The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027544	Escherichia coli strain 2013C-3264 chromosome, complete genome	5486407	365237	473450	5486407	terminase,tail,portal,transposase,holin,tRNA	Escherichia_phage(42.37%)	103	NA	NA
WP_000826466.1|365237_366446_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	1.6e-207
WP_001261020.1|366977_367646_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586732.1|367947_368541_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001190278.1|368537_369530_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234034.1|369653_370634_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_000140891.1|370628_371165_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|371227_371452_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375956.1|371591_373247_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013789.1|373471_374815_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414560.1|375031_375955_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001320773.1|378031_378181_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|378252_378426_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001397126.1|378670_379201_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	2.4e-19
WP_000048667.1|379389_380391_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000115939.1|380432_381872_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027938.1|382069_382870_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139563.1|383141_387044_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048948.1|387244_387850_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000890932.1|390982_391879_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000177543.1|391878_392484_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000097840.1|392782_393643_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123454.1|393872_394463_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039888.1|394444_395395_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632280.1|395495_396809_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206186.1|396835_398041_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|398040_398463_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973358.1|398452_399880_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969774.1|399881_400670_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292341.1|400669_401437_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206369.1|401433_402504_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189194.1|402511_403009_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072827.1|403023_403770_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|403778_404066_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191068.1|404077_405007_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186478.1|405291_407337_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535469.1|407584_409858_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|409913_411413_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067512.1|411648_412554_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_163426704.1|412725_413055_-	DUF1318 domain-containing protein	NA	NA	NA	NA	NA
WP_000698145.1|413059_413245_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900979.1|413241_415881_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762231.1|416088_417078_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	43.7	1.6e-69
WP_001298828.1|417188_417611_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|417607_417874_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628200.1|418147_421672_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837962.1|422038_423172_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	4.1e-117
WP_001295593.1|423312_423747_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001023420.1|424547_424817_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_078267904.1|424818_426132_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	3.9e-79
WP_001230517.1|426196_426796_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	1.7e-109
WP_139358546.1|430584_431217_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.4	6.3e-99
WP_001365018.1|431162_431906_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.8	2.7e-149
WP_001151061.1|431916_432615_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	98.3	1.4e-131
WP_000847298.1|432614_432944_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918271.1|432940_435586_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.5	0.0e+00
WP_000532075.1|435629_435938_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000479059.1|435964_436387_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	97.9	1.3e-71
WP_000235090.1|436400_437153_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|437160_437559_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|437571_438195_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|438197_438479_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|438471_438798_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_000974567.1|440853_442356_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	1.2e-289
WP_000102415.1|442355_442568_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077625.1|442564_444688_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000373407.1|444684_445161_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816791.1|445637_445823_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|446050_446197_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|446196_446766_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087730.1|447036_447570_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
WP_001072901.1|447574_447790_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|447867_448113_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143463.1|448153_448333_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_106898769.1|448468_450415_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.6	0.0e+00
WP_001502553.1|451121_451664_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.0	1.1e-75
WP_000228020.1|451660_451951_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_001502554.1|451950_452550_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	7.7e-107
WP_000687443.1|452609_452783_-	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	72.2	7.3e-18
WP_000818161.1|452983_453469_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000119356.1|453487_453667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024175526.1|453877_454090_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	4.0e-26
WP_001278450.1|454278_454383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072616987.1|454498_455161_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	54.5	9.5e-74
WP_103654569.1|455674_456295_-	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	70.8	2.4e-58
WP_072616986.1|456281_457034_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.6	1.8e-76
WP_000788990.1|457055_457802_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	2.8e-114
WP_000702023.1|458677_459100_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_000171139.1|459083_459359_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	65.9	1.4e-23
WP_001253182.1|459463_459928_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	69.5	1.2e-54
WP_001169149.1|460308_460461_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	57.4	2.1e-08
WP_000935592.1|460889_461738_+	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	60.8	5.9e-60
WP_000560228.1|461784_462006_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.4e-37
WP_065336296.1|462005_462176_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	1.0e-16
WP_001502427.1|462249_462525_+	bacteriophage protein	NA	A0A0U2QW85	Escherichia_phage	95.6	5.2e-42
WP_042963503.1|462626_465227_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.2	6.7e-248
WP_001502425.1|465219_466029_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_001302840.1|466272_466461_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079602.1|466560_466776_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	98.6	2.3e-37
WP_001358842.1|466777_468013_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.5	2.3e-238
WP_001157382.1|468064_469000_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.6	5.4e-147
WP_000123751.1|469128_470502_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	8.6e-53
WP_000387388.1|470979_471963_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001397124.1|472217_473450_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 2
NZ_CP027544	Escherichia coli strain 2013C-3264 chromosome, complete genome	5486407	549991	593477	5486407	head,terminase,tail,transposase,holin,protease	Enterobacteria_phage(25.93%)	43	NA	NA
WP_000422045.1|549991_551041_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559280.1|551260_552019_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_001278904.1|552015_552606_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|552645_553518_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|553618_554239_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|554235_555117_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|555254_555299_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194590.1|555390_556953_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|556952_558548_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_000983912.1|558548_559910_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000209520.1|559921_561115_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|561114_561921_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|562301_562481_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|562566_563067_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|563112_563619_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_104770229.1|565916_567079_-|transposase	IS3-like element IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	2.4e-51
