The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027462	Escherichia coli isolate 07-4299 chromosome, complete genome	4847172	912370	919510	4847172		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|912370_913009_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590388.1|913005_914268_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	5.7e-136
WP_000847985.1|914264_915173_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|915368_916136_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141334.1|916186_916843_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	4.3e-50
WP_001272898.1|916948_919510_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 2
NZ_CP027462	Escherichia coli isolate 07-4299 chromosome, complete genome	4847172	956106	1070312	4847172	head,lysis,transposase,portal,terminase,capsid,tRNA,tail,plate,integrase	Salmonella_phage(60.34%)	115	997659:997703	1031946:1031990
WP_000047176.1|956106_958737_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|958971_959157_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273309.1|960749_961316_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287457.1|961312_961741_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611804.1|961813_963370_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130210.1|963519_964035_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001295176.1|964098_965637_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001295175.1|965653_966826_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378442.1|966952_967483_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_000119763.1|967573_967909_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445658.1|967898_968636_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_000165699.1|968759_969944_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216527.1|970234_971227_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774996.1|971283_972348_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985494.1|972340_973543_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777968.1|973897_974857_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	2.2e-132
WP_000246536.1|974866_977011_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.1	5.4e-195
WP_000080944.1|976983_977394_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_001223227.1|977390_977636_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001295174.1|977883_978213_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|978364_978709_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492656.1|978745_979195_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115383.1|979862_980267_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229444.1|980313_980838_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000137280.1|980847_981147_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|981329_981488_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522415.1|981571_982021_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|982021_982684_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001295173.1|982704_984105_-	GABA permease	NA	NA	NA	NA	NA
WP_001087606.1|984415_985696_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
WP_000772847.1|985709_987158_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271942.1|987180_988449_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000993087.1|988468_989446_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_087599250.1|990954_992116_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000577254.1|992268_993987_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
WP_033802718.1|993988_995737_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.7	0.0e+00
WP_000448925.1|995808_996225_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001341819.1|996263_997493_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
997659:997703	attL	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_001716855.1|997788_998835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000155498.1|998824_999865_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	92.7	1.7e-189
WP_000102105.1|1000618_1000861_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000460855.1|1000893_1001403_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	93.5	1.9e-82
WP_071607947.1|1001410_1001707_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.4e-21
WP_000996717.1|1001824_1002166_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001716853.1|1002233_1002467_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000752619.1|1002466_1002694_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_043856316.1|1002690_1003548_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.9	1.9e-162
WP_106912499.1|1003544_1005959_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001154434.1|1006112_1006301_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|1006311_1006545_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_058344351.1|1006908_1007718_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_137491347.1|1007737_1008400_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_000961024.1|1008409_1009258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106912500.1|1009295_1010330_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.9	1.1e-172
WP_001098431.1|1010329_1012096_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_069934637.1|1012238_1013072_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	86.6	9.7e-124
WP_000742511.1|1013088_1014147_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_034167056.1|1014150_1014801_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.9e-111
WP_000673523.1|1014896_1015361_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000868175.1|1015360_1015564_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|1015567_1015783_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_085959187.1|1015802_1016276_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_069934636.1|1016277_1016655_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	8.8e-16
WP_001513113.1|1016651_1017080_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	6.4e-47
WP_001039939.1|1017175_1017607_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
WP_106912501.1|1017599_1018046_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	87.9	3.9e-63
