The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027464	Escherichia coli strain 2013C-4248 chromosome, complete genome	5243827	115821	197660	5243827	tRNA,tail,capsid,holin,terminase,integrase,plate,head,portal,lysis	Escherichia_phage(51.11%)	87	162767:162813	194872:194918
WP_000932342.1|115821_116295_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_000586973.1|116480_117671_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_000636500.1|117667_118444_-	dual role activator/repressor for lldPRD operon	NA	NA	NA	NA	NA
WP_001295233.1|118443_120099_-	L-lactate permease	NA	NA	NA	NA	NA
WP_001033224.1|120466_125317_-	adhesin	NA	NA	NA	NA	NA
WP_024199749.1|125360_125942_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_071524600.1|126409_126502_+	IS1 encoded protein	NA	NA	NA	NA	NA
WP_000665680.1|126587_126950_-	DUF2810 domain-containing protein	NA	NA	NA	NA	NA
WP_000517100.1|127234_127444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000228271.1|127455_128043_-	MltR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000645405.1|128042_129191_-	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000093258.1|129285_131199_-	PTS mannitol transporter subunit IICBA	NA	NA	NA	NA	NA
WP_000479624.1|131735_132098_+	DUF3302 domain-containing protein	NA	NA	NA	NA	NA
WP_000364943.1|132100_133237_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000763808.1|133696_134134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333501.1|134500_134674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000642489.1|134840_135302_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000072858.1|136299_137142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001271686.1|137246_137630_-	protein YhhH	NA	NA	NA	NA	NA
WP_000015018.1|137601_141771_-	RHS repeat family protein	NA	NA	NA	NA	NA
WP_000710769.1|141930_142143_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001298972.1|142345_144544_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|144699_145725_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068833.1|145816_146776_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|146868_147399_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_001293343.1|147408_148740_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|148806_149733_+	prenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|149825_150311_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|150395_150641_-	cell division protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|151065_151911_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|151933_153442_+	glycerol kinase	NA	NA	NA	NA	NA
WP_001250644.1|153577_154588_+	fructose 1,6-bisphosphatase	NA	NA	NA	NA	NA
WP_000796320.1|154684_155431_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323556.1|155435_155864_-	universal stress protein D	NA	NA	NA	NA	NA
WP_000655986.1|155890_156190_-	DUF406 family protein	NA	NA	NA	NA	NA
WP_000155254.1|156401_156842_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802226.1|156942_157542_+	DUF1454 domain-containing protein	NA	NA	NA	NA	NA
WP_001216325.1|157649_158417_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708998.1|158471_159227_-	CDP-diacylglycerol pyrophosphatase	NA	NA	NA	NA	NA
WP_001045689.1|159333_160323_-	sulfate-binding protein	NA	NA	NA	NA	NA
WP_000591795.1|160642_161605_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|161785_162688_-	cation-efflux pump FieF	NA	NA	NA	NA	NA
162767:162813	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_096170421.1|162923_163178_-	transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	97.6	8.7e-44
WP_097743892.1|163223_164387_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	97.2	9.1e-205
WP_000978899.1|164386_164866_-|tail	tail assembly protein	tail	M1TAU1	Escherichia_phage	98.7	2.5e-84
WP_106959007.1|164880_167328_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.5	0.0e+00
WP_000785970.1|167320_167440_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_021547836.1|167472_167748_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.8e-40
WP_001251408.1|167804_168323_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286709.1|168335_169526_-|tail	tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_024226848.1|169585_170179_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	97.0	1.8e-103
WP_021547352.1|170783_171386_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.5e-97
WP_001106830.1|171357_171798_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	71.0	1.5e-54
WP_097476444.1|172990_173602_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.0	8.4e-117
WP_001121475.1|173594_174503_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	100.0	3.4e-162
WP_000127163.1|174507_174855_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_021547833.1|174851_175487_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	9.0e-114
WP_021547832.1|175570_176356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297845.1|176427_176880_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	5.3e-76
WP_000917158.1|176872_177340_-|tail	tail fiber protein	tail	A0A0F7LA33	Escherichia_phage	98.7	1.5e-81
WP_001300730.1|177302_177476_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_024226166.1|177447_177873_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	95.7	1.8e-65
WP_097760551.1|177860_178286_-	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	96.4	1.6e-58
WP_001144101.1|178300_178798_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|178797_179079_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|179082_179286_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|179285_179795_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_106959008.1|179894_180638_-|terminase	terminase	terminase	A0A0F7LBP7	Escherichia_phage	98.8	1.3e-124
WP_001248583.1|180641_181715_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	100.0	6.7e-202
WP_001085952.1|181773_182628_-|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_000156872.1|182801_184574_+|terminase	terminase	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_000038166.1|184573_185608_+|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.1	1.6e-200
WP_000351260.1|185981_187124_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	42.9	1.6e-73
WP_000373633.1|187125_187806_+	hypothetical protein	NA	A0A0R6PER3	Moraxella_phage	31.7	9.9e-18
WP_001697730.1|187835_188858_-	DNA (cytosine-5-)-methyltransferase	NA	A0A0R6PG08	Moraxella_phage	59.0	5.5e-113
WP_106959009.1|188944_191242_-	replication protein A	NA	Q858T4	Yersinia_virus	97.6	0.0e+00
WP_024226161.1|191231_191507_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	98.9	3.3e-44
WP_024226160.1|191503_191728_-	hypothetical protein	NA	A0A0F7LDG9	Escherichia_phage	97.3	8.5e-35
WP_001747926.1|191727_192030_-	hypothetical protein	NA	A0A0F7LCL4	Escherichia_phage	95.0	2.1e-44
WP_024226159.1|192029_192254_-	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	98.6	8.0e-33
WP_000217671.1|192317_192818_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
WP_000453534.1|192987_193260_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_001192857.1|193412_193706_+	transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000023385.1|193775_194756_+|integrase	integrase	integrase	U5N0A8	Enterobacteria_phage	99.7	2.3e-185
WP_001223800.1|194941_195442_-	periplasmic protein CpxP	NA	NA	NA	NA	NA
194872:194918	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033722.1|195591_196290_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|196286_197660_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 2
NZ_CP027464	Escherichia coli strain 2013C-4248 chromosome, complete genome	5243827	682250	691336	5243827	transposase,integrase	Stx2-converting_phage(42.86%)	9	683136:683158	691451:691473
WP_001272558.1|682250_683006_+	lipoprotein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
683136:683158	attL	TTCGATTCCCTTCGCCCGCTCCA	NA	NA	NA	NA
WP_000935132.1|683292_684918_+|integrase	integrase	integrase	A0A059XK29	uncultured_phage	28.1	1.3e-10
WP_000290524.1|684918_685548_+	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	37.5	2.2e-35
WP_001339397.1|686206_686884_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|686883_687231_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_047086028.1|687250_688822_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	7.6e-170
WP_000066189.1|688865_689429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085954674.1|689533_689851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099561174.1|690122_691336_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.6	2.5e-168
691451:691473	attR	TTCGATTCCCTTCGCCCGCTCCA	NA	NA	NA	NA
>prophage 3
NZ_CP027464	Escherichia coli strain 2013C-4248 chromosome, complete genome	5243827	865327	872467	5243827		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|865327_865966_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590407.1|865962_867225_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	1.4e-134
WP_000847985.1|867221_868130_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|868325_869093_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|869143_869800_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272924.1|869905_872467_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 4
NZ_CP027464	Escherichia coli strain 2013C-4248 chromosome, complete genome	5243827	1459144	1468586	5243827		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569329.1|1459144_1460071_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1460075_1460807_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
WP_001216961.1|1460787_1460895_-	membrane protein	NA	NA	NA	NA	NA
WP_001240402.1|1460954_1461686_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1461907_1463593_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1463589_1464309_+	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_001295430.1|1464355_1464826_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1464866_1465328_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_106959028.1|1465452_1467453_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_106959029.1|1467449_1468586_-	hypothetical protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 5
NZ_CP027464	Escherichia coli strain 2013C-4248 chromosome, complete genome	5243827	1597264	1638850	5243827	transposase,coat,integrase,terminase,holin,portal,lysis	Enterobacteria_phage(37.7%)	64	1591477:1591491	1616949:1616963
1591477:1591491	attL	TTTGTAATGAACTGG	NA	NA	NA	NA
WP_106959037.1|1597264_1598443_+|integrase	integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	99.5	2.0e-231
WP_000132739.1|1598423_1598615_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281200.1|1598694_1599039_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	99.1	5.9e-59
WP_106959038.1|1599066_1599234_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	94.5	4.1e-26
WP_106959156.1|1599166_1599412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001336413.1|1599452_1599605_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	73.7	5.1e-07
WP_001336414.1|1599582_1599867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106959039.1|1599951_1600581_-	molecular chaperone DnaJ	NA	G9L6G3	Escherichia_phage	67.6	1.1e-42
WP_033555665.1|1600577_1600943_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	98.3	9.6e-68
WP_000034211.1|1600944_1601352_-	hypothetical protein	NA	A0A125RPT9	Escherichia_phage	98.5	5.7e-69
WP_000071294.1|1601338_1601593_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	96.4	1.1e-38
WP_001214441.1|1601589_1601757_-	DUF2737 domain-containing protein	NA	K7PJV9	Enterobacteria_phage	98.2	6.6e-24
WP_001111280.1|1601767_1602064_-	hypothetical protein	NA	A0A220NRR0	Escherichia_phage	100.0	2.3e-51
WP_016248935.1|1602080_1602629_-	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	99.5	3.3e-104
WP_106959040.1|1602637_1603117_-	hypothetical protein	NA	Q716E9	Shigella_phage	98.7	8.6e-93
WP_106959041.1|1603126_1603600_-	single-stranded DNA-binding protein	NA	Q716E8	Shigella_phage	98.7	6.2e-59
WP_000365280.1|1603600_1604308_-	recombinase	NA	K7PKU3	Enterobacteria_phage	100.0	7.6e-138
WP_001308813.1|1604562_1604838_-	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	100.0	1.6e-46
WP_106959042.1|1604957_1605581_-	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	97.6	1.9e-108
WP_000213975.1|1605617_1605818_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_016242502.1|1606065_1606428_-	hypothetical protein	NA	K7PHE0	Enterobacteria_phage	99.2	1.2e-57
WP_089624158.1|1606430_1606703_-	hypothetical protein	NA	K7PH69	Enterobacterial_phage	94.4	2.6e-25
WP_042019209.1|1607016_1607667_-	LexA family transcriptional repressor	NA	A5VW98	Enterobacteria_phage	99.5	1.1e-122
WP_000276886.1|1607747_1607933_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000251074.1|1608041_1608338_+	hypothetical protein	NA	A5VW96	Enterobacteria_phage	96.9	2.1e-44
WP_033810823.1|1608696_1609584_+	replication protein	NA	A5VW95	Enterobacteria_phage	99.3	3.1e-144
WP_106959043.1|1609580_1610957_+	replicative DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	99.1	2.4e-252
WP_000158285.1|1610953_1611052_+	hypothetical protein	NA	Q9MCP6	Enterobacteria_phage	100.0	7.5e-12
WP_000381912.1|1611038_1611251_+	hypothetical protein	NA	A0A1V0E5J7	Salmonella_phage	100.0	2.8e-35
WP_096983900.1|1611213_1611672_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	99.3	1.8e-79
WP_021560253.1|1611668_1612259_+	hypothetical protein	NA	A0A193GYV6	Enterobacter_phage	75.5	3.7e-85
WP_000113772.1|1612394_1612571_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_000386657.1|1612573_1612933_+	DUF2591 domain-containing protein	NA	G8EYI2	Enterobacteria_phage	95.8	1.2e-62
WP_021552627.1|1612932_1613109_+	protein ninF	NA	A0A088CPS6	Enterobacteria_phage	98.3	1.1e-26
WP_001108062.1|1613101_1613713_+	recombination protein NinG	NA	K7PHM2	Enterobacterial_phage	98.0	2.1e-99
WP_000144614.1|1613709_1613916_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_064236794.1|1613893_1614565_+	serine/threonine protein phosphatase	NA	K7P721	Enterobacteria_phage	99.1	3.9e-131
WP_000512811.1|1614555_1615074_+	DUF1133 domain-containing protein	NA	Q716B8	Shigella_phage	99.4	2.0e-95
WP_015966862.1|1615582_1615906_+|holin	phage holin, lambda family	holin	K7PH31	Enterobacteria_phage	100.0	2.2e-52
WP_000229392.1|1615889_1616366_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_004031412.1|1616362_1616800_+|lysis	lysis protein	lysis	Q716B4	Shigella_phage	98.6	5.0e-71
WP_001543881.1|1616787_1616940_+	hypothetical protein	NA	C6ZR68	Salmonella_phage	100.0	1.2e-21
WP_000807788.1|1617247_1617490_+	DUF2560 domain-containing protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
1616949:1616963	attR	CCAGTTCATTACAAA	NA	NA	NA	NA
WP_001543880.1|1617492_1617930_+	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	96.1	4.1e-65
WP_106959044.1|1617929_1619390_+|terminase	terminase	terminase	W6MW26	Pseudomonas_phage	76.2	8.2e-219
WP_106959045.1|1619389_1621558_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	98.1	0.0e+00
WP_000373006.1|1621571_1622483_+	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	100.0	1.3e-161
WP_001196946.1|1622482_1623778_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	99.3	9.4e-243
WP_001595516.1|1623822_1624047_+	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	69.3	4.0e-24
WP_001054838.1|1624024_1624525_+	DNA recombination protein RmuC	NA	G8EYJ2	Enterobacteria_phage	99.4	5.0e-91
WP_089074837.1|1624524_1625943_+	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	99.4	4.6e-275
WP_106959046.1|1625942_1626791_+	hypothetical protein	NA	Q716G6	Shigella_phage	98.6	2.1e-102
WP_000614031.1|1626790_1627246_+	hypothetical protein	NA	A5VW67	Enterobacteria_phage	98.7	1.5e-86
WP_000964882.1|1627248_1627941_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_085947970.1|1628221_1629435_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_106959047.1|1629488_1630670_+	acyltransferase	NA	I6RSG0	Salmonella_phage	56.1	4.4e-106
WP_106959048.1|1630669_1632514_+	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	71.9	4.5e-238
WP_016231948.1|1632527_1633013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000757525.1|1633047_1633413_+	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	99.2	8.1e-67
WP_001085430.1|1633426_1633606_-	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
WP_000090240.1|1633705_1633957_-	Arc family DNA-binding protein	NA	B9UDL4	Salmonella_phage	98.8	4.9e-39
WP_000677939.1|1634047_1634209_+	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	98.1	2.7e-22
