salmonella_phage	61.1	3.6e-116
WP_000626861.1|978672_978867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000618008.1|978863_979088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000061545.1|979084_979909_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	78.4	1.2e-89
WP_000988265.1|979919_980819_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	94.8	8.8e-139
WP_000203855.1|980815_982216_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.2	6.4e-245
981215:981229	attL	CTGAAGGATGCGCAG	NA	NA	NA	NA
WP_001370224.1|982212_982470_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	9.5e-22
WP_001370152.1|982521_983511_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	2.3e-193
WP_085947772.1|983949_985162_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_096910863.1|985218_986432_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_001339373.1|987160_987313_+	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_000284522.1|990147_990363_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|990367_990712_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992088.1|990762_991296_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_001056806.1|991566_992136_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|992135_992282_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|992504_992690_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|993215_993530_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|993611_993836_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|994222_994768_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|994742_996668_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|996664_996871_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_024026143.1|996867_998469_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	2.1e-308
WP_032212710.1|998449_999769_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	2.6e-232
WP_001299443.1|999778_1000111_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_024025845.1|1000166_1001192_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	9.9e-187
WP_000158899.1|1001233_1001629_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_000753019.1|1001640_1001994_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_024025847.1|1002005_1002584_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	6.6e-79
WP_000683137.1|1002580_1002976_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235098.1|1002983_1003736_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479045.1|1003749_1004172_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|1004198_1004612_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_032212771.1|1004592_1007205_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	87.8	0.0e+00
WP_000847401.1|1007201_1007531_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_001453992.1|1007530_1008229_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	3.6e-132
WP_001370115.1|1008234_1008978_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	5.0e-148
WP_077696211.1|1008923_1009559_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.5	1.5e-97
WP_106901517.1|1009794_1013187_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	87.0	0.0e+00
WP_001230379.1|1013253_1013853_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_032212803.1|1013917_1015231_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	3.9e-79
WP_047091878.1|1015232_1015502_+|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	98.9	4.2e-44
WP_001370116.1|1015913_1016519_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.5	1.8e-111
WP_001121225.1|1016743_1017394_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_085948186.1|1017650_1018807_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001217539.1|1019254_1019503_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000332271.1|1019564_1020662_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.7	9.5e-212
WP_000543822.1|1020750_1021788_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
1022390:1022404	attR	CTGCGCATCCTTCAG	NA	NA	NA	NA
>prophage 2
NZ_CP027454	Escherichia coli strain 2014C-4423 chromosome, complete genome	5338915	1111445	1194473	5338915	tRNA,integrase,protease,transposase	Stx2-converting_phage(22.73%)	59	1115047:1115062	1200701:1200716
WP_001295082.1|1111445_1112963_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856834.1|1113199_1114657_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	1.8e-48
WP_001295383.1|1114715_1116863_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
1115047:1115062	attL	ATCAGATCCGGCAGAT	NA	NA	NA	NA
WP_000092909.1|1116942_1118277_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_096910863.1|1118468_1119681_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_001187182.1|1119955_1121494_-	DNA-binding transcriptional activator CadC	NA	NA	NA	NA	NA
WP_101329731.1|1121728_1123267_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.8	4.3e-295
WP_000612591.1|1123316_1123664_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1123660_1124041_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_094185360.1|1125152_1126309_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_000422707.1|1126567_1126993_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	2.9e-47
WP_001239100.1|1127646_1137318_-	lymphostatin Efa1/LifA	NA	NA	NA	NA	NA
WP_000609742.1|1139191_1139866_-	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_000953032.1|1139914_1140904_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.2	4.1e-97
WP_001121620.1|1141512_1143162_-	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_085948186.1|1145190_1146346_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000603950.1|1147411_1147960_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	32.4	1.3e-15
WP_000631725.1|1150281_1150629_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|1150625_1151300_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001218843.1|1152290_1153556_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_001188520.1|1153935_1154511_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068972.1|1154547_1156245_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|1156220_1156559_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|1156674_1157976_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000069437.1|1158093_1159530_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|1159866_1160343_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015800.1|1160358_1161615_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|1161890_1162184_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|1162227_1163874_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|1164011_1164365_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000940538.1|1165678_1166707_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|1166748_1167315_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|1167366_1167492_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|1167602_1167749_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|1167930_1168248_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238375.1|1168244_1168778_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	8.0e-47
WP_001370451.1|1168866_1170000_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001299198.1|1170062_1170422_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|1170432_1170828_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|1170838_1171573_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001192973.1|1171565_1173374_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|1173698_1174676_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001399652.1|1174894_1176397_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000342867.1|1176448_1176763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276180.1|1176759_1177074_+	YjeO family protein	NA	NA	NA	NA	NA
WP_001236847.1|1177102_1180426_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934905.1|1180447_1181416_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041970.1|1181511_1182564_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|1182658_1183204_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|1184067_1184121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294219.1|1184103_1185243_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001307537.1|1185241_1186789_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|1186760_1187222_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990308.1|1187240_1188578_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001370456.1|1188587_1190435_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.0	1.3e-59
WP_001280339.1|1190427_1191378_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|1191463_1191772_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|1191847_1193128_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|1193213_1194473_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
1200701:1200716	attR	ATCTGCCGGATCTGAT	NA	NA	NA	NA
>prophage 3
NZ_CP027454	Escherichia coli strain 2014C-4423 chromosome, complete genome	5338915	1386179	1422002	5338915	tail,holin,terminase,integrase,transposase	Enterobacteria_phage(40.0%)	44	1383147:1383160	1393043:1393056
1383147:1383160	attL	TTCTTCGCCTGGCG	NA	NA	NA	NA
WP_001218283.1|1386179_1387397_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	99.5	1.7e-238
WP_000206721.1|1389963_1390584_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	92.7	3.6e-115
WP_001242716.1|1390583_1390946_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	98.3	5.8e-65
WP_106901520.1|1390936_1391473_-	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.3	2.4e-99
WP_001311077.1|1392393_1393086_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
1393043:1393056	attR	TTCTTCGCCTGGCG	NA	NA	NA	NA
WP_001191671.1|1393183_1393444_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	1.2e-40
WP_000515839.1|1393436_1393988_+	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	98.9	2.2e-100
WP_001087356.1|1393984_1395133_+	peptidase	NA	K7PLX4	Enterobacteria_phage	86.9	7.2e-178
WP_000620698.1|1395129_1395354_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	2.8e-38
WP_024025783.1|1396164_1396659_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.8	4.3e-87
WP_000066917.1|1396658_1397312_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210170.1|1397308_1397635_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767113.1|1397631_1398021_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061444.1|1398040_1398850_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001223334.1|1398865_1399381_+	hypothetical protein	NA	V5URU3	Shigella_phage	28.7	4.6e-15
WP_001299344.1|1399390_1400380_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.2e-194
WP_001205460.1|1400397_1400739_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131907.1|1400751_1401300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868396.1|1401286_1402213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917724.1|1402477_1402681_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799669.1|1402831_1403890_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	86.7	2.9e-181
WP_001370417.1|1404332_1404764_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	99.3	3.5e-69
WP_000216636.1|1404760_1404928_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	74.5	1.1e-10
WP_032212796.1|1405335_1407186_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.8	0.0e+00
WP_085948186.1|1407308_1408464_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000411802.1|1408899_1409106_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_032212794.1|1409105_1409603_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	3.8e-91
WP_001208681.1|1409819_1410005_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|1410533_1410848_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|1410929_1411154_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303046.1|1411195_1411561_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_077760350.1|1411852_1412254_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	97.7	5.6e-61
WP_085947772.1|1412246_1413460_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001130973.1|1413485_1414181_+	hypothetical protein	NA	Q6H9T2	Enterobacteria_phage	99.6	8.6e-126
WP_001216289.1|1414248_1414872_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	2.5e-68
WP_106901521.1|1414936_1416118_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	93.6	4.3e-69
WP_001023428.1|1416119_1416389_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	2.4e-44
WP_001118085.1|1416499_1417081_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_086163594.1|1417148_1417778_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	3.9e-77