WP_000993775.1|1018114_1018693_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000177590.1|1018689_1019049_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000268280.1|1019035_1019944_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	7.8e-143
WP_096262219.1|1019936_1020542_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.6e-110
WP_010723096.1|1022657_1023071_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000905033.1|1023479_1024046_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_000046133.1|1024188_1025361_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	1.3e-203
WP_001207660.1|1025370_1025886_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|1025940_1026243_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|1026257_1026377_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_106912502.1|1026369_1029447_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.3	0.0e+00
WP_000980400.1|1029443_1029929_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_001011792.1|1029925_1031026_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	7.6e-177
WP_000980502.1|1031094_1031313_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	76.4	2.2e-27
WP_000391796.1|1031339_1031822_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	4.6e-17
WP_000162574.1|1032522_1033005_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1031946:1031990	attR	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000600190.1|1033136_1033613_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|1033602_1033893_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1033954_1034296_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|1034444_1036106_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|1036191_1037070_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|1037192_1037786_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_077221315.1|1037840_1039127_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|1039147_1039939_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1040105_1041467_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1041603_1041852_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1041870_1042419_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1042449_1043217_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1043258_1043606_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|1043682_1044165_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969042.1|1044180_1045407_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|1045396_1045915_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|1046064_1046430_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168054.1|1046639_1047710_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000225201.1|1047720_1048842_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200120.1|1048884_1050045_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|1050143_1050191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|1050294_1050636_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1050906_1051644_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079112.1|1051778_1052759_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040128.1|1052755_1053487_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|1053616_1056190_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841103.1|1062056_1063355_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|1063351_1063675_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949252.1|1063720_1065076_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_044059731.1|1065189_1067850_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001307345.1|1067881_1068580_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1068648_1069068_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|1069274_1070312_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP027462	Escherichia coli isolate 07-4299 chromosome, complete genome	4847172	1536228	1545669	4847172		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569313.1|1536228_1537155_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.3	3.1e-22
WP_000783120.1|1537159_1537891_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1537871_1537979_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1538038_1538770_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1538991_1540677_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1540673_1541393_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1541439_1541910_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1541949_1542411_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001296829.1|1542535_1544536_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_000040703.1|1544532_1545669_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	3.6e-161
>prophage 4
NZ_CP027462	Escherichia coli isolate 07-4299 chromosome, complete genome	4847172	2119324	2177713	4847172	head,lysis,portal,capsid,tail,integrase	Enterobacteria_phage(36.54%)	74	2114613:2114628	2147068:2147083
2114613:2114628	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000041554.1|2119324_2121751_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
WP_001307224.1|2121949_2122255_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2122362_2123073_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2123075_2123636_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2123670_2124012_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2124146_2124473_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2124678_2125893_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836057.1|2125904_2126924_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_001389342.1|2126981_2127110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876986.1|2127111_2128392_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_001296941.1|2128426_2128663_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_021511903.1|2128750_2131222_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083280.1|2131315_2131507_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2131503_2131692_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2132091_2132256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171925.1|2132259_2132478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379578.1|2132637_2132793_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_000381212.1|2132961_2133369_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000921596.1|2133449_2133677_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705355.1|2133660_2134182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054509.1|2134162_2135128_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	5.0e-55