WP_106959049.1|1634277_1635213_+	phage antirepressor Ant	NA	A0A2H4FRZ6	Salmonella_phage	96.5	3.3e-173
WP_106959050.1|1637725_1638850_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	30.4	1.0e-22
>prophage 6
NZ_CP027464	Escherichia coli strain 2013C-4248 chromosome, complete genome	5243827	1657748	1746063	5243827	transposase,tail,capsid,integrase,terminase,holin,head,portal,lysis	Enterobacteria_phage(37.04%)	93	1672516:1672575	1705923:1707232
WP_106881417.1|1657748_1659284_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.1	3.8e-259
WP_001331140.1|1659554_1659770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001311912.1|1660242_1660860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001313064.1|1660938_1661217_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000266732.1|1661251_1661554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071527823.1|1661521_1661845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297900.1|1662271_1662472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106959053.1|1662635_1663244_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001350686.1|1663497_1663905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012602024.1|1663805_1664303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000656352.1|1666617_1667652_-	phosphotriesterase	NA	NA	NA	NA	NA
WP_001066371.1|1668676_1669435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000667426.1|1669448_1670663_-	ribokinase RbsK	NA	NA	NA	NA	NA
WP_000555378.1|1671038_1672172_+|transposase	IS110-like element ISEc45 family transposase	transposase	NA	NA	NA	NA
1672516:1672575	attL	TGAACCGCCCCGGTTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
WP_085947970.1|1672557_1673771_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001317168.1|1675202_1675343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000973159.1|1675476_1676022_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001297350.1|1676018_1676762_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193798.1|1676773_1677853_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001255275.1|1677917_1678850_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011461.1|1679306_1680224_+	nitrogen assimilation regulatory protein nac	NA	NA	NA	NA	NA
WP_001011007.1|1680325_1681276_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_106959054.1|1681549_1683037_+	FMN/FAD transporter	NA	NA	NA	NA	NA
WP_000532923.1|1683664_1684381_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|1684723_1686178_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378571.1|1686279_1687596_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000477878.1|1687910_1688963_+	lipopolysaccharide heptosyltransferase family protein	NA	NA	NA	NA	NA
WP_085947970.1|1695138_1696351_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001300307.1|1698101_1698899_-	protein MtfA	NA	NA	NA	NA	NA
WP_000533625.1|1699134_1700160_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.0e-103
WP_000096346.1|1700159_1700363_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000048403.1|1700421_1702893_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.2	1.7e-59
WP_001090200.1|1702985_1703177_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_000449192.1|1703173_1703362_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_012816799.1|1703623_1703884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133037.1|1703932_1704142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947970.1|1704726_1705939_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_078274368.1|1705914_1706094_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.5	1.0e-06
WP_001345283.1|1706105_1706258_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_072096949.1|1706550_1707075_-	LexA family transcriptional repressor	NA	H9C160	Pectobacterium_phage	28.0	1.7e-12
WP_000747951.1|1707280_1707523_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
1705923:1707232	attR	GATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAAACCGGGGCGGTTCATATTATCAGTGTCTTTTTTCGTTACCGATTCCAATTCAAGTTCGTTCAGACGATGACGAAGTGTGTGTGCTGCAATCTCCTGGATTGAAGGAGGTAAATCTTTAAATTCCATCGTCAACCTCATCAGTCGGAGTTTCTTGCTAACCAGCGATGCGCGCCAGCTTCGGTTTTAAACGTTTTACTTTTGGTATACGTCATCGCGGTAAACGTACCGTCCTGGTTGGGAAACACGCCACATACCAGAGATTCGCTGTTGCCAAGATCGATAGTATCCATGCTGACCTCATTTCCCCTTAACGCCGGGGTAGCGGAACAAAAACCTGCTGCATAGTTATTAAAGTTGAACCCTGCCGTCATGTTCTTACGCCTCGGGCTGGCTACTTAACCCCTGACCACTGCCTGGTAACTCGAAGTATTGCCCTGCATTCTGTGGGGTGGGGAGAGGGAATGAATGAAGTTTAGAAAAATGAACTTTTCAGGTCAATGTTTTTTTATCAAAACATTTTAAGCAGGCAGCTGTTAAGCCATCACCACGATGGCATACAGTTAATCAAATAGATGAGGTCGGTTAAATATCTTGTTGAATTTTAAAGCATACGCCCAATATGCAAGATAGATCATCCAGCATAATTGAAGGGTAGCGAGGATTCGTGGGGACTAAAAGAATATCCGGCCCTTCTATCTCCAGTTTACGAATGACAGGTGTTGTGGTCCCTTTGGGTAAGGCAAGGACAATATTTCCTGGTTGTACGGTTCGATTGGGATCAACAAAAACTGTTGAACCATTTGGGATGGAAACTCCCCCACCAGATGTTGACATACTGTCACTCTCTAGAACAACTGCAAAGGTATTGGCCGGGATTTCTCCGACAAGCTGCACACAAGAGGTTATTGAGGAATTTTTCATATAATCACTCCAGCTTGCTGCCTGCTGAAGTGATAGTAGCGGAACCGTTTTTATCGGCGGTAAAGATAGATCAAGCGAATCACCTGTATTTAACTCTCCTCCATTAAGAAGCCAATTTTCGTTTACTTTCAATATTTTTGCCAGTGAACTTATGTAACGCGAGGACGGCGCTCCTCCACCGTTTATCCATTGACTTACGGAGCCTTTTGATGCGCCAGTGGCATTGACAAGGTCTTTGCCTTTCAGGTTTAGCGCATGCATACGTTGGGTTATGCGTTCAGATATTGTTTGCTTGCTCATGTTTTGATTTTAAAACACAGATGGTTTTGTTTCTTGACTTTCT	NA	NA	NA	NA
WP_000693883.1|1707506_1707932_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262348.1|1708003_1709086_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000788760.1|1709092_1709839_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_000450617.1|1709860_1710577_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_042353845.1|1710609_1710891_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	72.5	3.9e-29
WP_000699809.1|1710887_1711115_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000034815.1|1711107_1711419_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000683609.1|1711546_1711765_+	hypothetical protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|1711766_1712324_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|1712557_1712770_+	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|1712889_1713234_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|1713355_1713628_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265228.1|1713629_1714679_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.5e-110
WP_001217447.1|1714691_1715051_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_000640035.1|1715059_1715614_+	late gene antiterminator protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|1715839_1716037_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|1716171_1716885_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001368722.1|1717335_1717767_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_001304197.1|1718068_1718197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106919090.1|1718245_1720096_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_024165672.1|1720388_1720604_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731192.1|1720608_1720953_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_000992157.1|1721003_1721537_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	95.5	3.1e-99
WP_076611052.1|1721659_1721875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001082682.1|1722026_1722494_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	88.3	7.2e-68
WP_001368686.1|1722576_1722717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303878.1|1722958_1723273_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|1723354_1723579_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000235436.1|1723973_1724483_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_012816790.1|1724454_1726383_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	5.5e-263
WP_000259008.1|1726366_1726573_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	1.8e-10
WP_000831765.1|1726569_1728162_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
WP_001253961.1|1728151_1729657_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.2	1.0e-99
WP_000256809.1|1729693_1730041_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000522615.1|1730098_1731127_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
WP_000012981.1|1731130_1731553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204554.1|1731545_1731899_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974986.1|1731914_1732448_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.2e-58
WP_000683079.1|1732444_1732840_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235112.1|1732847_1733600_+|tail	tail protein	tail	Q687F6	Enterobacteria_phage	98.0	4.6e-133
WP_000479108.1|1733613_1734045_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_000533411.1|1734071_1734485_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.2	5.1e-41
WP_106959055.1|1734465_1737045_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.2	0.0e+00
WP_000847304.1|1737041_1737371_+|tail	tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001357740.1|1737370_1738069_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_012816788.1|1738074_1738818_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	8.6e-148
WP_012816787.1|1738715_1739396_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	94.6	2.3e-115
WP_001303882.1|1739349_1739556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000649829.1|1739586_1740114_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_001435161.1|1743790_1744414_+	membrane protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.9e-68
WP_000279044.1|1744478_1745792_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.6	9.1e-76
WP_001023997.1|1745793_1746063_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	95.5	6.0e-43
>prophage 7
NZ_CP027464	Escherichia coli strain 2013C-4248 chromosome, complete genome	5243827	1803527	1837916	5243827	capsid,tail,holin,terminase,integrase,plate,portal	Enterobacteria_phage(92.31%)	48	1802462:1802521	1838023:1838146
1802462:1802521	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_000078920.1|1803527_1803668_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488107.1|1803857_1804118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132840.1|1804160_1805270_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	8.2e-195
WP_000005406.1|1805427_1806612_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	1.4e-224
WP_000290462.1|1806611_1807124_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651570.1|1807179_1807554_+	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	72.4	5.8e-36
WP_001443620.1|1807481_1807718_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	4.3e-21
WP_000853415.1|1807704_1810512_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	91.0	0.0e+00
WP_075329358.1|1810518_1811013_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.1e-85
WP_001368668.1|1811265_1811742_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000885642.1|1811785_1812364_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	87.4	5.5e-94
WP_000108490.1|1812363_1814634_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.7	1.3e-146
WP_000071720.1|1814636_1815167_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_001111953.1|1815159_1816056_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.0	1.6e-153
WP_000213447.1|1816059_1816410_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271910.1|1816406_1816988_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.6e-101
WP_000356339.1|1816984_1817620_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_000920586.1|1817612_1818080_-|tail	tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	4.5e-86
WP_000780544.1|1818217_1818625_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	96.3	3.2e-64
WP_000072346.1|1818621_1819014_-	M15 family peptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	1.4e-69
WP_000104350.1|1819010_1819334_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|1819336_1819537_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063094.1|1819536_1820031_-|capsid	phage capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	98.2	3.0e-88
WP_000632362.1|1820132_1820933_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.7	1.3e-130
WP_001055104.1|1820978_1822031_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_001262654.1|1822054_1822891_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	7.9e-150
WP_000613800.1|1823045_1824797_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
WP_000087812.1|1824796_1825843_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_071529708.1|1826213_1826483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000711113.1|1826373_1826904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211256.1|1827440_1827752_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	97.1	5.0e-49
WP_000686553.1|1827756_1828716_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	6.4e-180
WP_001288348.1|1828792_1831633_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.9	0.0e+00
WP_000564228.1|1831629_1832019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013471.1|1832109_1832322_-	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	91.4	8.9e-26
WP_000104293.1|1832644_1832944_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	4.0e-40
WP_000153700.1|1832940_1833207_-	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|1833203_1833407_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543032.1|1833430_1833841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000357028.1|1834044_1834287_-	hypothetical protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000159456.1|1834298_1834577_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000739029.1|1834587_1834938_-	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|1834959_1835163_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001308719.1|1835179_1835386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|1835461_1835866_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290349.1|1835881_1836532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865207.1|1836561_1836909_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|1836914_1837916_+|integrase	integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
1838023:1838146	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 8
NZ_CP027464	Escherichia coli strain 2013C-4248 chromosome, complete genome	5243827	1875668	1883767	5243827	transposase,tail	Enterobacteria_phage(57.14%)	11	NA	NA
WP_000019588.1|1875668_1876412_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252979.1|1876452_1876848_-	membrane protein	NA	NA	NA	NA	NA
WP_085948136.1|1877036_1878249_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.8e-166
WP_106959059.1|1878917_1879187_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	96.6	7.1e-44
WP_001434996.1|1879297_1879870_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	52.8	7.0e-41
WP_072097366.1|1879948_1880584_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.3	1.1e-74
WP_001434995.1|1880711_1881770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144084.1|1881848_1882499_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	40.7	1.1e-37
WP_001132098.1|1882682_1883273_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_099561169.1|1883259_1883382_-	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
WP_001217551.1|1883518_1883767_-	DNA-damage-inducible protein DinI	NA	K7PLW4	Enterobacteria_phage	93.9	3.8e-36
>prophage 9
NZ_CP027464	Escherichia coli strain 2013C-4248 chromosome, complete genome	5243827	1910180	1951716	5243827	head,holin,terminase	Salmonella_phage(30.0%)	70	NA	NA
WP_000916763.1|1910180_1910411_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204700.1|1910549_1910924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000879280.1|1910927_1911800_+	copper resistance protein D	NA	NA	NA	NA	NA
WP_000976472.1|1911812_1912154_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_029397784.1|1912295_1912523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021572509.1|1912546_1913623_-	hypothetical protein	NA	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	2.4e-98
WP_001311878.1|1913588_1913870_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001356607.1|1913976_1914165_-	DUF1187 domain-containing protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_071780718.1|1914157_1914352_-	restriction alleviation protein, Lar family	NA	A0A0U2QQP4	Escherichia_phage	96.9	2.2e-31
WP_001004419.1|1914415_1915468_-	enterohemolysin	NA	A0A0U2S5Y9	Escherichia_phage	63.0	7.2e-116
WP_021572510.1|1915479_1918626_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	82.5	0.0e+00