WP_001143789.1|1417859_1418501_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	98.6	1.4e-106
WP_001217539.1|1418661_1418910_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000202564.1|1419129_1420716_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|1421108_1421714_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|1421840_1422002_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 4
NZ_CP027454	Escherichia coli strain 2014C-4423 chromosome, complete genome	5338915	1947729	2045297	5338915	protease,tail,portal,terminase,head,capsid,tRNA,integrase,transposase	Enterobacteria_phage(45.0%)	88	2004423:2004469	2036771:2036817
WP_000186631.1|1947729_1948209_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_000365135.1|1948412_1949207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001370330.1|1949344_1949686_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	9.3e-41
WP_000083976.1|1949799_1952304_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.1	1.4e-114
WP_000883019.1|1952565_1953498_+	glutaminase A	NA	NA	NA	NA	NA
WP_000982172.1|1953500_1954793_+	amino acid permease	NA	NA	NA	NA	NA
WP_001026747.1|1954917_1955325_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000970323.1|1955325_1955784_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000904502.1|1955780_1956698_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_032210040.1|1956843_1957521_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	6.8e-27
WP_001323739.1|1957507_1958287_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001295322.1|1958349_1959204_-	chaperedoxin	NA	NA	NA	NA	NA
WP_000148959.1|1959264_1960074_-	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295836.1|1960063_1960687_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|1960657_1961344_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561833.1|1961340_1963755_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_106901527.1|1964183_1968374_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	44.6	1.3e-22
WP_106901528.1|1968354_1968846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001158006.1|1969847_1970942_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|1971010_1971937_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|1972166_1972649_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|1972726_1973542_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001370296.1|1973631_1975413_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.8	6.0e-38
WP_000943556.1|1975425_1976202_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_032209890.1|1976301_1977180_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401125.1|1977348_1978803_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006887.1|1978862_1980224_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001370313.1|1980280_1981582_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001370319.1|1981603_1982749_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	4.1e-48
WP_000540996.1|1982976_1983762_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001370308.1|1983772_1985008_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703894.1|1985029_1986079_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580865.1|1986395_1988063_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495365.1|1988072_1989332_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001325209.1|1989342_1990158_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855398.1|1990154_1991048_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815538.1|1991186_1992254_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|1992250_1992760_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|1992877_1993600_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|1993602_1994097_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|1994270_1995656_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|1995691_1996213_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1996320_1996533_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|1996534_1997401_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776558.1|1997881_1998424_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_001370299.1|1999365_2001975_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691047.1|2001987_2002995_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001396973.1|2003005_2003521_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805418.1|2003523_2004156_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
2004423:2004469	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001370298.1|2004482_2005646_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	9.8e-199
WP_000446905.1|2005501_2005873_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|2005844_2006123_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|2006170_2006389_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001443983.1|2006487_2006769_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_087661054.1|2006825_2008038_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_029594360.1|2008096_2008621_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.7	2.2e-89
WP_001027188.1|2008595_2010521_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.3	0.0e+00
WP_000198151.1|2010517_2010730_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	95.7	1.6e-27
WP_001370283.1|2010726_2012328_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.2e-308
WP_050926764.1|2012308_2013628_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	95.4	1.1e-225
WP_001358596.1|2013637_2013970_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	1.4e-54
WP_024233962.1|2014024_2015050_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	3.3e-190
WP_032284437.1|2015091_2015487_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	4.1e-56
WP_000752996.1|2015498_2015852_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_001121835.1|2015863_2016442_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.7e-79
WP_024200945.1|2016438_2016834_+	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_001370356.1|2016841_2017582_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	5.0e-132
WP_000479147.1|2017597_2018020_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	1.9e-72
WP_000459457.1|2018001_2018436_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840238.1|2018428_2020990_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.7	0.0e+00
WP_000847371.1|2020986_2021316_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.6	2.1e-53
WP_001152565.1|2021315_2022014_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	3.6e-132
WP_000194780.1|2022019_2022763_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|2022699_2023332_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000515724.1|2023392_2026734_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.8	0.0e+00
WP_085947772.1|2026754_2027967_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001230348.1|2028136_2028736_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_077633707.1|2030899_2031871_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	89.3	2.1e-37
WP_000885574.1|2031870_2032455_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.2e-101
WP_000239881.1|2032509_2033178_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937500.1|2033234_2033540_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226375.1|2033723_2035208_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|2035394_2036348_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177464.1|2036860_2037622_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
2036771:2036817	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|2037804_2038695_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662369.1|2038695_2041668_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383947.1|2041654_2043892_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420919.1|2044160_2045297_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP027454	Escherichia coli strain 2014C-4423 chromosome, complete genome	5338915	2480587	2604090	5338915	protease,tail,holin,terminase,portal,head,capsid,integrase,transposase	Enterobacteria_phage(34.55%)	157	2503702:2503721	2560298:2560317
WP_000156526.1|2480587_2482348_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877158.1|2482533_2482986_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750419.1|2483060_2484113_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|2484469_2484979_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000841914.1|2485197_2485827_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875061.1|2485789_2487952_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|2487961_2488408_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001295354.1|2488530_2490585_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
WP_000424181.1|2490616_2491075_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|2491170_2491833_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|2492005_2492419_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|2492463_2492781_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|2492838_2494029_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048233.1|2494123_2494402_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|2494398_2494728_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|2494818_2495478_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_001370339.1|2495885_2496905_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.4	2.9e-85
WP_000273151.1|2496882_2497125_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_106901532.1|2497192_2498539_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	1.5e-57
WP_001066419.1|2498634_2500191_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000631725.1|2500210_2500558_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_106901533.1|2500554_2501229_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_159031907.1|2501307_2502345_-	exonuclease	NA	NA	NA	NA	NA
WP_001090200.1|2502437_2502629_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2502625_2502814_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000394557.1|2503345_2503720_-	hypothetical protein	NA	NA	NA	NA	NA
2503702:2503721	attL	GTAAATCTTTAAATTCCATC	NA	NA	NA	NA
WP_000379580.1|2503731_2503884_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000103686.1|2504156_2504873_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000471549.1|2504922_2505138_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693949.1|2505134_2505560_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262384.1|2505631_2506702_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	62.2	8.2e-59
WP_001151153.1|2506742_2507165_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_001266134.1|2507161_2507458_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001209480.1|2507454_2507916_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|2507893_2508250_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|2508300_2508513_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|2508598_2508763_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|2508764_2509028_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000208016.1|2509038_2509908_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	79.2	8.5e-123
WP_001278454.1|2510023_2510128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902696.1|2510316_2510529_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_001341388.1|2510696_2510975_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265133.1|2510976_2512026_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_000904103.1|2512038_2512398_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_000640048.1|2512406_2512937_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917767.1|2513178_2513376_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000024329.1|2513527_2514604_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	87.1	3.8e-181
WP_001443281.1|2515199_2515526_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	62.9	5.1e-36
WP_000142777.1|2517908_2518088_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_001290233.1|2518128_2518374_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	90.1	2.2e-15
WP_000284506.1|2518450_2518666_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087730.1|2518670_2519204_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
WP_001056806.1|2519474_2520044_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2520043_2520190_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2520417_2520603_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000373407.1|2521079_2521556_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077621.1|2521552_2522560_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	1.8e-201