WP_001151262.1|2135168_2135591_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_001374839.1|2135587_2135944_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	71.4	4.8e-40
WP_000955176.1|2137250_2137433_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	1.7e-12
WP_001317460.1|2139388_2139721_-	protein flxA	NA	NA	NA	NA	NA
WP_001326990.1|2139923_2140229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2140253_2140493_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2140492_2140780_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2140851_2141007_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2141223_2141475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2141541_2141820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|2141821_2142871_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_001047135.1|2142884_2143637_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2143914_2144004_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2144058_2144271_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2144571_2144787_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2145540_2145756_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189915.1|2145760_2146072_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2146068_2146602_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2146598_2147096_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2147068:2147083	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000066495.1|2147458_2147671_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2147681_2147870_+	cold-shock protein	NA	NA	NA	NA	NA
WP_122134696.1|2147872_2147938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|2148017_2148173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2148344_2148518_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2148669_2149080_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2149137_2149371_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453611.1|2149759_2150305_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_000198149.1|2152201_2152408_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_046464165.1|2152404_2154006_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.9e-309
WP_000123309.1|2153986_2155306_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	7.4e-235
WP_001338090.1|2155315_2155648_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_021514934.1|2155703_2156729_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	3.4e-187
WP_106912512.1|2156770_2157166_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	2.8e-57
WP_000785282.1|2157177_2157531_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_106912513.1|2157542_2158121_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	6.6e-79
WP_000683105.1|2158117_2158513_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001547245.1|2158520_2159261_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	1.7e-127
WP_001468358.1|2159276_2159699_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.9	2.8e-71
WP_000459457.1|2159680_2160115_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_106912514.1|2160107_2162687_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	95.0	0.0e+00
WP_000847331.1|2162683_2163013_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152624.1|2163012_2163711_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	5.6e-133
WP_000194780.1|2163716_2164460_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_122999725.1|2164396_2165029_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.6	1.9e-95
WP_106912515.1|2165089_2168587_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	98.0	0.0e+00
WP_001233090.1|2168657_2169257_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_024190505.1|2169321_2172282_+	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
WP_000885616.1|2172281_2172857_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086514.1|2172954_2173545_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000836768.1|2173861_2174095_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2174163_2174277_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2174880_2176164_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527751.1|2176252_2177713_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
>prophage 5
NZ_CP027462	Escherichia coli isolate 07-4299 chromosome, complete genome	4847172	2472854	2538940	4847172	head,portal,terminase,capsid,tail,holin,integrase,protease	Escherichia_phage(28.57%)	74	2486633:2486660	2539092:2539119
WP_000422045.1|2472854_2473904_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559281.1|2474123_2474882_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_001278906.1|2474878_2475469_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2475508_2476381_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|2476481_2477102_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|2477098_2477980_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2478117_2478162_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194600.1|2478253_2479816_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|2479815_2481411_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|2481414_2482773_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|2482784_2483978_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443056.1|2483977_2484784_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2485164_2485344_+	general stress protein	NA	NA	NA	NA	NA
WP_001056490.1|2485429_2485930_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|2485975_2486482_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2486633:2486660	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_001049902.1|2488089_2488761_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	83.9	2.5e-106
WP_106912520.1|2488829_2490017_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	97.3	8.8e-54
WP_001270059.1|2490167_2490791_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	9.0e-66
WP_106912521.1|2490859_2494555_-	DUF1983 domain-containing protein	NA	Q6H9T2	Enterobacteria_phage	84.0	0.0e+00
WP_072121435.1|2495470_2496103_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.5	4.3e-100
WP_044808579.1|2496048_2496792_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.0	5.9e-149