WP_000938103.1|567340_567910_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|567975_568887_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|568993_569116_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_106409363.1|572197_572392_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	87.2	1.1e-09
WP_000767050.1|572336_572879_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_001023460.1|573099_573369_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	97.8	7.1e-44
WP_001216293.1|574747_575371_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.8	1.0e-69
WP_085947772.1|576745_577958_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_096847500.1|577951_578071_-|head	head protein	head	A0A0P0ZAJ3	Stx2-converting_phage	89.7	1.2e-11
WP_000958380.1|579793_580357_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001372000.1|580646_581012_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	1.6e-62
WP_000074669.1|581053_581278_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|581359_581674_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208681.1|582200_582386_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_047661548.1|582602_583100_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_024164617.1|583099_583315_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_106898770.1|583752_585603_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.8	0.0e+00
WP_094189061.1|585916_586072_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	70.2	2.1e-08
WP_001059384.1|587121_587811_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000140002.1|587807_588173_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_010917803.1|589231_589510_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|589579_589837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|590057_590270_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001449026.1|590548_591307_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_122368318.1|592005_592170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450692.1|592166_592901_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_157910803.1|592934_593477_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	8.3e-84
>prophage 3
NZ_CP027544	Escherichia coli strain 2013C-3264 chromosome, complete genome	5486407	705424	768987	5486407	terminase,head,tail,integrase,lysis,holin,capsid,transposase,portal,tRNA	Escherichia_phage(39.13%)	81	742936:742952	764961:764977
WP_001297484.1|705424_706531_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|706566_707208_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|707211_708582_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265480.1|708749_709421_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|709420_710881_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|711482_711764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024199540.1|712019_712562_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	5.1e-33
WP_000224599.1|712767_713181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380886.1|713193_713529_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907455.1|713541_714597_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.7	3.5e-70
WP_000796958.1|714596_714803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132079.1|715054_715279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233304.1|715405_715678_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126687.1|715688_716099_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000192401.1|716095_716347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833618.1|716547_717948_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	9.6e-116
WP_000770175.1|717944_718244_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001204981.1|718249_718483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000336167.1|718475_718940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012816761.1|718929_719958_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000953272.1|720015_720204_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085258.1|720569_721799_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	8.4e-132
WP_000456506.1|722047_723169_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359462.1|723217_724444_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|724692_725829_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000799399.1|725812_726676_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001132165.1|726949_727540_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_001144083.1|727722_728373_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	6.1e-25
WP_012816780.1|729632_730268_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001118085.1|730335_730917_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_001131641.1|731207_731783_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.0	1.6e-56
WP_001023459.1|731895_732165_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_044707391.1|733730_734084_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	96.6	4.2e-60
WP_096847439.1|734095_734491_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	90.9	4.5e-55
WP_000118191.1|734532_735558_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	95.9	2.4e-185
WP_000201478.1|735613_735946_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_032313133.1|735955_737287_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	97.7	1.5e-230
WP_001680328.1|737267_738869_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	3.6e-308
WP_000198153.1|738865_739072_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_106898771.1|739068_740994_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.8	0.0e+00
WP_000453587.1|740968_741514_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001339565.1|741941_742082_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	84.8	1.0e-14
WP_000828067.1|742214_742541_-	TonB family protein	NA	H6WZK5	Escherichia_phage	97.2	1.4e-54
742936:742952	attL	TTGTGGTGATGATGTCA	NA	NA	NA	NA
WP_157778920.1|743216_743447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000092312.1|743563_744001_-|lysis	lysis protein	lysis	B9UDJ2	Salmonella_phage	95.9	6.1e-69
WP_001135298.1|743997_744495_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	3.8e-91
WP_024164617.1|744494_744710_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_106898772.1|744994_746845_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_001344632.1|747287_747419_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_000193722.1|748513_749392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000024154.1|749641_750028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000532208.1|750041_750392_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	86.6	2.3e-55
WP_001217418.1|750381_750753_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.6	8.9e-37
WP_001265036.1|750765_751815_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.2	1.2e-110
WP_032313142.1|751816_752095_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	9.7e-12
WP_000902687.1|752262_752475_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|752661_752766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137957.1|752875_753439_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	93.9	2.9e-47
WP_001273106.1|753565_753877_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001375713.1|753873_754026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|754058_754415_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|754411_754636_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450612.1|754657_755356_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.1	4.7e-71
WP_000373320.1|755390_755813_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_001262408.1|755844_756882_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	67.1	1.7e-85
WP_000693816.1|756950_757376_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|757372_757600_-	cell division protein	NA	NA	NA	NA	NA
WP_000444615.1|757697_758342_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|758617_758770_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449192.1|759267_759456_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|759452_759644_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001358072.1|759736_762208_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.7	1.1e-58
WP_000003742.1|762269_762539_+	excisionase	NA	NA	NA	NA	NA
WP_000074974.1|762507_763626_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.4	2.6e-84
WP_001113311.1|763702_764170_-	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.5	5.8e-09
WP_000824186.1|764147_764351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000580316.1|764659_765454_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
764961:764977	attR	TTGTGGTGATGATGTCA	NA	NA	NA	NA
WP_000759317.1|765450_766497_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_001397092.1|766554_767016_+	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_000713472.1|767012_767801_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_000399648.1|768006_768987_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP027544	Escherichia coli strain 2013C-3264 chromosome, complete genome	5486407	912115	976822	5486407	head,terminase,tail,integrase,holin,capsid,transposase,portal,protease	Enterobacteria_phage(33.33%)	73	920024:920041	977532:977549
WP_000003671.1|912115_912703_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|912699_913407_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|913425_915219_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|915215_916334_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001443410.1|916951_917335_+	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
WP_106898774.1|917780_918815_+	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_106898775.1|918941_919190_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.8	4.0e-41
WP_044704713.1|919211_920525_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	2.0e-78
920024:920041	attL	CGGCTGCACTTTCTGCCG	NA	NA	NA	NA
WP_044705270.1|920584_921184_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	98.0	4.8e-109
WP_106898776.1|921250_924730_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.2	0.0e+00