WP_000114064.1|2522721_2523960_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.1	6.6e-60
WP_000229066.1|2523952_2524177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038673.1|2524236_2524815_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	65.4	4.9e-58
WP_000201455.1|2524935_2525115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024176648.1|2525309_2525507_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000335965.1|2525499_2525724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551747.1|2525716_2526085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204082.1|2526077_2526311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000728901.1|2526507_2526750_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761774.1|2526746_2528561_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.9	5.7e-129
WP_001399692.1|2528848_2529094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126660.1|2529090_2529513_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001302595.1|2529940_2530087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106901535.1|2530170_2532060_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	7.2e-183
WP_000133409.1|2532317_2532599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000102415.1|2534091_2534304_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974554.1|2534303_2535806_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	99.8	3.1e-290
WP_001114424.1|2535750_2537775_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|2537862_2538189_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|2538181_2538463_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974960.1|2538465_2539089_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	99.5	2.5e-100
WP_000682716.1|2539101_2539500_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|2539507_2540260_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479062.1|2540273_2540696_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000532073.1|2540722_2541031_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_106901536.1|2541074_2543720_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.6	0.0e+00
WP_000847298.1|2543716_2544046_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001302134.1|2544045_2544744_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.3	5.2e-131
WP_001444516.1|2544754_2545498_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.0	1.7e-148
WP_159031909.1|2545443_2546073_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	6.0e-102
WP_106901538.1|2546313_2549790_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	94.4	0.0e+00
WP_001230497.1|2549856_2550456_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	9.7e-110
WP_106901539.1|2550520_2551834_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.6	6.9e-76
WP_001023407.1|2551835_2552105_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000938124.1|2552559_2553921_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_095585410.1|2554297_2554450_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
WP_001299351.1|2554732_2555752_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|2555729_2555972_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034468.1|2556039_2558511_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	8.5e-59
WP_001098307.1|2558604_2558796_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|2558792_2558981_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|2559554_2559740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|2559926_2560316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|2560457_2560613_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
2560298:2560317	attR	GTAAATCTTTAAATTCCATC	NA	NA	NA	NA
WP_001303876.1|2560889_2561177_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|2561176_2561368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|2561395_2561797_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|2561905_2562178_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|2562161_2562587_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|2562793_2563249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000788752.1|2564449_2565190_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	85.0	2.0e-117
WP_000450862.1|2565215_2565986_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	3.7e-85
WP_001151233.1|2566001_2566415_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160651.1|2566766_2567540_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|2567905_2568043_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|2568087_2568300_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_072145984.1|2568467_2568746_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001217436.1|2569673_2570045_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|2570034_2570406_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|2570557_2571376_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917739.1|2571662_2571860_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	95.4	5.7e-27
WP_000261909.1|2571997_2572711_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|2573158_2573590_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_153244796.1|2573939_2574083_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	97.4	3.7e-15
WP_106901540.1|2574068_2576006_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.6	0.0e+00
WP_000143462.1|2576141_2576321_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290231.1|2576361_2576634_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284518.1|2576710_2576926_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731198.1|2576930_2577275_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	1.4e-57
WP_000992152.1|2577325_2577859_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.0	6.2e-100
WP_012816791.1|2578377_2578563_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302717.1|2579047_2579362_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|2579443_2579668_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000235436.1|2580070_2580580_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001370721.1|2580551_2582480_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	1.8e-261
WP_000259002.1|2582463_2582670_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831794.1|2582666_2584259_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	2.1e-183
WP_001253987.1|2584248_2585754_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.6e-100
WP_000256807.1|2585790_2586138_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_000522623.1|2586195_2587224_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201512.1|2587275_2587659_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204559.1|2587651_2588005_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	67.5	3.3e-41
WP_000975030.1|2588019_2588553_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	5.0e-57
WP_000683065.1|2588549_2588945_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_001143019.1|2588952_2589705_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	1.4e-126
WP_085948186.1|2589757_2590914_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000479115.1|2590985_2591417_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_000533420.1|2591443_2591857_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	7.8e-42
WP_000082371.1|2591837_2594417_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.6	0.0e+00
WP_000847298.1|2594413_2594743_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032212654.1|2594742_2595441_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	5.8e-130
WP_106901541.1|2595446_2596190_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.3	6.4e-143
WP_000090917.1|2596126_2596759_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_101329699.1|2596819_2600299_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_001233099.1|2600366_2600966_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.0	1.1e-108
WP_101329698.1|2601030_2602344_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	98.2	2.8e-77
WP_001023455.1|2602345_2602615_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000767049.1|2602836_2603379_+	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.0	9.3e-51
WP_106420821.1|2603323_2603518_+	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	84.6	4.1e-09
WP_001131653.1|2603508_2604090_+	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	64.2	5.1e-63
>prophage 6
NZ_CP027454	Escherichia coli strain 2014C-4423 chromosome, complete genome	5338915	2723171	2810585	5338915	protease,transposase,tail,holin,portal,integrase,head	Stx2-converting_phage(28.75%)	118	2778730:2778747	2810358:2810375
WP_000074974.1|2723171_2724290_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	2.6e-84
WP_000003742.1|2724258_2724528_-	excisionase	NA	NA	NA	NA	NA
WP_000048560.1|2724589_2727061_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000560212.1|2727184_2727406_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	82.2	4.3e-31
WP_001331716.1|2727811_2727976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2728118_2728418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2728770_2729049_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2729050_2729242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169687.1|2729262_2729634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2729731_2730034_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693944.1|2730030_2730456_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|2730478_2731441_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_001151187.1|2731481_2731904_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	3.9e-65
WP_000935423.1|2732009_2732222_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	97.1	5.6e-36
WP_000209148.1|2732254_2732473_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_001370098.1|2732474_2732633_+	hypothetical protein	NA	A0A220NQU8	Salmonella_phage	75.6	2.2e-13
WP_001066422.1|2732636_2734193_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
WP_000631725.1|2734212_2734560_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|2734556_2735231_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_136865621.1|2735236_2735455_+	hypothetical protein	NA	S4TNB5	Salmonella_phage	70.8	7.6e-12
WP_000208016.1|2735465_2736335_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	79.2	8.5e-123
WP_001278454.1|2736450_2736555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024174193.1|2736743_2736956_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	97.1	2.5e-28
WP_000756560.1|2737073_2737421_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	81.7	9.2e-44
WP_000046991.1|2737541_2737814_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.1	1.9e-12
WP_001265272.1|2737815_2738865_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.1e-108
WP_001121083.1|2738877_2739252_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.1	6.4e-35
WP_000762899.1|2739248_2740070_+	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	8.2e-83
WP_000917750.1|2740295_2740493_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935558.1|2740643_2741702_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	90.1	3.8e-189
WP_001344632.1|2742589_2742721_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_032212668.1|2743163_2745014_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	97.1	0.0e+00
WP_000411804.1|2745460_2745667_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_087661054.1|2745711_2746925_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000138558.1|2747235_2747508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003112.1|2747667_2748201_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_001443546.1|2748278_2748470_+	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	63.9	7.8e-05
WP_001208682.1|2748847_2749054_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|2749118_2749343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|2749699_2749840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032208049.1|2749969_2750083_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	85.7	2.9e-07
WP_000088311.1|2750150_2750453_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094185360.1|2750550_2751706_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_077760344.1|2751699_2752443_+|portal	phage portal protein	portal	A0A0P0ZCZ4	Stx2-converting_phage	99.3	7.2e-78
WP_000125984.1|2752439_2752766_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|2752776_2753127_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|2753123_2753570_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2753566_2753911_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275482.1|2753976_2754693_+|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.2	6.2e-127