WP_001365876.1|2496802_2497501_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.4e-131
WP_000343411.1|2497500_2497842_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.3	6.9e-52
WP_106912522.1|2497834_2501077_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	87.8	0.0e+00
WP_122993267.1|2501124_2501334_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_000710934.1|2501429_2501804_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	7.8e-65
WP_001275432.1|2501818_2502535_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	6.2e-127
WP_000133388.1|2502600_2502945_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2502941_2503388_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2503384_2503735_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125970.1|2503744_2504071_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	99.1	2.0e-53
WP_106912523.1|2504067_2506653_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	96.3	0.0e+00
WP_001063099.1|2506598_2506820_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172990.1|2506864_2508802_-|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_106879091.1|2508865_2510527_-|terminase	terminase large subunit	terminase	Q6H9U9	Enterobacteria_phage	99.5	0.0e+00
WP_000958387.1|2510523_2511087_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000829192.1|2511376_2511742_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|2511783_2511984_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|2512115_2512442_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000735655.1|2512786_2513011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071974579.1|2513075_2513282_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	63.2	4.6e-11
WP_000788411.1|2513650_2513797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106888538.1|2513989_2514523_-	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	8.1e-100
WP_096096241.1|2514527_2514743_-|holin	holin	holin	G9L6J5	Escherichia_phage	98.6	5.9e-33
WP_096096240.1|2514820_2515066_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	98.8	1.5e-16
WP_062855780.1|2515106_2515286_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	93.2	1.2e-23
WP_099528372.1|2515420_2517385_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	79.4	1.2e-297
WP_096096235.1|2519249_2519975_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099528373.1|2520670_2521099_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_136807759.1|2521578_2522619_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	97.7	4.2e-201
WP_000917733.1|2522787_2522985_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_000342737.1|2523158_2523872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001064918.1|2524125_2524791_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.0	1.6e-60
WP_000904135.1|2524783_2525146_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	9.0e-34
WP_001365882.1|2525158_2526208_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	8.5e-109
WP_032347855.1|2526209_2526479_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	3.6e-11
WP_052327139.1|2526532_2526760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000042395.1|2527348_2527666_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000882662.1|2527768_2527981_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000211993.1|2528195_2528747_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000215512.1|2529098_2529284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097338867.1|2529343_2530105_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.3	3.4e-75
WP_047083545.1|2530134_2530875_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	82.3	1.2e-112
WP_047083544.1|2530881_2531883_-	phage O protein family	NA	U5P0A0	Shigella_phage	61.2	3.9e-55
WP_000705131.1|2531863_2532385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476991.1|2532368_2532596_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003380.1|2532673_2533081_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	5.5e-24
WP_000380317.1|2533270_2533423_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001365839.1|2533434_2533803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|2534578_2534767_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092839.1|2534763_2534952_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_106912524.1|2535047_2537519_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	7.5e-55
WP_000113183.1|2537583_2537832_+	excisionase	NA	NA	NA	NA	NA
WP_000113693.1|2537809_2538940_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	4.0e-104
2539092:2539119	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 6
NZ_CP027462	Escherichia coli isolate 07-4299 chromosome, complete genome	4847172	2645742	2724482	4847172	head,lysis,portal,terminase,capsid,tRNA,tail,integrase,protease	Enterobacteria_phage(51.35%)	109	2723191:2723205	2724547:2724561
WP_039022689.1|2645742_2646327_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.3	2.8e-101
WP_088167353.1|2646326_2649242_-	hypothetical protein	NA	Q6H9S9	Enterobacteria_phage	99.1	5.0e-58
WP_039022769.1|2649306_2649906_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	3.3e-110
WP_039022770.1|2649972_2653371_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.4	0.0e+00
WP_000090891.1|2653431_2654064_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_039022771.1|2654000_2654744_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.7e-148
WP_001152612.1|2654748_2655447_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847332.1|2655446_2655776_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	5.6e-59
WP_039022772.1|2655772_2658334_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.4	0.0e+00
WP_039022773.1|2658326_2658761_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	3.4e-64
WP_000479153.1|2658742_2659165_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001349920.1|2659180_2659921_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683105.1|2659928_2660324_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_039022774.1|2660320_2660899_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	6.6e-79
WP_000753007.1|2660910_2661264_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_039022775.1|2661275_2661674_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.0e-63
WP_001435373.1|2661715_2662480_-	hypothetical protein	NA	C6ZCY2	Enterobacteria_phage	100.0	2.7e-141