WP_000649829.1|924863_925391_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_136757659.1|925581_926214_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	95.7	1.2e-102
WP_001443265.1|926159_926903_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	3.6e-146
WP_001443264.1|926913_927612_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.1e-131
WP_000847298.1|927611_927941_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082480.1|927937_930517_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.5	0.0e+00
WP_000533402.1|930497_930911_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479116.1|930937_931369_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_021528565.1|931382_932135_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.8	1.1e-134
WP_000683079.1|932142_932538_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974983.1|932534_933068_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.1	1.3e-57
WP_096847462.1|933083_933437_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	3.3e-41
WP_000201512.1|933429_933813_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522623.1|933864_934893_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000256821.1|934950_935298_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_001253987.1|935334_936840_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.6e-100
WP_001397759.1|936829_938422_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	5.5e-184
WP_000259002.1|938418_938625_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_012816750.1|938608_940537_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	3.6e-262
WP_000235436.1|940508_941018_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001444498.1|941409_941634_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.3e-19
WP_001303878.1|941715_942030_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|942557_942743_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|942964_943078_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|943298_943832_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|943991_944264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024182511.1|944519_944735_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_106898777.1|945174_947025_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.8	0.0e+00
WP_000261909.1|947792_948506_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917749.1|948643_948841_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000265267.1|949126_949945_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090265.1|950097_950469_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|950458_950830_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265133.1|950842_951892_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001341388.1|951893_952172_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000902696.1|952339_952552_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_001278454.1|952740_952845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207985.1|952960_953830_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.5	2.8e-118
WP_000224233.1|953840_954104_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000935420.1|954355_954568_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000403777.1|954618_954975_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_001209480.1|954952_955414_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001443273.1|955410_955707_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	1.7e-46
WP_001151137.1|955703_956126_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	4.4e-64
WP_044718774.1|956166_957237_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_000693883.1|957308_957734_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|957717_958041_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|958165_958642_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001443327.1|958960_959116_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_001358071.1|959497_959662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|960068_960257_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|960253_960445_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001358072.1|960537_963009_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.7	1.1e-58
WP_000003742.1|963070_963340_+	excisionase	NA	NA	NA	NA	NA
WP_000074974.1|963308_964427_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.4	2.6e-84
WP_001113311.1|964503_964971_-	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.5	5.8e-09
WP_000824186.1|964948_965152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|966797_967178_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|967174_967522_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_025380472.1|967571_969110_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	1.9e-298
WP_157719312.1|976046_976358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801847.1|976377_976467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044683470.1|976573_976822_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.8	1.2e-40
977532:977549	attR	CGGCTGCACTTTCTGCCG	NA	NA	NA	NA
>prophage 5
NZ_CP027544	Escherichia coli strain 2013C-3264 chromosome, complete genome	5486407	983187	1027891	5486407	head,terminase,tail,lysis,capsid,holin,protease	Stx2-converting_phage(33.33%)	66	NA	NA
WP_001443504.1|983187_983931_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	94.3	1.7e-143
WP_000807964.1|984633_984975_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_173909677.1|986860_987463_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	76.4	9.6e-57
WP_173909678.1|987501_988206_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	98.3	1.3e-113
WP_001453698.1|988257_988467_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|988562_988937_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|988942_989659_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001007889.1|990498_990849_-|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_001063025.1|993711_993933_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173079.1|993977_995915_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_001368653.1|995978_997640_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.3	0.0e+00
WP_000958380.1|997636_998200_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_024224188.1|998494_998860_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	97.5	5.4e-63
WP_000095741.1|998901_999102_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_001283921.1|999394_999652_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|999648_1000146_-	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092313.1|1000348_1000786_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_053879799.1|1000782_1001280_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.0	1.1e-90
WP_024164617.1|1001279_1001495_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000023188.1|1001778_1003629_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	98.4	0.0e+00
WP_001299632.1|1004107_1004539_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	98.6	7.8e-69
WP_000498121.1|1004728_1004938_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.5e-20
WP_000735807.1|1004990_1005215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001064891.1|1006035_1006704_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.6	6.0e-60
WP_001008182.1|1006700_1007063_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PJW5	Enterobacteria_phage	98.3	1.1e-60
WP_000002240.1|1007059_1007350_-	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	99.0	1.0e-51
WP_106898780.1|1007349_1008072_-	phage antirepressor KilAC domain-containing protein	NA	Q4A1A3	Enterobacteria_phage	92.5	3.5e-122
WP_000235318.1|1008146_1008851_-	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	90.6	3.2e-120
WP_001254256.1|1009128_1009311_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153280.1|1009307_1009835_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|1009831_1010278_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000103679.1|1010480_1010696_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000130.1|1010828_1011107_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000145935.1|1011177_1011468_-	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_000788928.1|1011464_1012166_-	Replication protein P	NA	C1JJ58	Enterobacteria_phage	100.0	3.4e-130
WP_000185464.1|1012162_1013062_-	replication protein	NA	M1FN81	Enterobacteria_phage	99.0	1.2e-172
WP_000438541.1|1013094_1013391_-	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_001180318.1|1013529_1013757_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|1013835_1014543_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885202.1|1014603_1014945_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	100.0	5.1e-63
WP_001221211.1|1015012_1015474_+	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000957426.1|1015467_1016514_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000745483.1|1016516_1016681_+	hypothetical protein	NA	G9L672	Escherichia_phage	100.0	5.1e-21
WP_000198444.1|1017169_1017553_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167595.1|1017611_1018082_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065377.1|1018232_1018601_+	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001198861.1|1018673_1018838_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372941.1|1018806_1018950_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_000995422.1|1019025_1019322_+	host-nuclease inhibitor protein Gam	NA	A0A1U9AJD6	Stx1_converting_phage	100.0	2.1e-49
WP_000100862.1|1019327_1020113_+	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	98.9	3.4e-147
WP_000187061.1|1020109_1020790_+	YqaJ viral recombinase family protein	NA	V5UT69	Shigella_phage	97.8	8.7e-131
WP_000682305.1|1020786_1020969_+	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	98.3	2.8e-28
WP_000548517.1|1020941_1021133_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001386642.1|1021143_1021425_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763363.1|1021523_1021745_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_173909682.1|1021915_1022512_+	ead/Ea22-like family protein	NA	Q6H9Z5	Enterobacteria_phage	99.5	3.2e-105