WP_000710949.1|2754707_2755082_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001453698.1|2755177_2755387_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212947.1|2755438_2758681_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.6	0.0e+00
WP_000807954.1|2758673_2759015_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_032212666.1|2759014_2759713_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_124983447.1|2760413_2761043_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	94.2	1.5e-97
WP_106901542.1|2761283_2764760_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	98.2	0.0e+00
WP_024174257.1|2764828_2765404_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	55.6	1.2e-59
WP_106901543.1|2765468_2766782_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
WP_032212659.1|2766783_2767053_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	7.1e-44
WP_012817749.1|2767178_2767931_-	type III effector	NA	NA	NA	NA	NA
WP_001370123.1|2769047_2770166_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107384.1|2770162_2771956_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|2771974_2772682_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|2772678_2773266_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063978.1|2773262_2773661_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004899.1|2773657_2774515_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263584.1|2774648_2776193_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460789.1|2776204_2777341_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|2777353_2777446_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001297112.1|2777525_2778824_+	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
2778730:2778747	attL	CAGGATGTGAAGAGCGAA	NA	NA	NA	NA
WP_000208650.1|2778938_2781119_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000057871.1|2781138_2781585_-	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_001295357.1|2781572_2782712_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000742335.1|2782757_2784854_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001038062.1|2784853_2785600_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001247610.1|2785596_2786241_-	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001295358.1|2786347_2786653_-	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_000087763.1|2787094_2787307_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|2787592_2787805_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|2787815_2788004_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|2787978_2788209_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|2788198_2788372_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818477.1|2788420_2789494_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001399304.1|2789565_2792310_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	4.6e-37
WP_000533662.1|2792404_2793478_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	99.7	1.3e-200
WP_001303849.1|2793455_2793674_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|2793713_2793881_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_000022062.1|2793969_2794251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208006.1|2794365_2795163_-	DUF550 domain-containing protein	NA	A0A075B8H2	Enterobacteria_phage	41.1	5.7e-49
WP_000582238.1|2795173_2795929_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.8	4.2e-142
WP_001289864.1|2795930_2796338_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.8	2.8e-68
WP_000763386.1|2796334_2796556_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	98.6	6.4e-35
WP_001443983.1|2796654_2796936_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548546.1|2796946_2797138_-	DUF1382 family protein	NA	A0A0P0ZC49	Stx2-converting_phage	100.0	4.3e-27
WP_032204932.1|2797110_2797293_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	2.2e-28
WP_000186740.1|2797292_2797970_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100845.1|2797966_2798752_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995439.1|2798757_2799054_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372922.1|2799108_2799273_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	96.3	9.3e-23
WP_001198859.1|2799241_2799406_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	98.1	9.0e-26
WP_001132915.1|2799478_2799847_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	96.7	1.1e-63
WP_000213975.1|2800032_2800233_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_072097037.1|2800981_2801437_-	antitermination protein	NA	J3JZZ6	Escherichia_phage	96.1	6.8e-63
WP_096910866.1|2801785_2802604_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	46.2	3.3e-36
WP_001274756.1|2802770_2803484_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|2803584_2803785_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|2803903_2804197_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185425.1|2804229_2805129_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	6.0e-172
WP_000788869.1|2805125_2805827_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145926.1|2805823_2806114_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000736903.1|2806187_2806628_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_001254222.1|2806624_2806807_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_000566869.1|2806803_2806974_+	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	96.4	3.5e-25
WP_001108066.1|2806966_2807587_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	2.0e-94
WP_001028836.1|2807583_2808249_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	3.2e-130
WP_000750155.1|2808460_2809420_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|2809758_2809881_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097237.1|2809895_2810585_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
2810358:2810375	attR	CAGGATGTGAAGAGCGAA	NA	NA	NA	NA
>prophage 7
NZ_CP027454	Escherichia coli strain 2014C-4423 chromosome, complete genome	5338915	2814251	2851000	5338915	transposase,tail,holin,terminase,portal,capsid,lysis,head	Escherichia_phage(35.14%)	40	NA	NA
WP_001341423.1|2814251_2814926_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|2814922_2815270_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066419.1|2815289_2816846_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000411802.1|2817068_2817275_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_001135302.1|2817274_2817772_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.6	1.4e-90
WP_000092313.1|2817768_2818206_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_001307652.1|2819159_2819354_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_001429103.1|2819781_2820288_+	DNA-packaging protein	NA	O64316	Escherichia_phage	47.9	1.5e-34
WP_001299181.1|2820259_2822188_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	1.8e-261
WP_000259002.1|2822171_2822378_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831794.1|2822374_2823967_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	2.1e-183
WP_001253987.1|2823956_2825462_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.6e-100
WP_000256807.1|2825498_2825846_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_106901544.1|2825961_2826933_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.8	1.6e-106
WP_000201512.1|2826984_2827368_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204559.1|2827360_2827714_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	67.5	3.3e-41
WP_000975030.1|2827728_2828262_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	5.0e-57
WP_000683065.1|2828258_2828654_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_001143019.1|2828661_2829414_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	1.4e-126
WP_085948186.1|2829466_2830623_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000479115.1|2830694_2831126_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_000533420.1|2831152_2831566_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	7.8e-42
WP_000082371.1|2831546_2834126_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.6	0.0e+00
WP_000847298.1|2834122_2834452_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032212654.1|2834451_2835150_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	5.8e-130
WP_106901545.1|2835155_2835899_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	1.9e-147
WP_122994837.1|2835844_2836477_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	93.3	3.1e-98
WP_096910863.1|2837034_2838248_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_106901569.1|2838466_2841502_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.6	0.0e+00
WP_024174257.1|2841570_2842146_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	55.6	1.2e-59
WP_106901543.1|2842210_2843524_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
WP_001370649.1|2843525_2843795_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	1.4e-44
WP_032210229.1|2843908_2844484_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.0	4.6e-56
WP_001118085.1|2844774_2845356_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_012816780.1|2845423_2846059_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001299273.1|2846186_2847245_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144080.1|2847319_2847970_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132165.1|2848152_2848743_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_000799399.1|2849016_2849880_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531590.1|2849863_2851000_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.2	2.1e-28
>prophage 8
NZ_CP027454	Escherichia coli strain 2014C-4423 chromosome, complete genome	5338915	2966842	2978301	5338915	transposase	Escherichia_phage(50.0%)	17	NA	NA
WP_000394552.1|2966842_2967250_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_085948186.1|2967326_2968483_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001171901.1|2968539_2968758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2968830_2969130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2969394_2969802_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2969878_2970106_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705623.1|2970089_2970641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2970612_2971653_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157830737.1|2971564_2972107_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000450692.1|2972140_2972875_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_122368318.1|2972871_2973036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2973734_2974493_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|2974771_2974984_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|2975204_2975462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2975531_2975810_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001370670.1|2975811_2976804_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	47.3	7.3e-78
WP_085947772.1|2977088_2978301_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
>prophage 9
NZ_CP027454	Escherichia coli strain 2014C-4423 chromosome, complete genome	5338915	3084542	3132159	5338915	tRNA,integrase,tail,transposase	Escherichia_phage(51.61%)	49	3084176:3084191	3131811:3131826
3084176:3084191	attL	TGCTGGATAAGCTGCG	NA	NA	NA	NA
WP_000628065.1|3084542_3085775_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|3086029_3087013_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001296046.1|3087287_3087461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123758.1|3087490_3088864_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157421.1|3088992_3089928_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_000040852.1|3089979_3091215_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|3091216_3091432_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|3091510_3091720_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|3091712_3091907_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000595429.1|3091963_3092773_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	69.9	2.2e-104
WP_000102191.1|3092765_3095435_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	59.6	2.0e-194
WP_001427414.1|3095515_3095686_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_000560223.1|3095685_3095907_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_050437129.1|3096331_3096484_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	7.8e-08
WP_001253182.1|3096864_3097329_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	69.5	1.2e-54