WP_047083550.1|2662633_2663569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096936673.1|2664213_2664495_-	hypothetical protein	NA	K7PM54	Enterobacteria_phage	69.2	3.6e-06
WP_001178671.1|2664494_2664878_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000190773.1|2664889_2665231_-|head	head decoration protein	head	NA	NA	NA	NA
WP_032257180.1|2665240_2666281_-|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.4	2.0e-65
WP_032348758.1|2666498_2666948_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000125506.1|2666944_2667190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000817024.1|2667477_2669298_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.6	4.9e-128
WP_000790824.1|2669294_2669582_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000999172.1|2669585_2669810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001560453.1|2669802_2670168_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001560452.1|2670304_2670499_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001560451.1|2670531_2671215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001560450.1|2671241_2671463_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000896725.1|2671464_2672700_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	44.9	1.1e-99
WP_106121334.1|2672832_2673102_-|capsid	capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	1.2e-38
WP_001297109.1|2673163_2673496_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_039022777.1|2673505_2674825_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.9	8.1e-234
WP_032315153.1|2674805_2676407_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	4.9e-310
WP_000198153.1|2676403_2676610_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_039022778.1|2676606_2678532_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453592.1|2678506_2679052_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.1e-94
WP_001415975.1|2679440_2679635_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000738423.1|2679994_2680288_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|2680378_2680561_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_039022779.1|2680777_2681275_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	2.7e-89
WP_000839596.1|2681274_2681490_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737283.1|2682078_2683176_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_001204780.1|2683364_2683748_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000971055.1|2683833_2683974_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|2683970_2684333_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774484.1|2684329_2684620_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	4.3e-47
WP_000224916.1|2684612_2684783_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_001054342.1|2684782_2685238_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
WP_001303586.1|2685234_2685336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|2685452_2686250_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001445652.1|2686259_2686811_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|2687275_2688802_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001299444.1|2688859_2689009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070442.1|2689056_2689389_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145903.1|2689456_2689759_-	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	94.6	4.4e-42
WP_000788890.1|2689755_2690457_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.4	7.9e-127
WP_001361484.1|2690453_2691383_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	4.0e-110
WP_001182871.1|2691469_2692009_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.5e-61
WP_000184665.1|2692039_2692267_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_000712397.1|2692377_2693070_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.3	1.5e-109
WP_001221207.1|2693150_2693612_+	hypothetical protein	NA	G9L674	Escherichia_phage	98.7	1.1e-76
WP_000957425.1|2693605_2694652_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	96.8	4.4e-198
WP_000233576.1|2695295_2695502_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_039022786.1|2695577_2695874_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	2.3e-48
WP_106912526.1|2695879_2696665_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.2	1.0e-146
WP_039022788.1|2696661_2697342_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.1	3.0e-131
WP_039022789.1|2697338_2697521_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	96.7	2.4e-27
WP_000548513.1|2697493_2697685_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	95.2	4.0e-25
WP_001386642.1|2697695_2697977_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763387.1|2698075_2698294_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	1.7e-35
WP_000488406.1|2698341_2698581_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|2698720_2698957_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|2698946_2700089_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|2700202_2701453_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248691.1|2701624_2702278_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476089.1|2702287_2702749_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|2702802_2703909_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_044060540.1|2703944_2704586_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|2704589_2705960_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|2706127_2706799_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2706798_2708259_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133415.1|2708923_2709205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127881.1|2709218_2710880_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	2.0e-277
WP_000089568.1|2710863_2711220_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	80.5	2.1e-51
WP_001145905.1|2711509_2711950_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_106912527.1|2711949_2712246_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	63.3	2.0e-31
WP_096843438.1|2712242_2712581_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.1e-30
WP_001398592.1|2712577_2713753_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	4.8e-185
WP_000504056.1|2713790_2714363_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_001137341.1|2714402_2715560_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.1e-137