WP_001014300.1|1022513_1022705_+	hypothetical protein	NA	Q6H9Z6	Enterobacteria_phage	100.0	1.2e-26
WP_000206819.1|1022707_1023298_+	DUF551 domain-containing protein	NA	Q6H9Z7	Enterobacteria_phage	100.0	4.3e-118
WP_000457728.1|1023385_1023628_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556584.1|1023631_1023766_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	9.3e-21
WP_001193437.1|1023784_1024039_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063644.1|1024072_1025359_+	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	99.8	2.9e-252
WP_029208330.1|1025379_1026081_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.0e-102
WP_001216963.1|1026140_1026248_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1026228_1026960_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569363.1|1026964_1027891_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 6
NZ_CP027544	Escherichia coli strain 2013C-3264 chromosome, complete genome	5486407	1233513	1365979	5486407	head,terminase,tail,integrase,lysis,holin,capsid,transposase,portal,tRNA	Enterobacteria_phage(41.44%)	151	1230640:1230657	1327375:1327392
1230640:1230657	attL	ACCGCCAGCACGCGCCCG	NA	NA	NA	NA
WP_001283581.1|1233513_1234326_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|1234325_1235339_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|1235404_1236541_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615813.1|1236639_1237635_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127743.1|1237631_1238810_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|1239093_1240314_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683790.1|1240472_1242479_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|1242599_1242878_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089241.1|1242911_1243460_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|1243459_1244269_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043811.1|1244268_1245093_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|1245096_1246182_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|1246216_1247149_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|1247314_1247866_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_000399648.1|1248059_1249040_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001356216.1|1249266_1250139_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730291.1|1250125_1250650_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822649.1|1250646_1251117_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000842082.1|1251113_1251662_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001281612.1|1251636_1252389_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112823.1|1252408_1255051_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|1255132_1255696_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|1256379_1256865_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000424995.1|1257067_1259212_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531956.1|1259211_1260522_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|1260701_1260986_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|1261357_1262698_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937816.1|1263061_1264120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776762.1|1264301_1265057_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|1265350_1266283_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958682.1|1266594_1267752_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.5	6.3e-222
WP_000246062.1|1268455_1269199_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000022458.1|1270349_1271003_+	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_106898781.1|1271327_1272341_+	Tir-cytoskeleton coupling protein TccP	NA	NA	NA	NA	NA
WP_001023407.1|1272466_1272736_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_106898782.1|1272737_1274054_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	97.9	6.5e-74
WP_044705270.1|1274113_1274713_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	98.0	4.8e-109
WP_085947772.1|1277983_1279197_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000649829.1|1279646_1280174_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_001443265.1|1280941_1281685_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	3.6e-146
WP_001443264.1|1281695_1282394_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.1e-131
WP_000847298.1|1282393_1282723_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082480.1|1282719_1285299_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.5	0.0e+00
WP_000533402.1|1285279_1285693_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479116.1|1285719_1286151_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000235110.1|1286164_1286917_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_106898783.1|1286924_1287320_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	3.2e-69
WP_000752994.1|1287905_1288259_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|1288270_1288666_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063275.1|1288707_1289733_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	1.1e-190
WP_001299443.1|1289788_1290121_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123236.1|1290130_1291450_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_001356819.1|1291430_1293032_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000198149.1|1293028_1293235_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_033803811.1|1293231_1295157_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453587.1|1295131_1295677_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001303940.1|1296065_1296290_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|1296371_1296686_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|1297212_1297398_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|1297620_1297767_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|1297766_1298336_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_001092860.1|1298606_1299140_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
WP_000284516.1|1299702_1299918_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_001290231.1|1299994_1300267_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143464.1|1300307_1300487_-	DUF1378 family protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
WP_106898784.1|1300621_1302559_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	97.1	0.0e+00
WP_000466957.1|1303037_1303469_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000301797.1|1303919_1304633_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|1304767_1304965_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|1305189_1305744_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_044705114.1|1306124_1307174_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	3.4e-110
WP_000191872.1|1307175_1307448_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|1307569_1307914_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|1308033_1308246_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|1308479_1309037_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|1309038_1309257_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000034815.1|1309384_1309696_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000699809.1|1309688_1309916_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_042353845.1|1309912_1310194_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	72.5	3.9e-29
WP_000450617.1|1310226_1310943_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_000788760.1|1310964_1311711_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_001262348.1|1311717_1312800_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000693883.1|1312871_1313297_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391948.1|1313280_1313562_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362152.1|1313661_1314081_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_001345283.1|1314347_1314500_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000394546.1|1314511_1315150_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|1315150_1315360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|1315930_1316119_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|1316115_1316307_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_106898785.1|1316399_1318871_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.2	1.7e-59
WP_000096346.1|1318929_1319133_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533625.1|1319132_1320158_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.0e-103
WP_001443332.1|1321131_1321713_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	92.7	8.0e-101
WP_106898786.1|1321712_1324739_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	82.1	7.2e-68
WP_044684157.1|1324803_1325403_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	98.5	2.8e-109
WP_071529460.1|1328926_1329559_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
1327375:1327392	attR	ACCGCCAGCACGCGCCCG	NA	NA	NA	NA
WP_000140700.1|1329495_1330239_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001154410.1|1330244_1330943_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	2.8e-132
WP_000847386.1|1330942_1331272_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.6	3.5e-53
WP_000840231.1|1331268_1333818_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.6	0.0e+00
WP_000459458.1|1333810_1334245_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000479164.1|1334226_1334649_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_096847747.1|1334664_1335405_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	2.9e-132
WP_000683138.1|1335412_1335808_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_000975096.1|1335804_1336383_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_098030155.1|1336393_1336747_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	1.1e-60
WP_096847439.1|1336758_1337154_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	90.9	4.5e-55
WP_000118191.1|1337195_1338221_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	95.9	2.4e-185