WP_106959060.1|1918725_1919001_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	91.2	6.3e-40
WP_001359121.1|1919075_1919246_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	92.9	7.9e-25
WP_000560226.1|1919245_1919467_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_021572511.1|1919867_1920158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005968.1|1920134_1920338_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	82.5	1.0e-10
WP_000379555.1|1920339_1920495_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	1.8e-07
WP_000410105.1|1920800_1921220_-	transcriptional regulator	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_001033914.1|1921316_1921559_+	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000702025.1|1921555_1921978_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	94.3	3.4e-69
WP_021572513.1|1922055_1922844_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.7	6.1e-43
WP_021572514.1|1922850_1923597_+	phage DNA replication protein	NA	V5UQI5	Shigella_phage	80.9	3.6e-114
WP_106959061.1|1923568_1924381_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	88.9	7.7e-118
WP_106959062.1|1924396_1924819_+	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	4.4e-64
WP_021527610.1|1924876_1925233_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.4e-58
WP_021529588.1|1925328_1925805_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	80.9	1.9e-15
WP_021529587.1|1925807_1926299_+	hypothetical protein	NA	G9L661	Escherichia_phage	92.6	1.3e-83
WP_100321708.1|1926273_1926510_+	hypothetical protein	NA	Q9XJH3	Enterobacteria_phage	96.0	1.1e-37
WP_106959063.1|1926506_1926887_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	77.0	5.9e-44
WP_033544646.1|1926888_1927152_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	1.1e-30
WP_077880917.1|1927162_1928062_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	54.8	2.4e-67
WP_096936176.1|1928068_1928269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000935258.1|1928458_1928671_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_077770060.1|1928645_1928834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049281514.1|1928907_1929159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106959064.1|1929230_1929830_+	hypothetical protein	NA	A0A0U2RT94	Escherichia_phage	91.0	9.4e-105
WP_000228038.1|1929829_1930120_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_087891274.1|1930116_1930659_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	73.4	9.2e-75
WP_106959065.1|1930635_1930815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001766841.1|1931143_1931479_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	98.2	3.3e-59
WP_047655280.1|1931482_1931959_+	lysozyme	NA	Q8SBE0	Shigella_phage	96.2	3.9e-85
WP_021572524.1|1931942_1932335_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	84.5	6.7e-51
WP_071780719.1|1932222_1932498_+	hypothetical protein	NA	S5FXQ4	Shigella_phage	71.8	2.1e-22
WP_024244259.1|1932478_1932664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021572526.1|1932721_1933471_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	75.6	2.6e-11
WP_000204763.1|1933436_1934840_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	3.2e-188
WP_000113490.1|1934839_1936306_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	6.7e-261
WP_106959066.1|1936196_1936931_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	88.0	1.0e-97
WP_106959067.1|1936945_1938166_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	89.3	4.0e-203
WP_001066733.1|1938169_1938676_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	80.5	9.8e-71
WP_001473318.1|1938687_1939629_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	1.4e-155
WP_106959068.1|1939671_1939893_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	7.7e-12
WP_106959069.1|1939858_1940266_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.1	1.8e-67
WP_106959070.1|1940262_1940817_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	71.7	1.0e-65
WP_001142484.1|1940803_1941193_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	1.1e-66
WP_089613941.1|1941167_1941731_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	4.4e-80
WP_106959071.1|1941734_1942880_+	hypothetical protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.0	2.1e-161
WP_000109249.1|1942890_1943331_+	DUF3277 domain-containing protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_000393961.1|1943334_1943787_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.0	1.8e-55
WP_023141050.1|1943798_1943975_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	70.0	1.6e-12
WP_106959072.1|1943964_1945971_+	lytic transglycosylase catalytic	NA	A0A0M4REK7	Salmonella_phage	77.7	1.0e-155
WP_000346976.1|1945970_1946621_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	65.3	1.8e-61
WP_021572533.1|1946624_1946927_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	55.0	2.6e-26
WP_021572534.1|1946929_1947964_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	52.2	1.6e-99
WP_106959073.1|1947960_1948296_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	54.4	1.3e-23
WP_000466689.1|1948435_1948675_+	DUF4282 domain-containing protein	NA	A0A077KGV8	Edwardsiella_phage	47.5	5.6e-08
WP_001738127.1|1948734_1949487_+	translation initiation factor IF-2	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	64.4	2.2e-90
WP_001270632.1|1949486_1949840_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	9.0e-55
WP_106959074.1|1949839_1951039_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	82.9	7.0e-184
WP_097468543.1|1951035_1951716_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	5.9e-103
>prophage 10
NZ_CP027464	Escherichia coli strain 2013C-4248 chromosome, complete genome	5243827	1955002	2058263	5243827	tRNA,transposase,tail,integrase,terminase,holin,protease,portal,lysis	Escherichia_phage(40.0%)	128	1946140:1946155	1986582:1986597
1946140:1946155	attL	AACACGCATTCAGGCG	NA	NA	NA	NA
WP_047085834.1|1955002_1956079_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	1.2e-97
WP_001443927.1|1956044_1956326_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001356607.1|1956432_1956621_-	DUF1187 domain-containing protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_042853000.1|1956613_1956808_-	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_000166317.1|1956864_1957674_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_000105102.1|1957666_1960318_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.7	0.0e+00
WP_001307773.1|1960416_1960692_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	3.0e-42
WP_001427414.1|1960765_1960936_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_000560218.1|1960935_1961157_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
WP_047085833.1|1961577_1961730_-	DUF1391 domain-containing protein	NA	NA	NA	NA	NA
WP_000753628.1|1961982_1962444_-	transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	100.0	3.4e-78
WP_047085832.1|1962551_1962827_+	transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	98.8	5.7e-41
WP_000702023.1|1962810_1963233_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_000899746.1|1963245_1964103_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788968.1|1964109_1964856_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_023442183.1|1964827_1965640_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	5.7e-121
WP_001151124.1|1965655_1966078_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.0e-64
WP_001266134.1|1966074_1966371_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001209480.1|1966367_1966829_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|1966806_1967163_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|1967213_1967426_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|1967511_1967676_+	sugar acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|1967677_1967941_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|1967951_1968821_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|1968936_1969041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303916.1|1969029_1969185_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	83.8	1.9e-09
WP_047085861.1|1969229_1969442_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.0	3.4e-25
WP_000119356.1|1969653_1969833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818166.1|1969851_1970337_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000940340.1|1970798_1971398_+	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	93.5	1.2e-107
WP_000228018.1|1971397_1971688_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	90.6	1.5e-47
WP_000640170.1|1971684_1972239_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	70.5	1.8e-70
WP_071525387.1|1972235_1972460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001370386.1|1972986_1973172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106959075.1|1973780_1975727_+	sialate O-acetylesterase	NA	Q9EYC8	Enterobacteria_phage	98.0	0.0e+00
WP_000143464.1|1975862_1976042_+	DUF1378 domain-containing protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
WP_001290221.1|1976082_1976355_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	97.8	9.1e-23
WP_000284515.1|1976431_1976647_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_072165727.1|1976651_1977641_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	65.7	8.5e-111
WP_001092862.1|1977683_1978217_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	2.4e-99
WP_001043244.1|1978294_1978513_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	93.3	1.0e-16
WP_001082542.1|1978514_1979009_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	98.7	1.3e-75
WP_032313457.1|1979005_1979230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097397.1|1979226_1979391_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	77.8	4.3e-12
WP_106379429.1|1979385_1979658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|1979690_1980167_+	DUF1441 domain-containing protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077621.1|1980163_1981171_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	1.8e-201
WP_000114062.1|1981332_1982571_+	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	35.1	3.9e-60
WP_000229066.1|1982563_1982788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106959076.1|1982847_1983429_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	61.3	1.2e-51
WP_088136225.1|1983409_1984129_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_106959077.1|1984121_1984346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551748.1|1984338_1984932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000728901.1|1985128_1985371_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761774.1|1985367_1987182_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.9	5.7e-129
1986582:1986597	attR	AACACGCATTCAGGCG	NA	NA	NA	NA
WP_001399692.1|1987469_1987715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126660.1|1987711_1988134_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001114742.1|1988600_1988795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860406.1|1988791_1990681_+	peptidase S14	NA	Q8VNN5	Enterobacteria_phage	51.7	6.5e-184
WP_000133409.1|1990938_1991220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000368825.1|1992688_1992925_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	100.0	4.5e-34
WP_000974567.1|1992924_1994427_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	1.2e-289
WP_001299297.1|1994440_1996396_+	peptidase S14	NA	S5M7Q8	Escherichia_phage	98.9	0.0e+00
WP_001097065.1|1996483_1996810_+	DUF2190 domain-containing protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1996802_1997084_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1997086_1997710_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1997722_1998121_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1998128_1998881_+|tail	tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479059.1|1998894_1999317_+|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	97.9	1.3e-71
WP_000532075.1|1999343_1999652_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_106959078.1|1999695_2002341_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	94.4	0.0e+00
WP_000847298.1|2002337_2002667_+|tail	tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151061.1|2002666_2003365_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	98.3	1.4e-131
WP_050941327.1|2003375_2004119_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	1.1e-147
WP_074435840.1|2004016_2004697_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	98.2	1.5e-114
WP_001230388.1|2008406_2009006_+	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	98.5	1.5e-110
WP_078186114.1|2009070_2010384_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.4	1.1e-81
WP_001023417.1|2010385_2010655_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_000701369.1|2011087_2012074_+	peptidase M85	NA	NA	NA	NA	NA
WP_000812712.1|2012806_2013463_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
WP_001296140.1|2013463_2013655_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_001295499.1|2013759_2013996_-	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
WP_000057022.1|2014113_2015553_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001297532.1|2015632_2018266_-	MCE family protein	NA	NA	NA	NA	NA
WP_001207283.1|2018234_2019518_-	paraquat-inducible membrane protein A	NA	NA	NA	NA	NA
WP_001043882.1|2019647_2020145_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431370.1|2020241_2020940_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001315679.1|2020959_2023008_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000984517.1|2023199_2024081_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001400370.1|2024126_2025500_-	MFS transporter	NA	NA	NA	NA	NA
WP_001262171.1|2025676_2026468_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001211011.1|2026610_2026850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|2027008_2027152_+	PhoP regulon feedback inhibition membrane protein MgrB	NA	NA	NA	NA	NA
WP_001006866.1|2027226_2027514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001308705.1|2028015_2028222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295496.1|2028183_2028327_+	DUF2527 domain-containing protein	NA	NA	NA	NA	NA
WP_001062678.1|2028339_2028549_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_000010107.1|2028714_2029524_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001296134.1|2029520_2030087_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_015953171.1|2030083_2030329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000156255.1|2030515_2030974_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_000228655.1|2031028_2031880_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000406926.1|2031892_2032693_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000150543.1|2032755_2033727_-	PTS mannose transporter subunit EIIAB	NA	NA	NA	NA	NA
WP_001322972.1|2033697_2033892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009008110.1|2033992_2034202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394983.1|2034189_2035746_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_001295494.1|2035749_2037348_-	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000624303.1|2037478_2038843_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000456725.1|2039026_2039605_-	coenzyme A pyrophosphatase	NA	NA	NA	NA	NA
WP_000854972.1|2039608_2040970_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|2041043_2041223_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|2041342_2041702_-	DUF1889 domain-containing protein	NA	NA	NA	NA	NA
WP_001295493.1|2042063_2042408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000128827.1|2042539_2044450_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	7.7e-92
WP_001220981.1|2044507_2045203_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290576.1|2045242_2045824_+	Slp family lipoprotein, RpoE-regulated	NA	NA	NA	NA	NA
WP_000758422.1|2046028_2047714_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_001109158.1|2047783_2048911_+	ribonuclease D	NA	NA	NA	NA	NA
WP_001287005.1|2048964_2049930_-	oxidoreductase	NA	NA	NA	NA	NA
WP_000987517.1|2051140_2052751_-	BCCT family transporter	NA	NA	NA	NA	NA
WP_000978509.1|2053001_2054087_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_001299287.1|2054189_2055113_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000457200.1|2055239_2055878_+	leucine efflux protein	NA	NA	NA	NA	NA