WP_000171139.1|3097433_3097709_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	65.9	1.4e-23
WP_000702023.1|3097692_3098115_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_000788989.1|3098991_3099738_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	2.8e-114
WP_001370676.1|3099759_3100521_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	2.0e-120
WP_001151266.1|3100536_3100953_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	86.2	1.6e-58
WP_001275735.1|3100949_3101423_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	74.8	2.9e-64
WP_001204666.1|3101745_3102324_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_000156213.1|3102283_3103381_-	hypothetical protein	NA	A0A0U2S621	Escherichia_phage	99.7	9.5e-212
WP_085947598.1|3103934_3105097_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_106901570.1|3105167_3106649_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	93.5	1.1e-250
WP_001230496.1|3106715_3107315_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.3e-109
WP_032212694.1|3107379_3108693_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	5.3e-76
WP_001023386.1|3108694_3108964_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	95.5	6.0e-43
WP_122988840.1|3109074_3109152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993102.1|3109366_3110380_+	peptidase M85	NA	NA	NA	NA	NA
WP_016241229.1|3110750_3111065_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347482.1|3111124_3112408_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000214712.1|3113993_3114197_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000215549.1|3114374_3115061_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000636571.1|3115149_3115896_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_001370614.1|3116032_3118078_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_001024746.1|3118121_3118640_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000671731.1|3118915_3119308_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_000592837.1|3119562_3120453_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.8e-19
WP_000901367.1|3120671_3120767_-	protein MgtS	NA	NA	NA	NA	NA
WP_001054189.1|3120893_3122081_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000087216.1|3122275_3123175_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_106901571.1|3123219_3123942_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085948186.1|3123934_3125091_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000722571.1|3125383_3125695_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_001370581.1|3125809_3127132_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001296721.1|3127159_3127471_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001022785.1|3127526_3129200_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_096910863.1|3130945_3132159_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
3131811:3131826	attR	CGCAGCTTATCCAGCA	NA	NA	NA	NA
>prophage 10
NZ_CP027454	Escherichia coli strain 2014C-4423 chromosome, complete genome	5338915	3321317	3405563	5338915	protease,tail,transposase,holin,terminase,integrase,portal	Enterobacteria_phage(32.05%)	100	3344289:3344306	3397637:3397654
WP_000837940.1|3321317_3322451_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	59.1	6.3e-118
WP_001295593.1|3322591_3323026_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_085948186.1|3323880_3325036_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000731236.1|3325451_3325796_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411802.1|3325800_3326007_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000023191.1|3326454_3328305_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_157744807.1|3328290_3328434_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	92.1	4.0e-14
WP_001359877.1|3328783_3329215_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	3.6e-66
WP_000301797.1|3329665_3330379_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917748.1|3330514_3330712_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	95.4	1.5e-27
WP_000640035.1|3330936_3331491_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217447.1|3331499_3331859_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_001265229.1|3331871_3332921_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|3332922_3333195_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|3333316_3333661_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|3333780_3333993_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104475.1|3334226_3334784_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.3	2.4e-33
WP_000683609.1|3334785_3335004_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|3335131_3335443_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|3335435_3335663_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|3335659_3335941_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|3335973_3336690_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|3336723_3337185_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262401.1|3337177_3338245_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	85.3	1.9e-84
WP_000693878.1|3338313_3338739_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|3338722_3338965_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|3339356_3339695_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|3339987_3340140_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|3340151_3340790_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|3340790_3341000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|3341564_3341753_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|3341749_3341938_+	DUF1482 family protein	NA	NA	NA	NA	NA
3344289:3344306	attL	GGCAGGGGATCCCCTGCC	NA	NA	NA	NA
WP_085948186.1|3344672_3345828_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_048258936.1|3345821_3346085_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.8	5.4e-12
WP_001206148.1|3346104_3347400_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_120795384.1|3348050_3348164_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|3348232_3348466_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086528.1|3348782_3349370_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	6.1e-24
WP_085948186.1|3349575_3350732_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001370405.1|3350788_3351310_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.9	2.3e-91
WP_072004194.1|3351309_3354264_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.7	6.0e-67
WP_001230525.1|3354328_3354928_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	8.8e-111
WP_000515486.1|3354994_3358393_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.6	0.0e+00
WP_001399694.1|3358453_3359101_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	1.2e-110
WP_000140752.1|3358998_3359742_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.5e-147
WP_001152409.1|3359747_3360446_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	2.3e-134
WP_000447255.1|3360455_3360785_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	8.6e-60
WP_000372036.1|3360784_3363850_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.7	0.0e+00
WP_001161009.1|3363821_3364151_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001370402.1|3364159_3364546_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
WP_000211089.1|3364606_3365350_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	96.8	4.0e-129
WP_001079398.1|3365361_3365763_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677106.1|3365759_3366338_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001283147.1|3366349_3366625_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
WP_001097046.1|3366617_3366941_-	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
WP_159031908.1|3368999_3370487_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	4.8e-283
WP_001072975.1|3370508_3370721_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000133409.1|3372203_3372485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032209815.1|3372742_3374632_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
WP_001302595.1|3374715_3374862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126660.1|3375290_3375713_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001399692.1|3375709_3375955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833609.1|3376242_3378069_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.7	2.0e-129
WP_001261504.1|3378065_3378365_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001113138.1|3378371_3378692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024200973.1|3378684_3378948_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000179578.1|3379085_3379391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130338.1|3379448_3379646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038673.1|3379766_3380345_-	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	65.4	4.9e-58
WP_000229066.1|3380404_3380629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000114064.1|3380621_3381860_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.1	6.6e-60
WP_001399690.1|3381977_3382949_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.7	3.1e-182
WP_000421825.1|3383023_3383563_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001031431.1|3384115_3384322_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000035577.1|3384622_3385033_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001019140.1|3385184_3385358_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|3385529_3385685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|3385765_3385831_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|3385833_3386022_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|3386032_3386245_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|3386606_3387104_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|3387100_3387634_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_087661054.1|3387928_3389141_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_024025755.1|3389259_3389475_-|holin	holin	holin	A5LH82	Enterobacteria_phage	93.0	5.5e-31
WP_000066485.1|3390228_3390444_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	7.7e-25
WP_000087756.1|3390744_3390957_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|3391011_3391101_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000203370.1|3391727_3391913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047121.1|3393073_3393826_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.8	2.1e-133
WP_012775982.1|3394891_3395170_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_087661054.1|3395434_3396648_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001296941.1|3397929_3398166_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
3397637:3397654	attR	GGCAGGGGATCCCCTGCC	NA	NA	NA	NA
WP_000997984.1|3398323_3399862_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.0e-296
WP_000612591.1|3399911_3400259_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001066422.1|3400440_3401997_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
WP_000631725.1|3402016_3402364_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|3402360_3403035_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000836078.1|3403238_3403805_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	30.2	1.5e-11
WP_001370501.1|3403816_3405031_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001295395.1|3405236_3405563_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
>prophage 11
NZ_CP027454	Escherichia coli strain 2014C-4423 chromosome, complete genome	5338915	3709550	3779928	5338915	plate,transposase,tail,holin,terminase,head,capsid,tRNA,integrase,portal	Enterobacteria_phage(66.67%)	83	3745629:3745688	3780873:3780994
WP_001025305.1|3709550_3711284_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	5.7e-86
WP_001341423.1|3711464_3712139_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|3712135_3712483_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066422.1|3712502_3714059_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
WP_001171554.1|3714207_3714588_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3714584_3714932_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000997984.1|3714981_3716520_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.0e-296
WP_001370468.1|3716627_3717116_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|3717235_3717628_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066983.1|3717627_3719706_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278912.1|3719698_3720847_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983611.1|3721048_3721693_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763874.1|3721703_3722093_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	34.6	1.0e-06