WP_000201478.1|1338276_1338609_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_032313133.1|1338618_1339950_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	97.7	1.5e-230
WP_001680328.1|1339930_1341532_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	3.6e-308
WP_000198153.1|1341528_1341735_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_106898787.1|1341731_1343657_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.8	0.0e+00
WP_001443307.1|1344564_1344759_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	3.3e-27
WP_000881324.1|1344946_1345564_-	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	85.9	1.5e-92
WP_001299305.1|1345713_1346151_-|lysis	lysis protein	lysis	K7P6J0	Enterobacteria_phage	93.8	6.7e-68
WP_001135298.1|1346147_1346645_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	3.8e-91
WP_000284515.1|1346644_1346860_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_033816266.1|1347002_1347401_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|1347481_1347640_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|1347725_1348469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|1348721_1349345_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|1349341_1350007_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223933.1|1350003_1350606_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.1	1.2e-91
WP_001108084.1|1350580_1351147_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_029208361.1|1352632_1353460_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	98.9	1.7e-149
WP_001254221.1|1353963_1354146_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
WP_000153270.1|1354142_1354670_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_000810176.1|1354666_1355113_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000229809.1|1355120_1355327_-	hypothetical protein	NA	G9L683	Escherichia_phage	94.1	1.1e-25
WP_000145894.1|1355399_1355690_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	97.9	3.1e-45
WP_032313406.1|1355686_1356388_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	2.2e-129
WP_000147910.1|1356384_1357404_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	65.0	2.1e-112
WP_001191452.1|1357400_1357940_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	67.2	2.3e-62
WP_000184665.1|1357970_1358198_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_024199487.1|1358308_1359001_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.7	1.6e-108
WP_000338655.1|1359074_1360016_+	hypothetical protein	NA	Q8LTB7	Lactobacillus_phage	33.1	9.8e-32
WP_000233576.1|1360492_1360699_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_032313404.1|1360774_1361071_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.1e-49
WP_032313051.1|1361076_1361862_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.2	1.5e-147
WP_000186713.1|1361858_1362539_+	YqaJ viral recombinase family protein	NA	Q6H9Z0	Enterobacteria_phage	99.1	1.8e-131
WP_000682310.1|1362535_1362694_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	98.1	1.5e-22
WP_000581110.1|1362690_1363443_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	99.2	2.7e-149
WP_000151207.1|1363450_1363666_+	hypothetical protein	NA	M1FPM2	Enterobacteria_phage	97.2	8.5e-32
WP_000763378.1|1363764_1363986_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.3	8.4e-35
WP_001289880.1|1363982_1364399_+	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	86.6	1.7e-28
WP_001274536.1|1364400_1365069_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.1	1.4e-51
WP_000022062.1|1365183_1365465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545737.1|1365553_1365721_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_001163428.1|1365778_1365979_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
>prophage 7
NZ_CP027544	Escherichia coli strain 2013C-3264 chromosome, complete genome	5486407	1581794	1675409	5486407	terminase,tail,integrase,holin,transposase,portal,tRNA	Enterobacteria_phage(66.07%)	99	1627683:1627709	1675542:1675568
WP_001298974.1|1581794_1582532_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|1582663_1583998_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000399648.1|1584268_1585249_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001443508.1|1585485_1586367_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|1586469_1587057_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|1587112_1587496_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|1587800_1588490_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997393.1|1588537_1589575_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1589781_1590201_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001397332.1|1590269_1590968_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082964.1|1590999_1593660_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949279.1|1593773_1595129_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|1595174_1595498_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|1595494_1596793_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|1602649_1605223_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|1605352_1606084_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079107.1|1606080_1607061_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|1607195_1607933_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|1608203_1608545_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|1608648_1608696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|1608794_1609955_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|1609997_1611119_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|1611129_1612200_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000976004.1|1612409_1612775_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|1612924_1613443_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969042.1|1613432_1614659_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|1614674_1615157_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|1615233_1615581_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|1615621_1616389_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|1616419_1616968_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|1616986_1617235_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|1617483_1618845_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001443472.1|1619011_1619803_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077630901.1|1619823_1621110_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287917.1|1621232_1621838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300112.1|1621872_1622463_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|1622584_1623463_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880955.1|1623548_1625210_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|1625358_1625700_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|1625761_1626052_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600189.1|1626041_1626518_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|1626649_1627132_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1627683:1627709	attL	CGGGTTCAACTCCCGCCAGCTCCACCA	NA	NA	NA	NA
WP_000403938.1|1627907_1628471_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	71.0	1.4e-73
WP_024199529.1|1628478_1629903_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	50.5	1.4e-58
WP_001443470.1|1629943_1630525_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	6.8e-100
WP_106898789.1|1630524_1633596_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	81.4	2.1e-67
WP_001707087.1|1633660_1634260_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	9.7e-110
WP_106898790.1|1634329_1637743_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	86.2	0.0e+00
WP_123006813.1|1637981_1638614_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.9	1.4e-98
WP_001443526.1|1638559_1639303_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.7	3.6e-146
WP_001371281.1|1639308_1640007_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	2.6e-130
WP_000847298.1|1640006_1640336_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000532075.1|1643020_1643329_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000479043.1|1643355_1643778_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|1643791_1644544_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|1644551_1644950_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|1644962_1645586_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_106898791.1|1645588_1645861_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	96.7	3.6e-43
WP_001097065.1|1645860_1646187_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_173909679.1|1648242_1648419_-	hypothetical protein	NA	Q9EYD2	Enterobacteria_phage	98.3	1.4e-24
WP_106898792.1|1648419_1649745_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	3.8e-255
WP_000102415.1|1649744_1649957_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077625.1|1649953_1652077_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|1652073_1652550_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_100209512.1|1652582_1652855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032313457.1|1653010_1653235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|1653320_1653506_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000459342.1|1653727_1653865_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	95.6	3.7e-17
WP_000087716.1|1654023_1654557_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	4.5e-98
WP_000284506.1|1654561_1654777_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290233.1|1654853_1655099_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	90.1	2.2e-15
WP_000142777.1|1655139_1655319_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_052933920.1|1655455_1657402_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	97.2	0.0e+00
WP_000752026.1|1657901_1658171_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|1658180_1659128_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000646552.1|1659702_1660755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001041173.1|1660755_1661148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000969104.1|1661144_1661810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001064804.1|1662186_1662444_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	97.5	2.9e-34