WP_000939317.1|2056048_2056408_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000513743.1|2056411_2056600_+	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_000604942.1|2056615_2057047_-|transposase	IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	7.4e-43
WP_106959079.1|2057054_2058263_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.3	2.0e-207
>prophage 11
NZ_CP027464	Escherichia coli strain 2013C-4248 chromosome, complete genome	5243827	2216649	2252230	5243827	head,holin,terminase	Salmonella_phage(55.0%)	45	NA	NA
WP_001520094.1|2216649_2218041_-	ATP-dependent helicase	NA	Q3LZN8	Bacteriophage	72.8	6.0e-211
WP_021580418.1|2218079_2218790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312946.1|2218795_2219065_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	65.9	3.0e-26
WP_000637722.1|2219054_2219354_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	64.2	5.5e-29
WP_001520092.1|2219350_2219566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106959084.1|2219571_2221635_-	DNA polymerase	NA	Q775A3	Bordetella_phage	67.7	2.3e-275
WP_000215799.1|2221696_2222386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106959158.1|2222379_2223021_-	hypothetical protein	NA	H6WRY3	Salmonella_phage	64.1	1.4e-69
WP_000769011.1|2223072_2223621_-	DUF2815 domain-containing protein	NA	Q775A5	Bordetella_phage	65.9	1.6e-66
WP_001520087.1|2223636_2224938_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.7	2.3e-132
WP_000051353.1|2224940_2225843_-	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_000049986.1|2226622_2227246_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	44.8	3.3e-36
WP_000170998.1|2227366_2227579_+	XRE family transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	42.9	7.9e-06
WP_021578683.1|2227582_2229775_+	hypothetical protein	NA	B6SCY1	Bacteriophage	71.4	2.7e-173
WP_001244506.1|2230056_2230479_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	8.8e-41
WP_001174015.1|2230510_2230852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000781776.1|2231297_2231639_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_001194119.1|2231642_2232119_+	lysozyme	NA	Q8SBE0	Shigella_phage	96.2	2.1e-86
WP_000779566.1|2232102_2232627_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
WP_000162796.1|2232688_2233261_+|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	1.4e-60
WP_106959085.1|2233263_2234886_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.2	3.0e-312
WP_021578679.1|2234885_2236352_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	92.0	1.8e-261
WP_089553759.1|2236446_2236977_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	84.6	1.5e-82
WP_078356001.1|2236991_2238212_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	87.6	3.5e-199
WP_001066733.1|2238215_2238722_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	80.5	9.8e-71
WP_000627490.1|2238733_2239675_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	1.4e-155
WP_001040697.1|2239715_2240084_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	88.5	1.4e-53
WP_000042170.1|2240049_2240457_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	4.3e-69
WP_106959086.1|2240453_2241008_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	70.7	3.6e-66
WP_001142484.1|2240994_2241384_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	1.1e-66
WP_012816811.1|2241358_2241922_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	2.0e-80
WP_096896707.1|2241925_2243071_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	6.1e-161
WP_000109249.1|2243081_2243522_+	DUF3277 domain-containing protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_000393954.1|2243525_2243978_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	4.7e-56
WP_023141050.1|2243989_2244166_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	70.0	1.6e-12
WP_000990884.1|2244155_2246144_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	74.8	1.0e-272
WP_001300247.1|2246143_2246731_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	2.6e-83
WP_001007341.1|2246730_2247033_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	91.0	8.2e-49
WP_000081745.1|2247035_2248100_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.7	3.0e-154
WP_000832849.1|2248102_2248450_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	81.1	3.5e-27
WP_001121391.1|2248790_2249012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001007933.1|2249248_2250001_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	66.3	5.9e-88
WP_001270633.1|2250000_2250354_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	9.0e-55
WP_001197085.1|2250353_2251553_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.4	8.3e-185
WP_000049950.1|2251549_2252230_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	2.6e-103
>prophage 12
NZ_CP027464	Escherichia coli strain 2013C-4248 chromosome, complete genome	5243827	2310422	2370669	5243827	transposase,tail,capsid,holin,terminase,head,portal,lysis	Escherichia_phage(39.29%)	78	NA	NA
WP_047085932.1|2310422_2312849_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	6.5e-213
WP_001295396.1|2313047_2313353_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001443598.1|2313460_2314171_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2314173_2314734_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2314768_2315110_-	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
WP_000598292.1|2315244_2315571_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_071529671.1|2315607_2315796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295394.1|2315776_2316991_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836067.1|2317002_2318022_+	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_072095801.1|2318079_2318190_+	transporter	NA	NA	NA	NA	NA
WP_001206148.1|2318209_2319505_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_000005551.1|2319524_2319776_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
WP_000048585.1|2319845_2322317_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.0	1.9e-58
WP_001098307.1|2322410_2322602_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_000413705.1|2322598_2322787_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|2323354_2323564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2323564_2324203_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000379562.1|2324214_2324367_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	7.8e-08
WP_072094463.1|2324641_2325289_-	helix-turn-helix domain-containing protein	NA	A0A1P8DTH0	Proteus_phage	25.9	6.1e-09
WP_001261756.1|2325384_2325612_+	cell division protein	NA	NA	NA	NA	NA
WP_033810286.1|2325608_2326034_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_106959088.1|2326044_2326245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001164686.1|2326937_2327600_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.4e-79
WP_062855724.1|2327633_2328404_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.7	2.1e-80
WP_062855725.1|2328419_2328845_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	92.5	1.1e-62
WP_000150294.1|2329019_2329685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001427299.1|2329869_2330988_+	DNA (cytosine-5-)-methyltransferase	NA	M1PSQ0	Streptococcus_phage	31.7	1.7e-35
WP_001012717.1|2331001_2331880_+	type II restriction endonuclease NgoMIV	NA	NA	NA	NA	NA
WP_001342259.1|2332050_2332323_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_106959089.1|2332324_2333374_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	57.6	3.0e-114
WP_001047111.1|2333387_2334140_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	2.6e-136
WP_032316669.1|2334225_2334435_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.4	6.3e-24
WP_001339373.1|2334449_2334602_+	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_000735807.1|2334982_2335207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000498121.1|2335259_2335469_+	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.5e-20
WP_001299632.1|2335658_2336090_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	98.6	7.8e-69
WP_001339372.1|2336391_2336520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000023191.1|2336568_2338419_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000075191.1|2338697_2338859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024164617.1|2338857_2339073_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_032316671.1|2339077_2339869_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	6.3e-40
WP_000992045.1|2340380_2340914_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.6	8.1e-100
WP_000675931.1|2341134_2341248_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001082637.1|2341249_2341717_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	93.5	2.2e-72
WP_001096930.1|2341799_2341940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303878.1|2342182_2342497_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|2342578_2342803_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000867498.1|2343197_2343743_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2343717_2345643_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2345639_2345846_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2345842_2347444_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2347424_2348744_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2348753_2349086_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2349141_2350167_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158901.1|2350208_2350604_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	90.2	7.2e-53
WP_000752969.1|2350615_2350969_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	2.5e-57
WP_000975020.1|2350983_2351517_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2351513_2351909_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_106959090.1|2351916_2352669_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.8	1.1e-134
WP_000479051.1|2352682_2353105_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2353131_2353545_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_106959091.1|2353525_2356138_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.2	0.0e+00
WP_000847280.1|2356134_2356464_+|tail	tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_045896506.1|2356463_2357162_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	99.1	1.8e-131
WP_001375575.1|2357167_2357911_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
WP_106959092.1|2357808_2358489_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.8	7.4e-114
WP_106959093.1|2361987_2362074_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.3e-07
WP_085947970.1|2362039_2363253_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001230496.1|2363612_2364212_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.3e-109
WP_106959094.1|2364276_2365590_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	2.7e-80
WP_001023400.1|2365591_2365861_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	7.1e-44
WP_001341980.1|2366070_2366262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000701369.1|2366290_2367277_+	peptidase M85	NA	NA	NA	NA	NA
WP_001339397.1|2367432_2368110_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2368109_2368457_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_047086028.1|2368476_2370048_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	7.6e-170
WP_106959095.1|2370074_2370188_-	ferredoxin	NA	NA	NA	NA	NA
WP_096846665.1|2370354_2370669_-	DinI family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
>prophage 13
NZ_CP027464	Escherichia coli strain 2013C-4248 chromosome, complete genome	5243827	2768046	2846887	5243827	tail,capsid,lysis,holin,terminase,integrase,head,tRNA	Escherichia_phage(36.36%)	97	2794927:2794943	2848594:2848610
WP_001297484.1|2768046_2769153_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2769188_2769830_+	lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|2769833_2771204_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|2771371_2772043_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735406.1|2772042_2773503_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|2774104_2774386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032247227.1|2774437_2774662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816762.1|2774641_2775184_-|terminase	terminase	terminase	O64316	Escherichia_phage	43.6	1.5e-32
WP_000224599.1|2775388_2775802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380886.1|2775814_2776150_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907455.1|2776162_2777218_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.7	3.5e-70
WP_000796962.1|2777217_2777424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132079.1|2777675_2777900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301569.1|2777941_2778070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233304.1|2778026_2778299_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126687.1|2778309_2778720_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000192401.1|2778716_2778968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833618.1|2779168_2780569_-	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	9.6e-116
WP_000770175.1|2780565_2780865_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001204981.1|2780870_2781104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000336166.1|2781096_2781561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012816761.1|2781550_2782579_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000953272.1|2782636_2782825_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085258.1|2783180_2784410_-	DUF4102 domain-containing protein	NA	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	8.4e-132
WP_000456506.1|2784658_2785780_+	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
WP_000359439.1|2785925_2787155_-	peptidase T	NA	NA	NA	NA	NA
WP_001299275.1|2787210_2787426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000531594.1|2787404_2788541_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799400.1|2788524_2789388_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_106959100.1|2789750_2791112_+	type III secretion protein GogB	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_047085946.1|2791488_2794890_-	DUF4765 domain-containing protein	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.7e-219
2794927:2794943	attL	GAATAAAAGCCAGTTGA	NA	NA	NA	NA
WP_001301673.1|2795481_2797830_-	type III secretion system effector HECT-type E3 ubiquitin transferase	NA	NA	NA	NA	NA
WP_001023420.1|2798045_2798315_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_032362337.1|2798316_2799630_-|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.1	4.8e-77
WP_078202780.1|2799694_2800294_-	Ail/Lom family protein	NA	B6ETG5	Enterobacteria_phage	98.5	7.5e-110
WP_106959101.1|2800361_2803835_-|tail	phage tail protein	tail	A0A0P0ZCI5	Stx2-converting_phage	96.5	0.0e+00
WP_032202882.1|2803901_2804120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001429073.1|2804073_2804754_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.1	4.8e-113
WP_000194767.1|2804651_2805395_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	3.8e-148
WP_001357740.1|2805405_2806104_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000807944.1|2806103_2806445_-|tail	tail protein	tail	H6WZM2	Escherichia_phage	98.2	1.2e-61
WP_106959102.1|2806437_2809680_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.2	0.0e+00
WP_001234272.1|2809727_2810009_-|tail	phage tail protein	tail	A0A0P0ZED8	Stx2-converting_phage	98.9	2.3e-45
WP_001030063.1|2810032_2810407_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275510.1|2810412_2811129_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_000133388.1|2811195_2811540_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2811536_2811983_-	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2811979_2812330_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|2812340_2812667_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063096.1|2815193_2815415_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_047086052.1|2815459_2817397_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.1	0.0e+00
WP_001399867.1|2817460_2819122_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_000958380.1|2819118_2819682_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000279796.1|2819971_2820337_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001448509.1|2820378_2820603_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_001302717.1|2820684_2820999_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001096932.1|2821239_2821380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082648.1|2821462_2821930_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	88.3	2.1e-67