WP_106912528.1|2715847_2716120_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126675.1|2716130_2716541_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_086257674.1|2716550_2716856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106912560.1|2716852_2717104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033806701.1|2717306_2718704_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.0	2.0e-113
WP_000770163.1|2718700_2719000_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001204993.1|2719005_2719239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001373432.1|2719231_2719465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032308185.1|2719457_2719697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609225.1|2719686_2719899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442352.1|2719891_2720449_-	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	45.5	9.0e-17
WP_106912529.1|2720642_2720822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000103621.1|2722005_2722185_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.5e-10
WP_000182306.1|2722242_2722446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000953271.1|2722689_2722878_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
2723191:2723205	attL	TTGTTTCACGTTGTA	NA	NA	NA	NA
WP_032317082.1|2723252_2724482_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	3.4e-133
WP_032317082.1|2723252_2724482_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	3.4e-133
2724547:2724561	attR	TACAACGTGAAACAA	NA	NA	NA	NA
>prophage 7
NZ_CP027462	Escherichia coli isolate 07-4299 chromosome, complete genome	4847172	3637938	3657672	4847172	plate,transposase	uncultured_Caudovirales_phage(50.0%)	15	NA	NA
WP_106912541.1|3637938_3639039_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_033882877.1|3639038_3640175_-|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
WP_000786991.1|3640512_3640770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106912542.1|3640771_3645265_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.5	6.2e-23
WP_106912543.1|3645340_3647482_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	3.1e-25
WP_001142958.1|3647691_3648210_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037391.1|3648906_3649407_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3649441_3649666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056975.1|3649716_3651192_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611738.1|3651198_3651612_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393857.1|3651615_3653466_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3653429_3654512_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113713.1|3654536_3655817_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3655813_3656338_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246444.1|3656340_3657672_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_CP027462	Escherichia coli isolate 07-4299 chromosome, complete genome	4847172	4226662	4310102	4847172	head,lysis,transposase,portal,terminase,capsid,tRNA,tail,holin,integrase	Escherichia_phage(42.86%)	88	4229814:4229830	4313802:4313818
WP_000399679.1|4226662_4227643_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000835799.1|4227908_4229222_-	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_000662608.1|4229563_4230160_-	heme lyase NrfEFG subunit NrfG	NA	NA	NA	NA	NA
4229814:4229830	attL	ACCGTCGCCAGCGCCGC	NA	NA	NA	NA
WP_001032546.1|4230156_4230540_-	heme lyase NrfEFG subunit NrfF	NA	NA	NA	NA	NA
WP_000195171.1|4232269_4233226_-	cytochrome c nitrite reductase subunit NrfD	NA	NA	NA	NA	NA
WP_000220281.1|4233222_4233894_-	cytochrome c nitrite reductase Fe-S protein	NA	NA	NA	NA	NA
WP_001295391.1|4233890_4234457_-	cytochrome c nitrite reductase pentaheme subunit	NA	NA	NA	NA	NA
WP_000196875.1|4234501_4235938_-	ammonia-forming nitrite reductase cytochrome c552 subunit	NA	NA	NA	NA	NA
WP_000078239.1|4236329_4238288_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
WP_001014565.1|4238487_4238802_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_000832573.1|4238798_4240448_+	cation/acetate symporter ActP	NA	NA	NA	NA	NA
WP_001270143.1|4240625_4241918_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000402207.1|4242071_4243721_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_000106879.1|4243871_4245221_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	2.3e-159
WP_000412428.1|4245766_4246231_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_000019358.1|4246316_4246640_+	superoxide response transcriptional regulator SoxS	NA	NA	NA	NA	NA
WP_000019539.1|4246642_4248229_-	c-di-GMP phosphodiesterase PdeC	NA	NA	NA	NA	NA
WP_001295689.1|4248658_4248940_+	membrane protein	NA	NA	NA	NA	NA
WP_000168305.1|4249038_4249575_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|4249828_4252651_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000155657.1|4252685_4253042_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000270375.1|4253045_4253462_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_001226928.1|4253572_4254286_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_000275035.1|4254939_4255191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000486996.1|4255412_4256606_-	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_001147328.1|4256858_4257938_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|4257990_4259406_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_000235522.1|4259488_4260472_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891389.1|4260637_4260880_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543828.1|4261013_4262051_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332263.1|4262139_4263237_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	5.0e-213
WP_001217556.1|4263298_4263547_+	DinI family protein	NA	S5MQI1	Escherichia_phage	98.8	1.8e-38
WP_033802776.1|4263817_4264489_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	84.3	5.1e-107
WP_044687098.1|4264557_4265745_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	99.1	6.1e-55
WP_000078855.1|4265889_4266030_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	93.5	8.5e-17
WP_033802778.1|4266228_4269915_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	87.8	0.0e+00
WP_136868121.1|4270850_4271483_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	84.3	6.1e-94
WP_033802780.1|4271428_4272172_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	96.8	7.3e-147
WP_001499019.1|4272182_4272881_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.7	2.1e-132