WP_000625371.1|1662440_1663841_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	94.1	1.1e-247
WP_000988198.1|1663837_1664716_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	89.3	4.3e-130
WP_001247833.1|1664726_1665635_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	95.7	4.4e-61
WP_000621197.1|1665621_1665855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000336162.1|1665851_1666085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000622008.1|1666077_1666737_-	ash family protein	NA	Q8W643	Enterobacteria_phage	71.1	2.8e-81
WP_000620815.1|1666733_1667393_-	ash family protein	NA	Q8W643	Enterobacteria_phage	89.4	1.4e-104
WP_001193680.1|1667410_1667620_-	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_000973321.1|1667619_1668474_-	ORF6N domain-containing protein	NA	Q8W644	Enterobacteria_phage	55.6	9.2e-45
WP_001443464.1|1668550_1668811_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001434065.1|1668946_1669672_+	helix-turn-helix transcriptional regulator	NA	K7P7I4	Enterobacteria_phage	61.2	6.7e-81
WP_001201869.1|1669805_1670504_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	59.8	2.3e-22
WP_000141094.1|1670866_1671073_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	95.6	3.4e-30
WP_000660644.1|1671271_1671460_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	98.4	1.3e-28
WP_001443463.1|1671456_1672038_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	90.7	4.1e-105
WP_000755594.1|1672400_1673228_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	98.5	1.4e-130
WP_001443462.1|1673268_1673640_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	95.1	4.7e-62
WP_000457714.1|1673671_1673914_+	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	92.5	3.2e-35
WP_001030140.1|1673917_1674064_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	91.7	1.6e-21
WP_001406060.1|1674236_1675409_+|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	87.9	2.2e-198
1675542:1675568	attR	CGGGTTCAACTCCCGCCAGCTCCACCA	NA	NA	NA	NA
>prophage 8
NZ_CP027544	Escherichia coli strain 2013C-3264 chromosome, complete genome	5486407	1755204	1762344	5486407		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|1755204_1757766_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141347.1|1757871_1758528_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001297141.1|1758578_1759346_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847712.1|1759541_1760450_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.4	1.3e-118
WP_000590382.1|1760446_1761709_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	1.4e-134
WP_001278994.1|1761705_1762344_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 9
NZ_CP027544	Escherichia coli strain 2013C-3264 chromosome, complete genome	5486407	2192551	2271484	5486407	protease,tRNA,transposase	Escherichia_phage(21.05%)	60	NA	NA
WP_000708501.1|2192551_2193790_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
WP_001305111.1|2193952_2194774_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001397406.1|2194864_2195233_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_001272796.1|2195337_2195955_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_000986797.1|2197106_2198018_+	L(+)-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
WP_000722957.1|2198014_2198620_+	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
WP_000804909.1|2198668_2200132_+	L-tartrate/succinate antiporter	NA	NA	NA	NA	NA
WP_001264366.1|2200174_2201188_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|2201424_2201640_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918841.1|2201750_2203496_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.4e-76
WP_000437371.1|2203690_2205532_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228940.1|2205609_2206116_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001274557.1|2206415_2207261_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000772026.1|2207345_2207543_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001054228.1|2207562_2208051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854687.1|2208047_2208428_-	toxin	NA	NA	NA	NA	NA
WP_001443392.1|2208516_2208885_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_001220313.1|2208959_2209181_-	DUF987 domain-containing protein	NA	A0A1U8V471	Klebsiella_phage	43.1	7.2e-10
WP_001186714.1|2209249_2209726_-	RadC family protein	NA	NA	NA	NA	NA
WP_001397416.1|2209741_2210215_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.5	1.1e-12
WP_000848828.1|2213999_2214410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348967.1|2214425_2214668_-	DNA polymerase III subunit gamma/tau	NA	NA	NA	NA	NA
WP_077252115.1|2214677_2214908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000203527.1|2216304_2217210_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000544707.1|2217206_2219603_-	dynamin family protein	NA	NA	NA	NA	NA
WP_000282124.1|2221022_2221205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358663.1|2223878_2225075_+|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_000301248.1|2225189_2225765_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|2225833_2226412_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|2226460_2227501_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|2227523_2227979_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_044782296.1|2228001_2229183_-	TerD family protein	NA	NA	NA	NA	NA
WP_000254140.1|2229157_2229739_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|2230061_2231120_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001280118.1|2231129_2232272_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|2232264_2233038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|2233039_2234119_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|2234118_2235075_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506894.1|2235085_2236294_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|2236311_2236779_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|2237039_2237369_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957247.1|2237355_2237736_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001443493.1|2240851_2241523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135714.1|2242388_2242529_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	3.1e-11
WP_000803992.1|2242830_2243094_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_169072766.1|2243519_2244733_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_000035067.1|2248574_2248763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612591.1|2250417_2250765_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2250761_2251142_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_162829241.1|2257889_2259102_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001021388.1|2259442_2260060_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001142971.1|2260071_2260746_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966484.1|2260746_2261211_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000065688.1|2261220_2262924_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_000612149.1|2262916_2263237_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|2263245_2263548_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_162829241.1|2264382_2265596_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_024224169.1|2266530_2268150_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|2268242_2268602_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_173909680.1|2270271_2271484_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.6	1.1e-168
>prophage 10
NZ_CP027544	Escherichia coli strain 2013C-3264 chromosome, complete genome	5486407	3344103	3393994	5486407	terminase,head,tail,integrase,holin,capsid,portal,tRNA	Enterobacteria_phage(36.0%)	58	3384852:3384866	3398600:3398614
WP_000390070.1|3344103_3344277_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	94.6	8.3e-22
WP_001128527.1|3344415_3345450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093922.1|3345641_3345923_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	94.6	2.0e-41
WP_001075213.1|3345963_3346830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000008182.1|3346938_3347463_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.3	4.1e-96
WP_000081299.1|3347590_3348415_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	98.9	5.0e-149
WP_000135680.1|3348480_3348843_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000859461.1|3349508_3350183_-	LexA family transcriptional regulator	NA	Q8SBF6	Shigella_phage	99.6	1.3e-131
WP_000649477.1|3350273_3350474_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_001250270.1|3351243_3351456_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	5.4e-15
WP_000054957.1|3351412_3352405_+	hypothetical protein	NA	U5P0A0	Shigella_phage	98.2	1.2e-93
WP_001355692.1|3352499_3353153_+	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	1.1e-127
WP_000210151.1|3353149_3353476_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	99.1	2.0e-53
WP_000767110.1|3353472_3353868_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_001072676.1|3354019_3354835_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	1.9e-148
WP_001223333.1|3354850_3355366_+	hypothetical protein	NA	V5URU3	Shigella_phage	29.1	2.7e-15
WP_001443262.1|3355375_3356365_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	2.0e-192
WP_001204806.1|3356382_3356763_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_000917759.1|3356978_3357131_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	1.1e-17
WP_106898800.1|3358308_3360075_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	94.2	0.0e+00