WP_001056891.1|2822086_2822656_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	98.9	9.9e-104
WP_000087705.1|2822930_2823464_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	98.9	1.5e-101
WP_001072901.1|2823468_2823684_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|2823761_2824007_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143463.1|2824047_2824227_-	DUF1378 domain-containing protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_000023293.1|2824362_2826300_-	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_000466957.1|2826777_2827209_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000301785.1|2827658_2828372_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816794.1|2828506_2828827_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.1	2.7e-34
WP_000640048.1|2828945_2829476_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904103.1|2829484_2829844_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_001265113.1|2829856_2830903_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_001342259.1|2830904_2831177_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_001260977.1|2831312_2831570_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_000220601.1|2831575_2831875_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_000206830.1|2832079_2832424_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	1.7e-58
WP_001229296.1|2832420_2832786_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000209152.1|2832787_2833006_-	hypothetical protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
WP_001289353.1|2833093_2833729_-	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_001224662.1|2833894_2834077_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000935422.1|2834110_2834323_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_000403783.1|2834373_2834730_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_001209480.1|2834707_2835169_-	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266133.1|2835165_2835462_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_077249748.1|2835458_2835866_-	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
WP_001164687.1|2836625_2837288_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	2.2e-78
WP_000693932.1|2838176_2838614_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
WP_001172789.1|2838610_2838871_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
WP_000578360.1|2838997_2839390_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_001022415.1|2839436_2839796_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
WP_000692026.1|2839798_2840101_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_012817750.1|2840436_2840736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171921.1|2840807_2841026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2841594_2841783_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2841779_2841968_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_000048493.1|2842062_2844513_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000273151.1|2844580_2844823_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|2844800_2845820_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375136.1|2846227_2846887_+	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
2848594:2848610	attR	GAATAAAAGCCAGTTGA	NA	NA	NA	NA
>prophage 14
NZ_CP027464	Escherichia coli strain 2013C-4248 chromosome, complete genome	5243827	3071719	3118809	5243827	transposase,capsid,tail,holin,terminase,integrase,head,portal,lysis	Enterobacteria_phage(46.81%)	58	3067356:3067370	3127203:3127217
3067356:3067370	attL	CAGGCCATCTTCCAG	NA	NA	NA	NA
WP_001399730.1|3071719_3073009_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	6.5e-18
WP_000767413.1|3073067_3073544_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_071524634.1|3073458_3073638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071529690.1|3073764_3073953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102750.1|3074222_3075461_+	hypothetical protein	NA	H6WZN2	Escherichia_phage	82.3	3.6e-207
WP_047086028.1|3075833_3077405_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	7.6e-170
WP_000624622.1|3077424_3077772_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|3077771_3078449_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001131649.1|3078505_3079081_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	76.4	1.8e-76
WP_106959105.1|3079632_3080415_-	cell division protein	NA	A5LH49	Enterobacteria_phage	98.1	3.5e-144
WP_000950986.1|3080681_3081563_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.1	2.3e-147
WP_096150060.1|3081726_3081858_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
WP_072096918.1|3081880_3082144_-	T3SS effector NleC domain protein	NA	NA	NA	NA	NA
WP_106959106.1|3082204_3083185_-	type III secretion system effector NleB	NA	Q8HAB2	Salmonella_phage	49.5	1.7e-87
WP_001023455.1|3083361_3083631_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_106959107.1|3083632_3084946_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	99.5	9.7e-78
WP_097491834.1|3085010_3085610_-	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	6.3e-109
WP_000515380.1|3085677_3089073_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.2	0.0e+00
WP_106959108.1|3089133_3089775_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	2.5e-95
WP_012816751.1|3089672_3090416_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	95.9	1.7e-143
WP_001152517.1|3090421_3091120_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	88.4	5.4e-120
WP_000847379.1|3091119_3091449_-|tail	tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_032362273.1|3091445_3094025_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.5	0.0e+00
WP_000533411.1|3094005_3094419_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.2	5.1e-41
WP_000479115.1|3094445_3094877_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_001143022.1|3094890_3095643_-|tail	tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.1e-126
WP_000683065.1|3095650_3096046_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_000975031.1|3096042_3096576_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.0e-57
WP_001204560.1|3096590_3096944_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.5e-41
WP_000201513.1|3096936_3097320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522623.1|3097371_3098400_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000256723.1|3098457_3098805_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253918.1|3098841_3100347_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	3.6e-100
WP_001374583.1|3100336_3101929_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	9.3e-184
WP_000259002.1|3101925_3102132_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_012816750.1|3102115_3104044_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	3.6e-262
WP_000235436.1|3104015_3104525_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_032347049.1|3104927_3105122_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	95.2	2.2e-26
WP_032158834.1|3105201_3105342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947970.1|3105509_3106722_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000092314.1|3107389_3107827_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	95.9	9.4e-70
WP_000075136.1|3107823_3108321_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	98.8	1.9e-90
WP_024164617.1|3108320_3108536_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075200.1|3108534_3108681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106959109.1|3108975_3110826_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000499453.1|3111124_3111283_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001299184.1|3111368_3112085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3112296_3112986_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3113000_3113123_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3113462_3114422_+	DUF2219 domain-containing protein	NA	NA	NA	NA	NA
WP_001028841.1|3114633_3115299_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.4	4.4e-127
WP_001108038.1|3115295_3115907_-	recombination protein NinG	NA	Q716C3	Shigella_phage	99.5	6.0e-99
WP_000566868.1|3115899_3116070_-	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	98.2	1.2e-25
WP_001254222.1|3116066_3116249_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_000130633.1|3116245_3116563_-	hypothetical protein	NA	Q8H9Z7	Enterobacteria_phage	98.6	4.6e-34
WP_085947970.1|3116524_3117737_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_071790934.1|3117703_3117793_+|transposase	transposase	transposase	A0A0N7BTS3	Escherichia_phage	100.0	1.7e-07
WP_042094857.1|3117789_3118809_+|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	3.9e-191
3127203:3127217	attR	CAGGCCATCTTCCAG	NA	NA	NA	NA
>prophage 15
NZ_CP027464	Escherichia coli strain 2013C-4248 chromosome, complete genome	5243827	3332044	3397208	5243827	tRNA,transposase,capsid,tail,holin,terminase,integrase,protease,head,portal,lysis	Enterobacteria_phage(56.36%)	75	3340525:3340571	3387002:3387048
WP_000394594.1|3332044_3333181_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383912.1|3333449_3335687_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662366.1|3335673_3338646_+	phage receptor	NA	NA	NA	NA	NA
WP_001224569.1|3338646_3339537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580049.1|3339450_3339663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001177469.1|3339719_3340481_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001443680.1|3340474_3340591_+	hypothetical protein	NA	NA	NA	NA	NA
3340525:3340571	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001307659.1|3340776_3340968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001201825.1|3340993_3341947_+|protease	outer membrane protease	protease	NA	NA	NA	NA
WP_001226378.1|3342133_3343618_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937478.1|3343801_3344107_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_050552926.1|3344205_3344832_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000836765.1|3345379_3345613_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
WP_000087133.1|3345931_3346522_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.9	2.1e-24
WP_000885588.1|3346619_3347195_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	6.9e-105
WP_000279114.1|3347194_3350110_-	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	2.5e-57
WP_001230323.1|3350174_3350774_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	2.6e-110
WP_106959112.1|3350840_3354239_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.9	0.0e+00
WP_001309913.1|3354299_3354947_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	2.5e-111
WP_000140729.1|3354844_3355588_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	7.0e-150
WP_001152638.1|3355593_3356292_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	6.6e-134
WP_000847379.1|3356291_3356621_-|tail	tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001368744.1|3358633_3359098_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	98.0	1.3e-45
WP_000459457.1|3359090_3359525_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|3359506_3359929_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001298904.1|3359944_3360685_-|tail	tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	1.7e-132
WP_000683105.1|3360692_3361088_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975070.1|3361084_3361663_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000752979.1|3361674_3362028_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000158905.1|3362039_3362438_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	1.2e-63
WP_106959113.1|3362479_3363505_-|capsid	major capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	99.7	9.2e-193
WP_001297109.1|3363560_3363893_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000123319.1|3363902_3365222_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	1.5e-235
WP_001297098.1|3365202_3366804_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.2e-311
WP_000198149.1|3366800_3367007_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027292.1|3367003_3368929_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
WP_000453580.1|3368903_3369449_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_000583869.1|3369588_3369690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001298906.1|3369837_3370032_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	9.7e-27
WP_001031427.1|3370196_3370403_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001298896.1|3370688_3371099_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738500.1|3371389_3371683_+	lipoprotein bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001400133.1|3371714_3372176_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	97.4	1.5e-73
WP_001135281.1|3372172_3372670_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000670959.1|3372669_3372885_-|holin	holin	holin	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_000737283.1|3373473_3374571_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_000332834.1|3374760_3375144_-	antitermination protein	NA	A0A088CD47	Shigella_phage	83.3	3.4e-55
WP_001360050.1|3375161_3376151_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061438.1|3376158_3376968_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_000767117.1|3376987_3377377_-	crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	100.0	7.1e-69
WP_000210187.1|3377373_3377700_-	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
WP_000066917.1|3377696_3378350_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_001305611.1|3378349_3378844_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_000104954.1|3378840_3379782_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_001250269.1|3379771_3379951_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|3380126_3380678_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|3380670_3380931_-	XRE family transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001400137.1|3381028_3381721_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.6	3.9e-126
WP_072094451.1|3382040_3382601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|3383026_3383389_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_106959114.1|3383454_3384279_+	hypothetical protein	NA	U5P439	Shigella_phage	99.6	1.3e-149
WP_000008165.1|3384406_3384943_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_001242707.1|3384933_3385296_+	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000206810.1|3385295_3385601_+	hypothetical protein	NA	U5P0J0	Shigella_phage	97.0	2.2e-49
WP_077625877.1|3385516_3385972_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	85.4	5.5e-65
WP_106959115.1|3385827_3386988_+|integrase	integrase	integrase	A0A088CD23	Shigella_phage	86.3	2.8e-198
WP_000805428.1|3387322_3387955_+	DNA-binding response regulator	NA	NA	NA	NA	NA
3387002:3387048	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001250422.1|3387957_3388473_-	fimbriae assembly protein	NA	NA	NA	NA	NA
WP_000691050.1|3388483_3389491_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000988366.1|3392142_3392835_-	molecular chaperone FimC	NA	NA	NA	NA	NA
WP_106959116.1|3393054_3393597_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729160.1|3394077_3394944_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3394945_3395158_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001143552.1|3395265_3395787_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|3395822_3397208_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 16
NZ_CP027464	Escherichia coli strain 2013C-4248 chromosome, complete genome	5243827	3954894	4043024	5243827	transposase,capsid,tail,lysis,holin,terminase,integrase,head,tRNA	Stx2-converting_phage(35.29%)	98	3982761:3982776	4050385:4050400
WP_000399648.1|3954894_3955875_-|transposase	IS110 family transposase IS621	transposase	NA	NA	NA	NA
WP_000738721.1|3956134_3956431_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000781067.1|3956644_3957931_-	threonine synthase	NA	NA	NA	NA	NA
WP_000241660.1|3957931_3958864_-	homoserine kinase	NA	NA	NA	NA	NA
WP_001264697.1|3958865_3961328_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_001386572.1|3961408_3961474_-	thr operon leader peptide	NA	NA	NA	NA	NA
WP_001223177.1|3961687_3962374_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|3962773_3962914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|3963009_3963726_+	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_000920337.1|3963784_3965137_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219604.1|3965194_3966619_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