WP_000847279.1|4272880_4273210_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	100.0	5.6e-59
WP_106912548.1|4273206_4275780_-|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	86.0	0.0e+00
WP_000533402.1|4275760_4276174_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479116.1|4276200_4276632_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000235046.1|4276645_4277398_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.0e-132
WP_000683079.1|4277405_4277801_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_024213759.1|4277797_4278373_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	9.8e-51
WP_001204554.1|4278388_4278742_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201501.1|4278734_4279118_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522591.1|4279169_4280198_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256823.1|4280255_4280603_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253979.1|4280639_4282145_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_024174188.1|4282134_4283727_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.5	1.5e-186
WP_000259002.1|4283723_4283930_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_106912549.1|4283913_4285842_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_106912550.1|4285813_4286323_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	2.1e-12
WP_001109015.1|4286999_4287542_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	100.0	1.1e-99
WP_032209690.1|4287744_4288182_-|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	97.9	4.7e-69
WP_032209664.1|4288184_4288334_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	81.6	2.1e-13
WP_032209662.1|4288333_4288900_-	antirepressor	NA	A0A0H4IQ87	Shigella_phage	97.9	1.7e-103
WP_032209661.1|4289173_4289707_-	lysozyme	NA	A0A088CC28	Shigella_phage	99.4	1.3e-102
WP_000284506.1|4289711_4289927_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_106912551.1|4290421_4292386_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	78.6	3.8e-296
WP_047083933.1|4292629_4292953_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	97.2	1.9e-59
WP_000738072.1|4293250_4293520_-	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_001365678.1|4293531_4294491_-	Shiga toxin Stx2a subunit A	NA	A0A0P0ZDQ7	Stx2-converting_phage	99.7	3.6e-175
WP_000483494.1|4294873_4295932_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.4	1.4e-207
WP_000917735.1|4296082_4296280_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_001204806.1|4296495_4296876_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_106912552.1|4296893_4297883_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	7.3e-195
WP_001061438.1|4297890_4298700_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_000767113.1|4298719_4299109_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210156.1|4299105_4299432_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	99.1	1.2e-53
WP_052904510.1|4299428_4300082_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	1.6e-126
WP_000061523.1|4300572_4301391_-	helix-turn-helix domain-containing protein	NA	S5MC07	Escherichia_phage	99.3	1.7e-120
WP_000620696.1|4301387_4301612_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_106912553.1|4301608_4302772_-	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	80.6	1.2e-167
WP_106912554.1|4302768_4303320_-	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	98.4	1.4e-99
WP_001191680.1|4303312_4303573_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZCZ7	Stx2-converting_phage	98.8	3.5e-40
WP_001020631.1|4303670_4304363_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	95.7	1.4e-120
WP_000135680.1|4305064_4305427_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081316.1|4305492_4306317_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	2.3e-149
WP_000008232.1|4306444_4306981_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_001242725.1|4306971_4307334_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.4	3.4e-65
WP_000206746.1|4307333_4308143_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	61.4	9.5e-76
WP_001061343.1|4308142_4308715_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	96.8	3.7e-106
WP_001093911.1|4308751_4309024_+	hypothetical protein	NA	S5MQM5	Escherichia_phage	100.0	7.2e-44
WP_000089360.1|4309057_4309606_-	hypothetical protein	NA	S5M7T3	Escherichia_phage	93.4	1.1e-83
WP_000287252.1|4309628_4310102_-	SocA family protein	NA	K4NZT7	Burkholderia_phage	31.8	2.4e-18
4313802:4313818	attR	ACCGTCGCCAGCGCCGC	NA	NA	NA	NA
>prophage 9
NZ_CP027462	Escherichia coli isolate 07-4299 chromosome, complete genome	4847172	4750764	4757581	4847172		Enterobacteria_phage(100.0%)	9	NA	NA
WP_106912559.1|4750764_4753098_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
WP_000856729.1|4753112_4753433_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459302.1|4753568_4754024_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244665.1|4754016_4754304_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000980221.1|4754296_4754887_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	89.6	1.2e-59
WP_001149160.1|4754883_4755150_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283007.1|4755703_4756438_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_000638635.1|4756434_4756935_+	transactivation protein	NA	NA	NA	NA	NA
WP_001406846.1|4757008_4757581_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	95.7	5.5e-94
>prophage 1
NZ_CP027463	Escherichia coli isolate 07-4299 plasmid unnamed	125059	8264	14051	125059	integrase	Cronobacter_phage(33.33%)	9	7369:7383	16874:16888
7369:7383	attL	ATTCGCTTTTTCCAC	NA	NA	NA	NA
WP_000618110.1|8264_8513_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_106912564.1|8509_8947_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.6	1.9e-25
WP_097418954.1|8946_9939_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	59.8	1.2e-101
WP_097452909.1|9968_10220_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	58.8	3.0e-20
WP_001278818.1|10221_10638_-	recombinase	NA	NA	NA	NA	NA
WP_106912565.1|10630_11611_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.1	3.8e-79
WP_000030199.1|12024_12333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144036.1|12419_13064_-	ParA family protein	NA	NA	NA	NA	NA
WP_040116953.1|13244_14051_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	4.1e-55
16874:16888	attR	ATTCGCTTTTTCCAC	NA	NA	NA	NA