WP_024164617.1|3360513_3360729_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000992167.1|3361127_3361661_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_001056806.1|3361931_3362501_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|3362500_3362647_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|3362869_3363055_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|3363580_3363895_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|3363976_3364201_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000235436.1|3364592_3365102_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|3366984_3367191_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001397759.1|3367187_3368780_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	5.5e-184
WP_001253987.1|3368769_3370275_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.6e-100
WP_000256821.1|3370311_3370659_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_055278166.1|3370716_3371745_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.9	2.4e-116
WP_072187772.1|3371786_3372182_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	7.0e-56
WP_098030155.1|3372193_3372547_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	1.1e-60
WP_000975096.1|3372558_3373137_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683137.1|3373133_3373529_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235110.1|3373536_3374289_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479116.1|3374302_3374734_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000533402.1|3374760_3375174_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082480.1|3375154_3377734_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.5	0.0e+00
WP_000847298.1|3377730_3378060_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001443264.1|3378059_3378758_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.1e-131
WP_001443265.1|3378768_3379512_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	3.6e-146
WP_123055119.1|3379457_3380090_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.2	2.7e-102
WP_001230409.1|3383786_3384386_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	3.0e-111
WP_044723102.1|3384450_3385764_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.4	8.5e-82
3384852:3384866	attL	CGGCATATCAGCCAG	NA	NA	NA	NA
WP_001023986.1|3385765_3386035_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	96.6	4.2e-44
WP_000442133.1|3386195_3386618_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.8	2.5e-72
WP_001144079.1|3386769_3387420_-	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132160.1|3387601_3388192_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_099561169.1|3388178_3388301_-	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
WP_001217547.1|3388437_3388686_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	98.8	1.2e-37
WP_000332258.1|3388747_3389845_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	8.1e-211
WP_000543841.1|3389933_3390971_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891402.1|3391104_3391347_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235516.1|3391512_3392496_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918363.1|3392578_3393994_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
3398600:3398614	attR	CTGGCTGATATGCCG	NA	NA	NA	NA
>prophage 11
NZ_CP027544	Escherichia coli strain 2013C-3264 chromosome, complete genome	5486407	3772277	3855260	5486407	tail,integrase,holin,transposase,portal,tRNA,protease	Enterobacteria_phage(46.0%)	85	3771480:3771494	3800467:3800481
3771480:3771494	attL	GCGATGGCGGAAATC	NA	NA	NA	NA
WP_001218282.1|3772277_3773495_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	99.8	4.5e-239
WP_000421881.1|3773628_3775761_+	hypothetical protein	NA	A5LH58	Enterobacteria_phage	99.7	0.0e+00
WP_000214790.1|3776062_3776683_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	100.0	2.1e-123
WP_001242700.1|3776682_3777045_-	hypothetical protein	NA	A5LH61	Enterobacteria_phage	100.0	5.6e-68
WP_000008174.1|3777035_3777572_-	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
WP_000081301.1|3777699_3778524_-	YfdQ family protein	NA	A5LH63	Enterobacteria_phage	100.0	2.7e-150
WP_000135679.1|3778589_3778952_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	5.6e-60
WP_000981537.1|3779409_3780063_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_001231956.1|3780158_3780356_+	Cro/Cl family transcriptional regulator	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000514174.1|3780383_3780968_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
WP_001250270.1|3781143_3781356_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	5.4e-15
WP_024224482.1|3781312_3782305_+	hypothetical protein	NA	U5P0A0	Shigella_phage	97.6	1.2e-93
WP_001557928.1|3782399_3783053_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	98.2	4.7e-126
WP_000767141.1|3783049_3783439_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	99.2	1.6e-68
WP_001061427.1|3783458_3784301_+	KilA-N domain-containing protein	NA	S5MC03	Escherichia_phage	91.5	1.1e-138
WP_016230662.1|3784308_3785298_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.7	4.3e-195
WP_001047084.1|3785311_3786064_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.4	1.1e-131
WP_122985741.1|3786335_3786425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087756.1|3786479_3786692_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066482.1|3786992_3787208_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	2.6e-25
WP_000839581.1|3787961_3788177_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
WP_000189903.1|3788181_3788733_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	50.6	3.3e-35
WP_001306174.1|3788680_3788941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101175.1|3789054_3789588_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	4.2e-96
WP_001071774.1|3789584_3790082_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001372058.1|3790444_3790657_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	72.9	3.5e-22
WP_071528545.1|3790667_3790856_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|3791003_3791159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|3791331_3791505_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|3791800_3792007_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_000373417.1|3792558_3793053_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	8.4e-83
WP_001072973.1|3795150_3795363_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	7.1e-31
WP_000985939.1|3795362_3796871_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	1.0e-288
WP_001136585.1|3796815_3798843_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.2	0.0e+00
WP_001097050.1|3798929_3799253_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_000677106.1|3799531_3800110_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001079400.1|3800106_3800508_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	1.1e-72
3800467:3800481	attR	GCGATGGCGGAAATC	NA	NA	NA	NA
WP_000211113.1|3800518_3801262_+	Ig-like domain-containing protein	NA	A5LH35	Enterobacteria_phage	99.2	2.3e-132
WP_001443491.1|3801322_3801709_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	1.4e-64
WP_001161009.1|3801717_3802047_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000447253.1|3805090_3805420_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000625673.1|3805818_3806127_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.0	1.3e-54
WP_001443490.1|3806131_3806875_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	1.6e-149
WP_000741576.1|3806772_3807420_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.6	2.7e-113
WP_000515498.1|3807480_3810978_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.3	0.0e+00
WP_032313160.1|3811048_3811648_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	97.5	1.7e-109
WP_071826681.1|3811712_3814739_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	82.1	7.2e-68
WP_001443432.1|3814738_3815314_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	2.5e-102
WP_000836769.1|3816380_3816614_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_001372053.1|3816682_3816796_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_001217539.1|3817222_3817471_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000202564.1|3817690_3819277_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|3819669_3820275_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3820401_3820563_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001299799.1|3820684_3821758_+	patatin family protein	NA	NA	NA	NA	NA
WP_000563066.1|3821754_3822537_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001088395.1|3822649_3823513_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_001143248.1|3823484_3825035_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001295412.1|3825292_3826072_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000477832.1|3826198_3827521_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.5	1.5e-78
WP_000816471.1|3827572_3828796_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224877.1|3828874_3829594_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000566153.1|3829868_3830018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106898801.1|3830054_3831065_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000124615.1|3831092_3831737_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_001132955.1|3831842_3832811_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_001029698.1|3832859_3834242_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_088606679.1|3834262_3835531_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.3e-82
WP_000046749.1|3835800_3837468_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000068679.1|3839703_3840030_+	trp operon repressor	NA	NA	NA	NA	NA
WP_001443433.1|3840071_3840584_-	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_000942344.1|3840635_3841283_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_000371666.1|3841279_3842149_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000875487.1|3842359_3842833_+	protein CreA	NA	NA	NA	NA	NA
WP_001188666.1|3842845_3843535_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
WP_000920323.1|3845016_3846369_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|3846428_3847145_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001303782.1|3847240_3847381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223164.1|3847780_3848467_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001386572.1|3848680_3848746_+	thr operon leader peptide	NA	NA	NA	NA	NA