WP_106959129.1|3966618_3967308_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
WP_000875487.1|3967320_3967794_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|3968004_3968874_+	right origin-binding protein	NA	NA	NA	NA	NA
WP_000942344.1|3968870_3969518_-	phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001300180.1|3969569_3970091_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068679.1|3970175_3970502_-	Trp operon repressor	NA	NA	NA	NA	NA
WP_000409451.1|3970591_3972529_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_001297284.1|3972637_3972766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000046750.1|3972739_3974407_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	2.9e-42
WP_000093810.1|3974713_3975946_-	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_106959130.1|3975966_3977349_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132949.1|3977397_3978366_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124615.1|3978471_3979116_+	protein Smp	NA	NA	NA	NA	NA
WP_000105865.1|3979143_3980160_+	lipoate--protein ligase A	NA	NA	NA	NA	NA
WP_000224877.1|3980615_3981335_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|3981414_3982638_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477808.1|3982689_3984012_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.4e-79
3982761:3982776	attL	TCACCGCTTTCGCCGC	NA	NA	NA	NA
WP_001295412.1|3984138_3984918_-	2-deoxyribose-5-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143237.1|3985175_3986726_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088403.1|3986697_3987561_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563079.1|3987975_3988758_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001299187.1|3988754_3989828_-	patatin family protein	NA	NA	NA	NA	NA
WP_001304521.1|3989949_3990129_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
WP_001300534.1|3990237_3990843_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202566.1|3991235_3992822_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001217548.1|3993041_3993302_+	DNA-damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	95.3	8.1e-37
WP_072097361.1|3993571_3993910_+	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	98.9	3.2e-49
WP_010917822.1|3994173_3994545_+	DUF1076 domain-containing protein	NA	A0A0P0ZBX1	Stx2-converting_phage	99.2	1.7e-67
WP_001023420.1|3994829_3995099_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_032362337.1|3995100_3996414_-|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.1	4.8e-77
WP_078202780.1|3996478_3997078_-	Ail/Lom family protein	NA	B6ETG5	Enterobacteria_phage	98.5	7.5e-110
WP_106959101.1|3997145_4000619_-|tail	phage tail protein	tail	A0A0P0ZCI5	Stx2-converting_phage	96.5	0.0e+00
WP_032202882.1|4000685_4000904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001429073.1|4000857_4001538_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.1	4.8e-113
WP_000194767.1|4001435_4002179_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	3.8e-148
WP_001357740.1|4002189_4002888_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000807944.1|4002887_4003229_-|tail	tail protein	tail	H6WZM2	Escherichia_phage	98.2	1.2e-61
WP_106959102.1|4003221_4006464_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.2	0.0e+00
WP_001234272.1|4006511_4006793_-|tail	phage tail protein	tail	A0A0P0ZED8	Stx2-converting_phage	98.9	2.3e-45
WP_001030063.1|4006816_4007191_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275510.1|4007196_4007913_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_000133388.1|4007979_4008324_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|4008320_4008767_-	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|4008763_4009114_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|4009124_4009451_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063096.1|4011977_4012199_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_047086052.1|4012243_4014181_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.1	0.0e+00
WP_001399867.1|4014244_4015906_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_000958380.1|4015902_4016466_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000279796.1|4016755_4017121_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|4017162_4017390_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_001082576.1|4017752_4018220_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	100.0	6.9e-79
WP_001056806.1|4018373_4018943_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992166.1|4019213_4019747_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.7	5.6e-101
WP_000731236.1|4019797_4020142_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_024164617.1|4020146_4020362_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075213.1|4020360_4020522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106959131.1|4020800_4022651_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	99.4	0.0e+00
WP_012817767.1|4022772_4023000_-	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	100.0	2.6e-39
WP_000752026.1|4023150_4023420_-	Shiga toxin Stx1 subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|4023429_4024377_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_015971135.1|4024649_4024895_+	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
WP_001204852.1|4024883_4025318_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000144759.1|4025310_4025505_-	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001107998.1|4025501_4026107_-	recombination protein NinG	NA	B6DZ84	Enterobacteria_phage	100.0	6.6e-98
WP_001004018.1|4026106_4026829_-	DNA-binding protein	NA	B6DZ83	Enterobacteria_phage	100.0	3.5e-130
WP_085948138.1|4026976_4028189_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	2.2e-169
WP_032425692.1|4028474_4029455_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	3.0e-185
WP_000250473.1|4029669_4030377_+	phage repressor protein C	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885202.1|4030437_4030779_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	100.0	5.1e-63
WP_001221211.1|4030846_4031308_+	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000198444.1|4033002_4033386_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167584.1|4033444_4033915_+	hypothetical protein	NA	G9L670	Escherichia_phage	99.4	1.1e-87
WP_001130933.1|4034113_4034383_+	host cell division inhibitory peptide Kil	NA	M1FN78	Enterobacteria_phage	95.5	3.6e-40
WP_001496530.1|4034337_4034490_+	hypothetical protein	NA	Q08J51	Stx2-converting_phage	98.0	4.7e-21
WP_000995407.1|4034458_4034755_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	5.2e-48
WP_000100847.1|4034760_4035546_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186781.1|4035542_4036223_+	exonuclease	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.1	6.0e-132
WP_000682304.1|4036219_4036402_+	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_000548528.1|4036374_4036566_+	DUF1382 domain-containing protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_001447688.1|4036576_4036858_+	hypothetical protein	NA	Q08J56	Stx2-converting_phage	100.0	6.5e-48
WP_000763383.1|4036956_4037178_+	conjugal transfer protein TraR	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289923.1|4037174_4037945_+	hypothetical protein	NA	H6WZG2	Escherichia_phage	97.7	4.0e-140
WP_001391668.1|4038174_4038462_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	100.0	9.5e-55
WP_001400035.1|4038458_4039277_+	hypothetical protein	NA	A0A0H4IU61	Shigella_phage	96.5	1.7e-120
WP_047086086.1|4039653_4039848_+	DNA-binding protein	NA	A5LH59	Enterobacteria_phage	95.3	1.4e-30
WP_001218294.1|4041800_4043024_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.0	1.3e-233
4050385:4050400	attR	TCACCGCTTTCGCCGC	NA	NA	NA	NA
>prophage 17
NZ_CP027464	Escherichia coli strain 2013C-4248 chromosome, complete genome	5243827	4243608	4316952	5243827	transposase,protease,tRNA	Stx2-converting_phage(26.32%)	55	NA	NA
WP_001232412.1|4243608_4244613_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312490.1|4244615_4245875_-|protease	protease modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|4245960_4247241_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|4247317_4247626_-	RNA-binding protein Hfq	NA	NA	NA	NA	NA
WP_001280345.1|4247711_4248662_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122507.1|4248654_4250502_-	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990321.1|4250511_4251849_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|4251867_4252329_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001307537.1|4252300_4253848_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294219.1|4253846_4254986_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|4254968_4255022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|4255652_4256198_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|4256292_4257345_+	ribosome small subunit-dependent GTPase	NA	NA	NA	NA	NA
WP_000934935.1|4257441_4258410_+	phosphatidylserine decarboxylase proenzyme	NA	NA	NA	NA	NA
WP_001236849.1|4258431_4261755_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001300174.1|4261905_4263408_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|4263626_4264604_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192991.1|4264928_4266737_+	fumarate reductase flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|4266729_4267464_+	fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000208757.1|4267474_4267870_+	fumarate reductase subunit C	NA	NA	NA	NA	NA
WP_001299198.1|4267880_4268240_+	fumarate reductase subunit D	NA	NA	NA	NA	NA
WP_106959138.1|4268302_4269436_+	class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|4269524_4270058_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|4270054_4270372_-	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
WP_000239596.1|4270553_4270700_-	entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|4270810_4270936_-	entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|4270987_4271554_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|4271595_4272624_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008071.1|4273013_4273883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000399648.1|4274131_4275112_-|transposase	IS110 family transposase IS621	transposase	NA	NA	NA	NA
WP_000558209.1|4275364_4275718_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|4275855_4277502_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|4277545_4277839_-	molecular chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015837.1|4278114_4279371_+	amino acid permease	NA	NA	NA	NA	NA
WP_001267448.1|4279386_4279863_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|4280199_4281636_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|4281753_4283055_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000883400.1|4283170_4283509_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068978.1|4283484_4285182_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_001188520.1|4285218_4285794_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218841.1|4286173_4287439_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_001341423.1|4288429_4289104_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631719.1|4289100_4289448_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.0e-42
WP_001130479.1|4292425_4292605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278237.1|4292889_4293090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000788140.1|4295021_4295216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001412621.1|4297551_4297893_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	57.3	2.0e-22
WP_001435180.1|4297925_4298540_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	57.2	2.3e-58
WP_000609742.1|4298588_4299263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106959139.1|4311207_4311294_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.2e-07
WP_085947970.1|4311259_4312473_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001339397.1|4313123_4313801_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4313800_4314148_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_047086028.1|4314167_4315739_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	7.6e-170
WP_106959140.1|4315765_4316952_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.7e-164
>prophage 18
NZ_CP027464	Escherichia coli strain 2013C-4248 chromosome, complete genome	5243827	4492404	4547765	5243827	transposase	Stx2-converting_phage(23.53%)	53	NA	NA
WP_047086028.1|4492404_4493976_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	7.6e-170
WP_071527744.1|4494706_4494823_-	cytoplasmic protein	NA	NA	NA	NA	NA
WP_000848830.1|4494905_4495316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775503.1|4495331_4496009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102649.1|4496143_4497214_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203527.1|4497210_4498116_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000544707.1|4498112_4500509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069798.1|4500726_4501599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000282124.1|4501929_4502112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064760767.1|4502515_4502758_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	93.4	1.7e-33
WP_106959144.1|4502978_4504109_-	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_085947970.1|4504902_4506116_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000301248.1|4506684_4507260_-	tellurium resistance protein TerE	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|4507328_4507907_-	tellurium resistance protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|4507955_4508996_-	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|4509018_4509474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001054789.1|4509496_4510654_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000254140.1|4510653_4511235_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|4511557_4512616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|4512625_4513768_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_106959145.1|4513760_4514534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182419.1|4514535_4515615_+	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	34.2	3.6e-38
WP_000797372.1|4515614_4516571_+	citrate lyase subunit beta	NA	NA	NA	NA	NA
WP_000506898.1|4516581_4517790_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|4517807_4518275_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|4518535_4518865_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957247.1|4518851_4519232_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000355324.1|4519274_4520816_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	36.6	1.5e-77
WP_032156589.1|4521840_4521996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001415970.1|4522791_4522983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015740426.1|4523527_4523806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135714.1|4523737_4523878_-	hok/gef family protein	NA	G9L6L7	Escherichia_phage	66.7	3.1e-11
WP_001310151.1|4523869_4524226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803992.1|4524179_4524443_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001303893.1|4525828_4526029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000024297.1|4526438_4526798_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591998.1|4526890_4528510_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000134819.1|4528734_4529010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015740427.1|4529061_4529265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000424145.1|4530180_4530483_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_000612150.1|4530491_4530812_+	urease subunit beta	NA	NA	NA	NA	NA
WP_015740428.1|4530801_4532508_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_000966484.1|4532517_4532982_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_001142971.1|4532982_4533657_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_001021388.1|4533668_4534286_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001034023.1|4536940_4541032_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	44.6	6.8e-311
WP_071532608.1|4541118_4541316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947970.1|4541488_4542702_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001171554.1|4542819_4543200_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|4543196_4543544_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000997983.1|4543593_4545132_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.9e-296