WP_000036378.1|3722107_3723157_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|3723159_3724020_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483246.1|3724038_3725640_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	2.2e-15
WP_001370571.1|3725685_3727347_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	7.6e-11
WP_000147302.1|3727491_3727995_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001355823.1|3728015_3729980_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|3729984_3730911_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906322.1|3730907_3731795_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|3731921_3732500_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|3732502_3732853_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122426.1|3733632_3734061_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001370485.1|3734067_3735492_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001295645.1|3735466_3736267_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|3736433_3737420_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187811.1|3737434_3738949_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548675.1|3739018_3740008_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179469.1|3740804_3741308_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|3741386_3741638_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|3741752_3741839_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237866.1|3742101_3742425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|3742595_3743093_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377225.1|3743130_3743370_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797573.1|3743560_3744772_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847902.1|3744833_3745499_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
3745629:3745688	attL	AAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATC	NA	NA	NA	NA
WP_001300279.1|3745856_3746858_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865386.1|3746863_3747211_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000786769.1|3747906_3748311_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|3748400_3748538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|3748609_3748813_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|3748834_3749185_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159467.1|3749195_3749474_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	5.3e-34
WP_000514274.1|3749485_3749728_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	6.8e-38
WP_000021655.1|3749724_3749838_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_029594336.1|3749952_3750348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985144.1|3750371_3750575_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	5.5e-25
WP_000153711.1|3750571_3750838_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	3.4e-30
WP_000108347.1|3750834_3751134_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	86.9	9.0e-40
WP_122985482.1|3751145_3751763_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	37.8	2.1e-06
WP_000564228.1|3751759_3752149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000686474.1|3755063_3756023_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	6.4e-180
WP_000211270.1|3756027_3756339_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	94.2	4.2e-48
WP_001289970.1|3756402_3756786_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.0	9.8e-31
WP_000711111.1|3756877_3757408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087807.1|3757937_3758984_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.4	6.3e-205
WP_032209856.1|3758983_3760735_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_001262656.1|3760889_3761726_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.6	1.5e-148
WP_001055112.1|3761749_3762802_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	2.9e-194
WP_000632364.1|3762847_3763648_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	97.4	3.3e-137
WP_000063078.1|3763750_3764245_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.2	2.3e-88
WP_000864901.1|3764244_3764445_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104342.1|3764447_3764771_+|holin	phage holin, lambda family	holin	A0A0A7NRY9	Enterobacteria_phage	100.0	4.2e-51
WP_000072327.1|3764767_3765160_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780572.1|3765156_3765564_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_032209860.1|3765701_3766169_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.3e-85
WP_032209862.1|3766161_3766797_+|tail	tail protein	tail	A0A0A7NV60	Enterobacteria_phage	98.6	4.5e-113
WP_001271900.1|3766793_3767375_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.4e-100
WP_000213447.1|3767371_3767722_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111920.1|3767725_3768622_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	5.7e-154
WP_000071720.1|3768614_3769145_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_000108489.1|3769147_3771148_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	97.6	4.6e-111
WP_000885638.1|3771147_3771765_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	80.9	1.0e-85
WP_001447286.1|3771728_3772274_-	transferase	NA	NA	NA	NA	NA
WP_000853431.1|3772952_3775760_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.7	0.0e+00
WP_000333494.1|3775746_3775902_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_000665308.1|3775910_3776276_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|3776330_3776843_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005425.1|3776842_3778027_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	4.4e-223
WP_000132830.1|3778184_3779294_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000488108.1|3779336_3779597_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|3779787_3779928_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
3780873:3780994	attR	AAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 12
NZ_CP027454	Escherichia coli strain 2014C-4423 chromosome, complete genome	5338915	3927898	3936188	5338915		Moumouvirus(14.29%)	7	NA	NA
WP_000414659.1|3927898_3929002_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	32.1	2.7e-28
WP_086163603.1|3929001_3929901_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.7	1.8e-107
WP_000697837.1|3929867_3930956_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	50.3	2.5e-95
WP_000875590.1|3930958_3931987_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	E3T4Y8	Cafeteria_roenbergensis_virus	45.1	4.5e-70
WP_000009507.1|3932023_3933304_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	A0A218MKK1	uncultured_virus	24.7	2.1e-08
WP_000183035.1|3933725_3934619_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_001115962.1|3934793_3936188_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 13
NZ_CP027454	Escherichia coli strain 2014C-4423 chromosome, complete genome	5338915	4027985	4037427	5338915		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001370574.1|4027985_4029122_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001370558.1|4029118_4031119_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|4031243_4031705_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001370504.1|4031745_4032216_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.1e-81
WP_000598641.1|4032262_4032982_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|4032978_4034664_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|4034885_4035617_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|4035676_4035784_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|4035764_4036496_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569358.1|4036500_4037427_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 14
NZ_CP027454	Escherichia coli strain 2014C-4423 chromosome, complete genome	5338915	4248212	4348484	5338915	bacteriocin,protease,tail,transposase,holin,tRNA,integrase,capsid	Escherichia_phage(57.65%)	110	4279760:4279784	4348679:4348703
WP_001283581.1|4248212_4249025_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|4249024_4250038_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000615813.1|4251339_4252335_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127745.1|4252331_4253510_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817184.1|4253793_4255014_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683817.1|4255172_4257179_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|4257299_4257578_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089241.1|4257611_4258160_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447367.1|4258159_4258969_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043819.1|4258968_4259793_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|4259796_4260882_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001300582.1|4260916_4261849_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|4262014_4262566_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001370480.1|4262637_4263489_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000844751.1|4263490_4264030_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000714139.1|4264026_4264515_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000018471.1|4264511_4265021_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000482743.1|4265036_4265789_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000033328.1|4268531_4269095_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|4269778_4270264_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426163.1|4270466_4272611_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531955.1|4272610_4273921_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|4274101_4274386_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|4274757_4276098_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_032209956.1|4276463_4277522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|4277703_4278459_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|4278752_4279685_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
4279760:4279784	attL	TGTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
WP_000885695.1|4279907_4288283_-	hypothetical protein	NA	A0A0P0ZCC7	Stx2-converting_phage	97.0	0.0e+00
WP_001370495.1|4288351_4289344_-	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	90.0	3.3e-163
WP_085948186.1|4289416_4290573_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_032210112.1|4290894_4291146_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	94.7	1.1e-11
WP_000455646.1|4291155_4291602_-	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	97.3	1.3e-74
WP_106901560.1|4291604_4292258_-	hypothetical protein	NA	Q08J74	Stx2-converting_phage	96.3	3.1e-109
WP_000035554.1|4292351_4292753_-	hypothetical protein	NA	A0A2L1IV61	Escherichia_phage	97.0	3.9e-70
WP_000682942.1|4293182_4293905_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	76.7	9.0e-102
WP_001399382.1|4294051_4294609_-	hypothetical protein	NA	Q08J77	Stx2-converting_phage	98.9	5.5e-107
WP_001369201.1|4294614_4294896_-	hypothetical protein	NA	Q08J78	Stx2-converting_phage	100.0	3.1e-50
WP_000162956.1|4294910_4296179_-	host specificity protein J	NA	Q08J79	Stx2-converting_phage	100.0	9.9e-221
WP_106901526.1|4297169_4298325_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001370566.1|4299371_4299551_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	2.8e-28
WP_001023433.1|4299688_4299958_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	6.4e-45
WP_000117996.1|4299959_4301798_-|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.0e-64
WP_000207919.1|4301794_4302445_-	hypothetical protein	NA	A0A0H4J3F2	Shigella_phage	99.5	3.9e-120
WP_000829203.1|4302444_4303008_-	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	99.5	7.0e-102
WP_001370499.1|4302991_4303453_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	94.8	3.3e-73
WP_001140444.1|4303503_4303893_-	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_000214470.1|4303947_4305162_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	99.5	1.1e-232
WP_000345010.1|4305185_4306193_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787524.1|4306350_4308495_-	hypothetical protein	NA	A0A2R2Z346	Escherichia_phage	99.9	0.0e+00
WP_087661054.1|4309356_4310569_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001086087.1|4311495_4312302_-	hypothetical protein	NA	A0A1U9AJA9	Stx1_converting_phage	99.3	1.1e-132