WP_000035067.1|4545198_4545387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106959146.1|4545404_4547765_-	DEAD/DEAH box helicase	NA	Q84473	Paramecium_bursaria_Chlorella_virus	31.8	2.6e-33
>prophage 1
NZ_CP027465	Escherichia coli strain 2013C-4248 plasmid unnamed1, complete sequence	113063	2946	43270	113063	transposase,integrase	Stx2-converting_phage(16.67%)	55	9022:9035	39062:39075
WP_000937595.1|2946_4134_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032345630.1|4133_4499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080731.1|5345_5681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071593992.1|5658_5877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000142449.1|5809_6157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015281.1|6776_6956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000587689.1|7075_7702_-	chromosome partitioning protein ParA	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
WP_000457510.1|7929_9201_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.4	1.7e-143
9022:9035	attL	TTGTCTCACCTGAA	NA	NA	NA	NA
WP_000109071.1|9200_9638_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|9634_9883_-	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_001324027.1|9994_10264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072108049.1|10232_11204_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086137.1|11587_12271_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.3e-30
WP_001104873.1|12271_12493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274421.1|12506_12941_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001006204.1|12985_13756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061355072.1|13774_13999_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_001335735.1|13962_14199_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_001198900.1|14171_14597_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271688.1|14643_15066_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001027516.1|15062_15254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015056416.1|15822_16029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276120.1|16025_16553_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.6e-47
WP_013307865.1|16583_16844_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.2	1.9e-06
WP_001145476.1|16902_18861_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.6	1.5e-21
WP_000845903.1|18915_19350_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276270.1|19346_20066_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000977995.1|20062_20659_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	56.6	9.0e-15
WP_000117631.1|21120_21621_+	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	28.2	1.4e-05
WP_000284691.1|22140_22356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106959164.1|22352_22787_+	post-segregation killing protein PndC	NA	NA	NA	NA	NA
WP_001247860.1|22879_23146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833767.1|23322_23712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038335.1|23708_24635_+	hypothetical protein	NA	Q2A0A7	Sodalis_phage	53.4	2.7e-66
WP_001346201.1|24658_24880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148286.1|24910_25162_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_071849622.1|25402_25618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000157083.1|26675_27011_-	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
WP_001291058.1|27243_27576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991384.1|27587_30299_+	relaxase NikB	NA	NA	NA	NA	NA
WP_001339397.1|30607_31285_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|31284_31632_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_047086028.1|31651_33223_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	7.6e-170
WP_001353740.1|34367_34607_+	DUF1819 domain-containing protein	NA	NA	NA	NA	NA
WP_000497519.1|34794_35121_-|integrase	integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
WP_000071896.1|35235_35772_-|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
WP_000777554.1|36103_36577_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
WP_000704156.1|36671_37196_+	streptothricin N-acetyltransferase Sat2	NA	NA	NA	NA	NA
WP_001206315.1|37253_38042_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001444089.1|38117_38615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119696.1|38675_39047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001334979.1|39079_39403_+	hypothetical protein	NA	NA	NA	NA	NA
39062:39075	attR	TTCAGGTGAGACAA	NA	NA	NA	NA
WP_001271300.1|39456_39834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251879.1|40064_41681_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_087880415.1|41756_43270_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.7	6.2e-12
>prophage 1
NZ_CP027468	Escherichia coli strain 2013C-4248 plasmid unnamed4	97439	382	96845	97439	tail,transposase,holin,terminase	Escherichia_phage(65.45%)	120	NA	NA
WP_000523978.1|382_994_-	hypothetical protein	NA	A0A077SLH8	Escherichia_phage	100.0	5.8e-110
WP_106959172.1|1004_1571_-	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	98.9	2.8e-98
WP_032283228.1|1716_2499_-	hypothetical protein	NA	Q71TC6	Escherichia_phage	33.9	3.9e-34
WP_032325264.1|2528_3167_-	hypothetical protein	NA	Q71TC4	Escherichia_phage	90.2	3.1e-13
WP_001484178.1|3390_3561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000245712.1|3594_3816_+	host cell division inhibitor Icd-like protein	NA	A0A077SLM6	Escherichia_phage	100.0	1.3e-38
WP_071998395.1|4397_5195_+	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	68.6	7.4e-97
WP_001697753.1|5359_6160_+	host killing protein	NA	Q1MVK4	Enterobacteria_phage	99.6	7.1e-148
WP_032283224.1|6189_7035_+	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	98.6	8.5e-152
WP_001426344.1|7085_7331_+	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
WP_000268407.1|7513_8110_-	hypothetical protein	NA	A0A077SLI4	Escherichia_phage	98.5	2.6e-107
WP_024222323.1|8281_8791_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	99.4	3.0e-91
WP_106959173.1|8802_9384_-	hypothetical protein	NA	Q71TM4	Escherichia_phage	95.3	2.2e-98
WP_000041774.1|9419_10235_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	9.8e-113
WP_032326466.1|10244_11834_-	hypothetical protein	NA	Q1MVJ6	Enterobacteria_phage	98.9	9.0e-304
WP_000067713.1|11894_13601_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
WP_000038868.1|13825_14827_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	99.7	3.7e-178
WP_001285362.1|14843_16040_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_000888906.1|17310_18195_-	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	99.7	1.4e-160
WP_001281116.1|18528_18921_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
WP_106905002.1|19098_19521_-	ppfA	NA	A0A1B0VCB0	Salmonella_phage	99.3	1.4e-57
WP_000890203.1|19560_20349_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	89.3	9.2e-108
WP_001369296.1|20357_20537_-	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	98.3	6.8e-27
WP_001177859.1|20811_21096_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.7e-48
WP_000472523.1|21088_21994_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.3	5.9e-159
WP_106959174.1|21990_25278_+	DNA methyltransferase	NA	A0A077SL51	Escherichia_phage	98.4	0.0e+00
WP_001068935.1|26548_26740_-	hypothetical protein	NA	Q71T98	Escherichia_phage	100.0	6.0e-29
WP_001180697.1|26935_27172_+	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	50.0	2.1e-07
WP_000751808.1|27152_27980_+	hypothetical protein	NA	A0A077SLJ6	Escherichia_phage	100.0	1.6e-131
WP_044711470.1|28363_29728_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	99.8	6.2e-253
WP_106959175.1|29727_30726_+	hypothetical protein	NA	Q71TK3	Escherichia_phage	98.8	3.1e-193
WP_000245706.1|31105_31327_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	82.2	2.1e-30
WP_032324541.1|31323_32436_+	antirepressor	NA	A0A077SLR9	Escherichia_phage	86.5	3.8e-176
WP_060552920.1|32511_33531_-	hypothetical protein	NA	Q71TR6	Escherichia_phage	99.4	7.8e-184
WP_032203717.1|33523_35233_-	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	99.6	0.0e+00
WP_000747846.1|35544_35793_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_032203718.1|35831_36554_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032203719.1|36802_37492_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_032203722.1|37545_38190_-	hypothetical protein	NA	A0A1B0VAG4	Salmonella_phage	85.8	1.7e-96
WP_071829164.1|38580_38751_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000245704.1|38784_39006_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.8	3.7e-30
WP_106959176.1|39002_40115_+	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	89.5	3.0e-181
WP_001224234.1|40354_40666_-	hypothetical protein	NA	A0A077SK03	Escherichia_phage	100.0	1.0e-46
WP_106959177.1|40716_41748_-	recombinase	NA	A0A077SLE7	Escherichia_phage	98.5	7.9e-192
WP_000481733.1|41744_42140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000542341.1|42159_42381_-	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	94.5	1.0e-32
WP_001312283.1|42792_42906_+	hypothetical protein	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
WP_012817944.1|42924_43020_+	hypothetical protein	NA	Q38402	Escherichia_phage	100.0	2.8e-11
WP_000874157.1|42985_43195_+	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	98.6	3.1e-31
WP_000611655.1|43305_44157_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	2.3e-157
WP_106959178.1|44189_44996_-	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	90.3	2.9e-133
WP_106959179.1|44929_45094_-	PapI protein	NA	A0A0N7BTS3	Escherichia_phage	100.0	9.4e-07
WP_085947970.1|45059_46273_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000124150.1|47195_48680_-|terminase	terminase	terminase	Q71T61	Escherichia_phage	100.0	1.5e-292
WP_032335092.1|48679_49873_-	hypothetical protein	NA	Q5QBP3	Enterobacteria_phage	96.7	7.4e-202
WP_001326849.1|49959_50412_-	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_106959180.1|50500_51544_-	hypothetical protein	NA	A0A1B0VBU2	Salmonella_phage	99.1	1.5e-206
WP_000113018.1|51571_51751_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
WP_106959181.1|51755_52136_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	99.2	1.3e-62
WP_001190712.1|52135_52357_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_000506730.1|52429_52819_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	100.0	8.3e-70
WP_001283837.1|52941_53193_-	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	100.0	1.4e-38
WP_001344848.1|53366_53576_+	hypothetical protein	NA	A0A222YY00	Escherichia_phage	98.6	1.1e-31
WP_001142394.1|53560_53845_-	hypothetical protein	NA	A0A222YXZ5	Escherichia_phage	100.0	2.4e-05
WP_000057451.1|53828_54479_-	hypothetical protein	NA	A0A077SK55	Escherichia_phage	96.7	4.9e-99
WP_000988657.1|54460_54835_-	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	96.8	4.1e-66
WP_000269001.1|54841_55135_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	92.8	5.3e-45
WP_000517421.1|55313_55547_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	98.7	7.3e-37
WP_106959182.1|55629_56538_-	hypothetical protein	NA	A0A077SK54	Escherichia_phage	54.4	1.7e-76
WP_106959183.1|56534_56786_-	hypothetical protein	NA	Q9XJH3	Enterobacteria_phage	86.5	1.1e-33
WP_106959184.1|56745_57141_-	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	86.7	5.4e-40
WP_042804905.1|57137_57425_-	hypothetical protein	NA	V5URG6	Shigella_phage	100.0	1.2e-54
WP_106959185.1|57654_58404_-	hypothetical protein	NA	Q1MVF9	Enterobacteria_phage	87.7	5.7e-107
WP_106959186.1|58400_59054_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	58.1	3.0e-35
WP_001571181.1|59050_59695_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	99.5	2.0e-132
WP_000042974.1|59687_59903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024177054.1|59899_60091_-	DUF1382 domain-containing protein	NA	A0A0P0ZC60	Stx2-converting_phage	81.4	4.7e-18
WP_032313321.1|60130_60856_-	hypothetical protein	NA	Q71T76	Escherichia_phage	98.7	6.4e-140
WP_106959187.1|61050_61557_-	3'-phosphatase	NA	Q71T77	Escherichia_phage	96.4	5.5e-90
WP_000107685.1|61630_62893_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	97.6	4.0e-230
WP_000267620.1|62894_63113_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
WP_106959188.1|63194_63896_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	98.3	2.3e-142
WP_106959189.1|63892_64570_-	serine/threonine protein phosphatase	NA	Q71TJ1	Escherichia_phage	96.4	1.1e-130
WP_000484116.1|64566_65193_-	norphogenetic protein	NA	Q1MVG8	Enterobacteria_phage	100.0	2.1e-123
WP_012817939.1|65090_65753_-	hypothetical protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
WP_000096174.1|65694_65850_-	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_000943609.1|65916_66495_-	norphogenetic protein	NA	Q71T85	Escherichia_phage	100.0	1.5e-107
WP_000840931.1|66497_66743_-	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000235786.1|66889_67267_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_001141908.1|67276_68494_+	hypothetical protein	NA	A0A077SL53	Escherichia_phage	100.0	1.1e-224
WP_000896801.1|68497_69226_+	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_015974270.1|69212_69998_+	hypothetical protein	NA	Q71T90	Escherichia_phage	100.0	9.4e-145
WP_000212023.1|69999_71016_+	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	99.7	5.9e-192
WP_000535208.1|71008_71641_+	hypothetical protein	NA	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
WP_001260617.1|71711_72746_-	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	77.7	1.5e-145
WP_000245706.1|72742_72964_-	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	82.2	2.1e-30
WP_074433679.1|72997_73168_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_106959190.1|73303_73456_-|holin	antiholin	holin	Q71TR5	Escherichia_phage	96.0	4.0e-20
WP_059331396.1|73552_74110_-	lysozyme	NA	Q71TF3	Escherichia_phage	98.4	1.8e-105
WP_000068866.1|74279_74768_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	99.4	8.5e-88
WP_106959191.1|74965_75760_+	hypothetical protein	NA	Q71TF1	Escherichia_phage	94.7	1.7e-141
WP_024231021.1|75957_77262_+	type II toxin-antitoxin system HipA family toxinoxin YjjJ	NA	NA	NA	NA	NA
WP_024231022.1|77292_77601_-	hypothetical protein	NA	Q1MVN0	Enterobacteria_phage	95.1	2.4e-48
WP_106959192.1|77590_80578_-	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	98.7	0.0e+00
WP_062863750.1|80677_81886_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	97.5	3.6e-220
WP_000175486.1|81925_82291_-	hypothetical protein	NA	A0A077SK35	Escherichia_phage	100.0	7.9e-46
WP_023442340.1|82287_84207_-	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	95.3	0.0e+00
WP_001345482.1|84208_84811_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_000580770.1|84797_85241_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	99.3	2.9e-82
WP_000887652.1|85237_85567_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_024177048.1|85457_85832_+	hypothetical protein	NA	A0A077SL44	Escherichia_phage	63.1	1.0e-24
WP_106959193.1|85864_86047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000383671.1|86418_86895_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144016.1|86938_87517_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	7.7e-96
WP_063106777.1|87516_90366_-|tail	phage tail protein	tail	Q71TP5	Escherichia_phage	94.6	0.0e+00
WP_001286326.1|90377_90812_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
WP_001189831.1|90890_91727_-	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	98.9	1.7e-152
WP_000047923.1|91726_93160_-	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	100.0	3.7e-272
WP_000002800.1|93156_93513_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_000440158.1|93512_96845_-	lytic transglycosylase domain-containing protein	NA	A0A077SK38	Escherichia_phage	89.9	0.0e+00
>prophage 1
NZ_CP027470	Escherichia coli strain 2013C-4248 plasmid unnamed6, complete sequence	80206	4498	68880	80206	transposase,integrase,protease	Stx2-converting_phage(62.07%)	64	4426:4439	6840:6853
4426:4439	attL	AATAATACAAGAGA	NA	NA	NA	NA
WP_001164205.1|4498_5281_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_000465041.1|5282_5696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012680949.1|5809_6004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012680950.1|5964_6168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077248527.1|6140_6278_+	toxin-antitoxin system, antitoxin component, AbrB family protein	NA	NA	NA	NA	NA