WP_001109019.1|4312594_4313146_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_012816791.1|4313373_4313559_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000455406.1|4313786_4313936_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_106901561.1|4313935_4314484_-	hypothetical protein	NA	A0A1U9AJ99	Stx1_converting_phage	99.4	3.0e-89
WP_096910863.1|4314480_4315694_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_000087714.1|4316092_4316626_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_000284510.1|4316630_4316846_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290216.1|4316922_4317195_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	98.9	3.1e-23
WP_000143462.1|4317235_4317415_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_106901562.1|4317550_4319251_-	sialate O-acetylesterase	NA	G9L6J1	Escherichia_phage	99.5	0.0e+00
WP_085948186.1|4319369_4320526_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000738068.1|4321241_4321511_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|4321522_4322482_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001356551.1|4322864_4323017_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204859.1|4323265_4323700_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144767.1|4323692_4323887_-	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_001108009.1|4323883_4324489_-	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	98.0	2.4e-95
WP_001004008.1|4324488_4325211_-	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.6	3.9e-129
WP_000178727.1|4325285_4325960_-	phage antirepressor Ant	NA	A0A0P0ZDQ5	Stx2-converting_phage	88.8	6.2e-113
WP_000201604.1|4326225_4326591_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	96.7	3.7e-43
WP_001254258.1|4326847_4327042_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	2.9e-31
WP_000153293.1|4327038_4327566_-	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	100.0	9.5e-101
WP_000573864.1|4327562_4328165_-	endonuclease	NA	G9L687	Escherichia_phage	100.0	1.7e-114
WP_001229012.1|4328157_4328574_-	NinB protein	NA	G9L686	Escherichia_phage	100.0	3.9e-73
WP_000103680.1|4328747_4328963_-	hypothetical protein	NA	G9L684	Escherichia_phage	100.0	2.2e-32
WP_000818843.1|4329107_4329314_-	hypothetical protein	NA	G9L683	Escherichia_phage	100.0	2.7e-27
WP_001036028.1|4329386_4329656_-	hypothetical protein	NA	G9L682	Escherichia_phage	100.0	2.9e-45
WP_001248397.1|4329652_4332046_-	DNA helicase	NA	G9L681	Escherichia_phage	99.7	0.0e+00
WP_000431329.1|4332042_4332930_-	hypothetical protein	NA	G9L680	Escherichia_phage	99.7	2.8e-145
WP_001244621.1|4332992_4333265_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000438537.1|4333287_4333587_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	100.0	1.3e-49
WP_001180318.1|4333693_4333921_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_106901563.1|4333999_4334707_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	99.1	5.7e-133
WP_000885926.1|4334767_4335109_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
WP_001189994.1|4335295_4336114_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	46.2	3.3e-36
WP_001370067.1|4336562_4336904_+	hypothetical protein	NA	F1C5C1	Cronobacter_phage	66.4	2.5e-30
WP_096910863.1|4337064_4338278_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_157910050.1|4338315_4338852_+	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	94.8	1.1e-88
WP_000065353.1|4339032_4339401_+	DUF2528 family protein	NA	A0A1U9AJB3	Stx1_converting_phage	99.2	2.6e-65
WP_001198858.1|4339473_4339614_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000361831.1|4339606_4339720_+	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	100.0	2.7e-13
WP_000613346.1|4339716_4339905_+	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
WP_000536228.1|4339913_4340594_+	AAA family ATPase	NA	G9L667	Escherichia_phage	100.0	3.4e-127
WP_000073097.1|4340590_4341178_+	hypothetical protein	NA	G9L666	Escherichia_phage	100.0	9.9e-107
WP_001111288.1|4341201_4341498_+	DUF2856 family protein	NA	G9L665	Escherichia_phage	100.0	9.5e-50
WP_001370500.1|4341508_4341673_+	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	9.3e-23
WP_000812196.1|4341669_4342278_+	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	93.6	1.0e-82
WP_000034212.1|4342274_4342682_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_001014298.1|4342683_4342875_+	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000206782.1|4342877_4343336_+	hypothetical protein	NA	V5UT79	Shigella_phage	54.5	7.1e-20
WP_000224734.1|4343341_4343539_+	hypothetical protein	NA	A0A222YWL3	Escherichia_phage	93.4	3.2e-25
WP_000628763.1|4344052_4344928_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	86.1	5.4e-141
WP_000969524.1|4344924_4345185_+	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	98.8	1.9e-41
WP_000002101.1|4345184_4345469_+	ASCH domain-containing protein	NA	A0A0P0ZDM1	Stx2-converting_phage	97.9	7.7e-49
WP_000609349.1|4345517_4346186_+	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	95.2	1.1e-104
WP_001291844.1|4346426_4346639_+	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000994805.1|4346674_4347070_+	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	95.4	2.0e-50
WP_000453637.1|4347148_4347331_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_001218308.1|4347314_4348484_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
4348679:4348703	attR	TGTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
>prophage 15
NZ_CP027454	Escherichia coli strain 2014C-4423 chromosome, complete genome	5338915	4570812	4672537	5338915	tail,transposase,holin,terminase,capsid,tRNA,integrase,head	Stx2-converting_phage(40.43%)	88	4655627:4655643	4679935:4679951
WP_001370572.1|4570812_4571550_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|4571681_4573016_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001370459.1|4573224_4574106_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001616362.1|4574208_4574796_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|4574851_4575235_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|4575539_4576229_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|4576276_4577314_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|4577520_4577940_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001370531.1|4578008_4578707_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082964.1|4578738_4581399_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|4581512_4582868_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|4582913_4583237_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|4583233_4584532_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|4590305_4592879_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040122.1|4593008_4593740_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079092.1|4593736_4594717_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197674.1|4594851_4595589_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|4595859_4596201_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|4596304_4596352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|4596450_4597611_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|4597653_4598775_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|4598785_4599856_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001370532.1|4600064_4600430_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|4600579_4601098_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000589828.1|4602329_4602812_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|4602888_4603236_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|4603277_4604045_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|4604075_4604624_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_032210152.1|4604642_4604891_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|4605028_4606390_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|4606556_4607348_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_024026167.1|4607368_4608655_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001307957.1|4608709_4609303_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|4609425_4610304_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|4610389_4612051_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|4612199_4612541_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|4612602_4612893_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|4612882_4613359_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|4613490_4613973_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_085948186.1|4615927_4617083_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001370486.1|4618732_4622134_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.3e-219
WP_001370516.1|4622725_4625074_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|4625093_4625183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023386.1|4625289_4625559_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	95.5	6.0e-43
WP_032212694.1|4625560_4626874_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	5.3e-76
WP_001230532.1|4626938_4627538_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
WP_106901565.1|4627604_4631078_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	98.1	0.0e+00
WP_000649829.1|4631211_4631739_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_122994351.1|4631926_4632559_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	94.3	1.2e-97
WP_032212700.1|4632504_4633248_-|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	98.0	2.3e-148
WP_032212666.1|4633258_4633957_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000807954.1|4633956_4634298_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212947.1|4634290_4637533_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.6	0.0e+00
WP_001453698.1|4637584_4637794_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000710949.1|4637889_4638264_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275482.1|4638278_4638995_-|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.2	6.2e-127
WP_000133388.1|4639060_4639405_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|4639401_4639848_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|4639844_4640195_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|4640205_4640532_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|4643058_4643280_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173032.1|4643324_4645262_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.5	0.0e+00
WP_000958402.1|4646984_4647548_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_086260344.1|4647663_4648194_-	HNH endonuclease	NA	H6WZK7	Escherichia_phage	90.3	1.3e-86
WP_000095749.1|4648235_4648463_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_000736096.1|4648831_4649056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047091958.1|4649141_4649327_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.3	1.3e-17
WP_001043239.1|4649548_4649767_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	93.3	1.0e-16
WP_000992122.1|4649844_4650378_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000731236.1|4650428_4650773_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411795.1|4650777_4650984_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	2.0e-30
WP_000143014.1|4651276_4653130_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	95.9	0.0e+00
WP_001344632.1|4653572_4653704_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_000101315.1|4654335_4655739_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
4655627:4655643	attL	TTGAAACTTTACAAAAA	NA	NA	NA	NA
WP_101329723.1|4655785_4656676_-	DNA methyltransferase	NA	A0A0P0YLW3	Yellowstone_lake_mimivirus	29.0	4.9e-17
WP_001205467.1|4656727_4657078_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	89.1	6.8e-55
WP_001399360.1|4657077_4657320_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	97.5	2.1e-34
WP_001258395.1|4657561_4658422_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	97.2	8.6e-160
WP_000844622.1|4658421_4659390_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	98.8	2.3e-185
WP_000424040.1|4659391_4661050_-	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	98.7	0.0e+00
WP_096910863.1|4661899_4663112_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_106901566.1|4663557_4664811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413407.1|4665206_4665620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024174260.1|4665734_4666130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087661054.1|4667567_4668780_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001370696.1|4669969_4671103_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000998846.1|4671111_4671333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001234104.1|4671325_4672537_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4679935:4679951	attR	TTTTTGTAAAGTTTCAA	NA	NA	NA	NA