WP_001261287.1|6255_6486_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024219872.1|6482_6899_+	PIN domain-containing protein	NA	NA	NA	NA	NA
6840:6853	attR	AATAATACAAGAGA	NA	NA	NA	NA
WP_024219873.1|7060_7606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000704534.1|8367_9228_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
WP_001066949.1|9355_9742_+	recombinase	NA	NA	NA	NA	NA
WP_001370221.1|9782_10469_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.8e-12
WP_000631725.1|10465_10813_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_012917687.1|10816_12385_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000937603.1|12663_13851_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|13850_14216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000499131.1|14143_14527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012917687.1|15039_16608_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000631725.1|16611_16959_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_078280484.1|16955_17684_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	5.1e-12
WP_106959215.1|17667_18830_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	2.0e-167
WP_078183958.1|18801_19005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034100.1|19309_23212_-|protease	serine protease EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_094282931.1|24149_24494_-	DUF1449 domain-containing protein	NA	NA	NA	NA	NA
WP_106873571.1|24393_24600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001341409.1|26541_26862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050936755.1|27082_29803_-	NikB	NA	NA	NA	NA	NA
WP_001291056.1|29814_30147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000157095.1|30376_30712_+	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
WP_024220042.1|30797_31646_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000148286.1|32224_32476_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_077776889.1|32506_32728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000038351.1|32751_33642_-	hypothetical protein	NA	Q2A0A7	Sodalis_phage	53.8	4.4e-66
WP_106959216.1|33702_33972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218854.1|34063_34498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106959217.1|35223_35565_-	antirestriction protein	NA	NA	NA	NA	NA
WP_106959218.1|35564_35738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106959219.1|37346_38021_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|38020_38368_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_047086028.1|38387_39959_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	7.6e-170
WP_106959220.1|41324_41678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000284691.1|43637_43853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|46499_47177_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|47176_47524_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_047086028.1|47543_49115_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	7.6e-170
WP_001341455.1|49338_49821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001443814.1|50310_50529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086167.1|50528_51212_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.3e-28
WP_077249722.1|51595_52498_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000921957.1|52770_53730_+	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.9	5.4e-62
WP_000445934.1|53729_54125_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_001172748.1|55085_55475_-	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_000592771.1|55518_57729_-	Catalase-peroxidase 2	NA	NA	NA	NA	NA
WP_085947970.1|57902_59116_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_106959221.1|59167_59740_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	99.5	1.5e-104
WP_000165178.1|59739_60066_-|transposase	IS3 family transposase	transposase	Q6H9S4	Enterobacteria_phage	98.1	6.3e-55
WP_106959222.1|60871_61849_+	protein RepA	NA	J9Q7H0	Salmonella_phage	59.2	5.1e-100
WP_097448753.1|62011_62233_+	hypothetical protein	NA	B6DZU5	Stx2-converting_phage	100.0	4.6e-33
WP_001341423.1|62286_62961_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|62957_63305_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_012917687.1|63308_64877_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000937603.1|65155_66343_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|66342_66708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612591.1|66944_67292_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_063107110.1|67341_68880_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	3.5e-297
>prophage 1
NZ_CP027471	Escherichia coli strain 2013C-4248 plasmid unnamed7, complete sequence	243267	10102	52420	243267	integrase,capsid,terminase,transposase,head,tail,portal	Enterobacteria_phage(45.83%)	56	13922:13936	55819:55833
WP_000066490.1|10102_10315_+	cold-shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|10325_10514_+	cold-shock protein	NA	NA	NA	NA	NA
WP_012816753.1|10488_10719_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001019197.1|10708_10882_+	protein GnsA	NA	NA	NA	NA	NA
WP_000829674.1|10930_12004_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_106959224.1|12075_14820_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	4.1e-38
13922:13936	attL	AACTGCGCGAACTGG	NA	NA	NA	NA
WP_000533662.1|14914_15988_-|integrase	integrase	integrase	Q9G075	Enterobacteria_phage	99.7	1.3e-200
WP_001303849.1|15965_16184_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545743.1|16223_16391_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	96.4	1.6e-25
WP_000022062.1|16479_16761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050936628.1|16875_17673_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	43.6	9.8e-49
WP_000582237.1|17683_18439_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.4	2.7e-141
WP_001289866.1|18440_19079_-	hypothetical protein	NA	Q6H9Z5	Enterobacteria_phage	97.2	5.2e-93
WP_000763376.1|19075_19297_-	hypothetical protein	NA	A0A1I9LJM6	Stx_converting_phage	98.6	2.9e-35
WP_001386642.1|19395_19677_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_078186059.1|19687_19879_-	DUF1382 domain-containing protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.5e-24
WP_000682299.1|19851_20034_-	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	98.3	3.7e-28
WP_000186848.1|20030_20711_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_021550614.1|20707_21493_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	4.1e-148
WP_000995439.1|21498_21795_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_001130927.1|21868_22138_-	host cell division inhibitory peptide Kil	NA	G3CFI2	Escherichia_phage	97.8	8.7e-42
WP_000065374.1|22217_22586_-	lambda prophage-derived protein ea10	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000392425.1|22780_23230_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	88.6	1.9e-70
WP_077792759.1|23288_23681_-	regulator	NA	A0A075B8K6	Enterobacteria_phage	67.6	1.9e-29
WP_000528774.1|24043_24820_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001074606.1|24807_25350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050936742.1|25396_26110_-	LexA family transcriptional repressor	NA	A4KWV9	Enterobacteria_phage	98.7	4.5e-130
WP_000437878.1|26210_26411_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	97.0	9.6e-30
WP_085948134.1|26799_28013_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.3	7.1e-168
WP_001368620.1|28110_28998_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.6	6.8e-168
WP_000165086.1|28997_29324_-|transposase	transposase	transposase	Q6H9S4	Enterobacteria_phage	99.1	4.9e-55
WP_106959225.1|29380_31192_+|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	67.2	4.5e-251
WP_000259002.1|31175_31382_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_106959226.1|31378_32971_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	2.5e-184
WP_106912651.1|32960_34466_+	scaffolding protein	NA	A0A2I6TC87	Escherichia_phage	54.0	1.2e-100
WP_000256821.1|34502_34850_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_000522630.1|34907_35936_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000012985.1|35939_36362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078186071.1|36354_36708_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	3.3e-41
WP_000975037.1|36722_37298_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_000683072.1|37294_37690_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.8	8.5e-62
WP_001143013.1|37697_38450_+|tail	tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000479086.1|38463_38895_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533431.1|38921_39335_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000082324.1|39315_41895_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.0	0.0e+00
WP_000847371.1|41891_42221_+|tail	tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.6	2.1e-53
WP_001302649.1|42931_43252_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154346.1|43358_43532_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	98.2	9.8e-23
WP_106959234.1|43602_44526_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	97.1	1.1e-173
WP_032164489.1|44580_45318_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	2.6e-144
WP_078186077.1|45215_45887_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	88.8	5.4e-101
WP_106959227.1|45947_49430_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	88.9	0.0e+00
WP_097491834.1|49496_50096_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	6.3e-109
WP_106959228.1|50160_51474_+|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	99.5	9.7e-78
WP_001023455.1|51475_51745_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_001128393.1|51859_52420_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	68.1	3.1e-65
55819:55833	attR	CCAGTTCGCGCAGTT	NA	NA	NA	NA
>prophage 2
NZ_CP027471	Escherichia coli strain 2013C-4248 plasmid unnamed7, complete sequence	243267	178860	216288	243267	lysis,integrase,capsid,terminase,transposase,head,holin,tail	Stx2-converting_phage(37.84%)	55	181477:181529	227595:227647
WP_047086028.1|178860_180432_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	7.6e-170
WP_000624622.1|180451_180799_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|180798_181476_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
181477:181529	attL	TATTTTTGTAGAGCCGGAGGAAACAGACCAGACGGTTTAAATGAGCCGGTTAC	NA	NA	NA	NA
WP_000076381.1|181536_181998_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_000759309.1|182055_183102_-	spermidine/putrescine-binding periplasmic protein	NA	NA	NA	NA	NA
WP_000580316.1|183098_183893_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
WP_000824186.1|184201_184405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001113310.1|184382_184850_+	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_000074973.1|184926_186045_-|integrase	integrase	integrase	Q77Z04	Phage_21	44.4	2.0e-84
WP_000003742.1|186013_186283_-	excisionase	NA	NA	NA	NA	NA
WP_001090200.1|188908_189100_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_000449192.1|189096_189285_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_072095984.1|189634_189850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171966.1|189853_190072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344934.1|190101_190230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001443692.1|190231_190387_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	48.9	5.7e-06
WP_000948452.1|190705_191182_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|191306_191630_+	transcriptional regulator	NA	D0UIL8	Aggregatibacter_phage	48.0	3.9e-12
WP_000693916.1|191613_192039_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|192061_193024_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000788938.1|193030_193771_+	replication protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000450874.1|193796_194567_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.3	2.2e-82
WP_001118159.1|194582_194978_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000627694.1|195034_195619_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	86.1	1.0e-34
WP_001278450.1|195734_195839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303916.1|195827_195983_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	83.8	1.9e-09
WP_000884071.1|196027_196240_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	67.1	1.2e-17
WP_001341388.1|196407_196686_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265175.1|196687_197737_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	9.4e-108
WP_000904098.1|197749_198124_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	3.2e-34
WP_000762928.1|198120_198942_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000143049.1|200112_201963_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_085954673.1|202246_202462_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	95.8	5.0e-32
WP_032184262.1|202424_202769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001360224.1|202717_202954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303879.1|202922_203117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001003112.1|203149_203683_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_001443546.1|203760_203952_+	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	63.9	7.8e-05
WP_024173637.1|204109_204577_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.1	7.2e-68
WP_000735655.1|204600_204825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303918.1|204821_205040_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	73.3	6.4e-11
WP_000347013.1|205181_205322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302977.1|205451_205637_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000279805.1|205678_206044_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	98.3	1.2e-65
WP_000958380.1|206333_206897_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001399867.1|206893_208555_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_047086052.1|208618_210556_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.1	0.0e+00
WP_001063096.1|210600_210822_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125984.1|213348_213675_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|213685_214036_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|214032_214479_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|214475_214820_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275510.1|214886_215603_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_001030063.1|215608_215983_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001234272.1|216006_216288_+|tail	phage tail protein	tail	A0A0P0ZED8	Stx2-converting_phage	98.9	2.3e-45
227595:227647	attR	GTAACCGGCTCATTTAAACCGTCTGGTCTGTTTCCTCCGGCTCTACAAAAATA	NA	NA	NA	NA
>prophage 3
NZ_CP027471	Escherichia coli strain 2013C-4248 plasmid unnamed7, complete sequence	243267	219569	232915	243267	transposase,tail	Stx2-converting_phage(61.54%)	16	NA	NA
WP_000807944.1|219569_219911_+|tail	tail protein	tail	H6WZM2	Escherichia_phage	98.2	1.2e-61
WP_001357740.1|219910_220609_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000194767.1|220619_221363_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	3.8e-148
WP_001429073.1|221260_221941_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.1	4.8e-113
WP_032202882.1|221894_222113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106959232.1|222179_225656_+|tail	phage tail protein	tail	Q687E8	Enterobacteria_phage	95.6	0.0e+00
WP_001230514.1|225722_226322_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_106959233.1|226386_227592_+|tail	phage tail protein	tail	A0A0P0ZDE7	Stx2-converting_phage	97.5	6.2e-79
WP_071533787.1|227542_227686_-	copper resistance protein	NA	NA	NA	NA	NA
WP_001339397.1|227647_228325_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|228324_228672_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_047086028.1|228691_230263_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	7.6e-170
WP_001023483.1|230300_230570_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
WP_001443842.1|230686_230962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938124.1|231024_232386_-	type III secretion system protein	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_095585410.1|232762_232915_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