>prophage 16
NZ_CP027454	Escherichia coli strain 2014C-4423 chromosome, complete genome	5338915	4753971	4761111	5338915		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|4753971_4756533_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141315.1|4756638_4757295_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.8	4.3e-50
WP_001297141.1|4757345_4758113_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|4758308_4759217_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590409.1|4759213_4760476_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	4.4e-136
WP_001278994.1|4760472_4761111_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 17
NZ_CP027454	Escherichia coli strain 2014C-4423 chromosome, complete genome	5338915	4985010	5024043	5338915	tRNA,integrase,protease,transposase	Stx2-converting_phage(45.45%)	43	4993043:4993057	5011168:5011182
WP_001370180.1|4985010_4985508_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|4985602_4986310_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222508.1|4986389_4987121_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|4987133_4988084_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|4988192_4988756_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017112.1|4988755_4989202_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_101329719.1|4989410_4990385_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|4990357_4991062_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|4991079_4991646_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|4991642_4991933_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174739.1|4991940_4992534_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239917.1|4992526_4993663_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
4993043:4993057	attL	CTGGAAGAGGCGCTT	NA	NA	NA	NA
WP_000784004.1|4993976_4994963_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577033.1|4995007_4995511_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_106901573.1|4995553_4996813_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745214.1|4996868_4997876_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394120.1|4997992_4999039_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|4999214_4999934_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001178593.1|4999954_5000095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107564.1|5000117_5000444_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|5000443_5001163_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001298922.1|5001323_5002376_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|5002403_5002679_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298916.1|5002743_5003823_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|5004024_5005281_+	nucleoside permease	NA	NA	NA	NA	NA
WP_001370231.1|5005329_5007465_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234502.1|5007862_5008570_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218841.1|5008948_5010214_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_000997985.1|5010330_5011869_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	8.7e-296
5011168:5011182	attR	AAGCGCCTCTTCCAG	NA	NA	NA	NA
WP_106901533.1|5011977_5012652_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|5012648_5012996_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066419.1|5013015_5014572_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000839246.1|5014832_5015030_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000777666.1|5015041_5015530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854916.1|5015526_5015904_-	toxin	NA	NA	NA	NA	NA
WP_024174207.1|5015950_5016325_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692312.1|5016487_5016709_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_077633701.1|5016777_5016945_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000624681.1|5018227_5018578_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	1.8e-39
WP_000422707.1|5018574_5019000_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	2.9e-47
WP_096910863.1|5019522_5020735_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_000953521.1|5021748_5023113_-	EspK/GogB family type III secretion system effector	NA	Q9MBM1	Phage_Gifsy-1	29.5	7.3e-52
WP_001145628.1|5023404_5024043_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	42.7	9.0e-45
>prophage 18
NZ_CP027454	Escherichia coli strain 2014C-4423 chromosome, complete genome	5338915	5173110	5232101	5338915	tRNA,protease,transposase	Caulobacter_phage(14.29%)	60	NA	NA
WP_000708503.1|5173110_5174349_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.3	1.3e-92
WP_001305111.1|5174511_5175333_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001295541.1|5175422_5175791_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_001272796.1|5175895_5176513_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_000935214.1|5176525_5177458_-	DNA-binding transcriptional activator TtdR	NA	NA	NA	NA	NA
WP_000986797.1|5177664_5178576_+	L(+)-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
WP_000722957.1|5178572_5179178_+	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
WP_000804928.1|5179226_5180690_+	anion permease	NA	NA	NA	NA	NA
WP_001264365.1|5180732_5181746_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|5181983_5182199_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|5182309_5184055_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|5184249_5186091_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|5186169_5186676_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001274557.1|5186975_5187821_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000772026.1|5187905_5188103_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001054228.1|5188122_5188611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854687.1|5188607_5188988_-	toxin	NA	NA	NA	NA	NA
WP_001443392.1|5189076_5189445_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692312.1|5189520_5189742_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_001186728.1|5189804_5190281_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855068.1|5190296_5190770_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.5	2.5e-12
WP_001164974.1|5190863_5191109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001243192.1|5191667_5193446_-	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	29.2	5.2e-26
WP_000848829.1|5194558_5194969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348967.1|5194984_5195227_-	DNA polymerase III subunit gamma/tau	NA	NA	NA	NA	NA
WP_077252115.1|5195236_5195467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102649.1|5195796_5196867_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203527.1|5196863_5197769_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000544707.1|5197765_5200162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069798.1|5200379_5201252_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000282124.1|5201582_5201765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066419.1|5202211_5203768_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000631725.1|5203787_5204135_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|5204131_5204806_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_087661054.1|5204910_5206124_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_032210102.1|5206175_5206505_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	94.8	3.2e-46
WP_032210101.1|5206662_5207904_-	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000301248.1|5208332_5208908_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|5208976_5209555_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|5209603_5210644_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|5210666_5211122_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|5211144_5212302_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000254140.1|5212301_5212883_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|5213205_5214264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|5214273_5215416_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|5215408_5216182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|5216183_5217263_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|5217262_5218219_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506894.1|5218229_5219438_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|5219455_5219923_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|5220183_5220513_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957247.1|5220499_5220880_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001370715.1|5220922_5222464_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	36.8	3.9e-78
WP_001443493.1|5223996_5224668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135714.1|5225534_5225675_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	3.1e-11
WP_000803992.1|5225976_5226240_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000024297.1|5228235_5228595_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591998.1|5228687_5230307_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000134819.1|5230531_5230807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|5230945_5232101_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
>prophage 19
NZ_CP027454	Escherichia coli strain 2014C-4423 chromosome, complete genome	5338915	5240004	5269852	5338915	tRNA,integrase,protease,transposase	Stx2-converting_phage(42.86%)	23	5232690:5232704	5270451:5270465
5232690:5232704	attL	GCAGCGGCGCGCAGG	NA	NA	NA	NA
WP_001034023.1|5240004_5244096_+|protease	serine protease autotransporter EspI	protease	Q9LA58	Enterobacterial_phage	44.6	6.8e-311
WP_077633724.1|5244549_5244798_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	80.2	1.3e-28
WP_001341423.1|5244811_5245486_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|5245482_5245830_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066419.1|5245849_5247406_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000612591.1|5247664_5248012_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000997983.1|5248061_5249600_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.9e-296
WP_000035067.1|5249666_5249855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087661054.1|5250103_5251316_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_085948186.1|5251927_5253084_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_050438101.1|5254646_5255555_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_000088311.1|5255500_5255803_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000282106.1|5256235_5256799_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_032209782.1|5257811_5259245_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000270113.1|5259340_5259568_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000248065.1|5260297_5261911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000268401.1|5262003_5262600_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	89.4	2.0e-99
WP_000290297.1|5262729_5264046_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.8	6.6e-34
WP_001065895.1|5264342_5265107_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018003.1|5265383_5266007_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000094682.1|5266160_5267681_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000633393.1|5267987_5269478_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-33
WP_000450589.1|5269519_5269852_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
5270451:5270465	attR	CCTGCGCGCCGCTGC	NA	NA	NA	NA
>prophage 1
NZ_CP027455	Escherichia coli strain 2014C-4423 plasmid unnamed1, complete sequence	73262	32567	40341	73262	integrase	Escherichia_phage(28.57%)	10	27794:27810	45632:45648
27794:27810	attL	GGCACGTTTCATGCCGT	NA	NA	NA	NA
WP_021553177.1|32567_33251_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	4.3e-29
WP_106901586.1|33635_34538_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618111.1|34955_35204_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	49.3	1.1e-14
WP_021553174.1|35200_35638_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.6	1.9e-25
WP_000457496.1|35637_36909_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	1.4e-142
WP_000340829.1|36913_37306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103690.1|37310_38282_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_000633913.1|38510_39155_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_000239529.1|39148_39424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302707.1|39561_40341_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	96.4	2.6e-54
45632:45648	attR	GGCACGTTTCATGCCGT	NA	NA	NA	NA