WP_001264697.1|3848826_3851289_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_000241660.1|3851290_3852223_+	homoserine kinase	NA	NA	NA	NA	NA
WP_000781063.1|3852223_3853510_+	threonine synthase	NA	NA	NA	NA	NA
WP_000738736.1|3853723_3854020_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000399648.1|3854279_3855260_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP027544	Escherichia coli strain 2013C-3264 chromosome, complete genome	5486407	4100420	4155862	5486407	plate,integrase,capsid	Enterobacteria_phage(20.0%)	52	4143128:4143148	4156005:4156025
WP_000246415.1|4100420_4101752_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|4101754_4102279_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000348793.1|4103579_4104662_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|4104625_4106476_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|4106479_4106893_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056978.1|4106899_4108375_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|4108425_4108650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037389.1|4108684_4109185_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|4109881_4110400_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103132.1|4110610_4112752_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	3.1e-25
WP_000939263.1|4117058_4117541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122985282.1|4117455_4117641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118037.1|4120310_4121078_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532695.1|4121231_4121705_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973081.1|4121747_4124192_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|4124431_4125010_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001365365.1|4125215_4125983_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|4125953_4126694_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615976.1|4126849_4127128_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|4127130_4127391_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543903.1|4127576_4128350_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001030484.1|4128406_4128763_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_000598760.1|4128755_4129034_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001298878.1|4129138_4130878_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207555.1|4130822_4131608_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226180.1|4131678_4132734_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001059855.1|4132730_4133183_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000528862.1|4133427_4134567_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	1.2e-31
WP_000602103.1|4134563_4135178_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001293016.1|4135234_4136692_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|4136952_4137411_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189543.1|4137502_4138747_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|4138804_4139206_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749865.1|4139244_4140300_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
WP_001285288.1|4140587_4141691_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893259.1|4141702_4142956_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	1.3e-95
4143128:4143148	attL	ACTCCTATTATCGGCACCATC	NA	NA	NA	NA
WP_000788776.1|4143778_4143931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001273869.1|4144481_4145033_-	recombinase family protein	NA	Q2A092	Sodalis_phage	43.9	3.2e-30
WP_000873438.1|4146571_4146754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005054.1|4146775_4146943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000610007.1|4146994_4147621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000323903.1|4147630_4147900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000532779.1|4147996_4148380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580785.1|4148437_4148641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390658.1|4148640_4148949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000806869.1|4149941_4150151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000996199.1|4150150_4150507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000583448.1|4150523_4151552_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_001531083.1|4151706_4151904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000886365.1|4151938_4153780_+	hypothetical protein	NA	A0A140G5Z0	Enterobacteria_phage	27.4	1.2e-17
WP_001240676.1|4153826_4154504_+	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	51.8	3.0e-46
WP_001269627.1|4154584_4155862_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
4156005:4156025	attR	ACTCCTATTATCGGCACCATC	NA	NA	NA	NA
>prophage 13
NZ_CP027544	Escherichia coli strain 2013C-3264 chromosome, complete genome	5486407	4159612	4170587	5486407		Enterobacteria_phage(87.5%)	12	NA	NA
WP_000446137.1|4159612_4160185_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	3.8e-95
WP_000638629.1|4160258_4160759_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001283021.1|4160755_4161490_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_001149160.1|4162051_4162318_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980257.1|4162314_4162914_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.8	1.3e-50
WP_071529409.1|4162906_4163194_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	96.8	3.3e-47
WP_000459315.1|4163186_4163642_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|4163777_4164098_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783674.1|4164112_4166446_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
WP_001111349.1|4167033_4167444_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000121338.1|4167422_4168379_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667027.1|4168388_4170587_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	3.3e-38
>prophage 14
NZ_CP027544	Escherichia coli strain 2013C-3264 chromosome, complete genome	5486407	4437487	4510676	5486407	terminase,head,tail,integrase,lysis,capsid,portal,transposase,holin,tRNA,protease	Enterobacteria_phage(46.88%)	80	4447665:4447711	4502150:4502196
WP_000912345.1|4437487_4438873_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143553.1|4438908_4439430_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4439537_4439750_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|4439751_4440618_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001396971.1|4441098_4441641_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988366.1|4441860_4442553_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000691056.1|4445221_4446229_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001396973.1|4446239_4446755_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_001443460.1|4446757_4447390_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
4447665:4447711	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001299447.1|4447724_4448888_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
WP_000488407.1|4449086_4449365_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763390.1|4449412_4449631_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_001386642.1|4449729_4450011_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000129285.1|4450021_4450579_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_000682294.1|4450571_4450733_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
WP_000186833.1|4450729_4451410_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000100847.1|4451406_4452192_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995433.1|4452197_4452494_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_032313553.1|4452568_4452712_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	97.9	6.0e-18
WP_001198861.1|4452680_4452845_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065358.1|4452917_4453286_-	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	97.5	6.5e-64
WP_000213977.1|4453468_4453669_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	4.2e-33
WP_001278766.1|4453878_4454373_+	hypothetical protein	NA	K7P861	Enterobacteria_phage	99.4	1.4e-85
WP_000512959.1|4454365_4454743_-	Antitermination protein N	NA	J3JZZ6	Escherichia_phage	97.4	5.6e-55
WP_001278659.1|4455116_4455719_-	hypothetical protein	NA	A4KWT4	Enterobacteria_phage	96.6	7.6e-46
WP_001207141.1|4455715_4456150_-	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	99.3	6.0e-77
WP_001274762.1|4456200_4456914_-	LexA family transcriptional regulator	NA	A4KWS0	Enterobacteria_phage	100.0	1.1e-131
WP_000437875.1|4457014_4457215_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251067.1|4457333_4457627_+	hypothetical protein	NA	A2SY75	Escherichia_phage	99.0	1.4e-45
WP_000185506.1|4457659_4458559_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	5.5e-173
WP_000788877.1|4458555_4459257_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_000145940.1|4459253_4459544_+	protein ren	NA	K7P7K7	Enterobacteria_phage	99.0	8.2e-46
WP_000736903.1|4459617_4460058_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_165382802.1|4460429_4461642_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001254218.1|4461890_4462073_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567000.1|4462069_4462240_+	protein ninF	NA	Q716C4	Shigella_phage	98.2	4.6e-25
WP_032313060.1|4462232_4462853_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	2.3e-93
WP_001028854.1|4462849_4463515_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_032314960.1|4463511_4464135_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	1.4e-111
WP_001302581.1|4464387_4465131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|4465216_4465375_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_080029467.1|4465672_4467187_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.6	5.6e-287
WP_085947772.1|4467207_4468420_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_024164617.1|4469221_4469437_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075135.1|4469436_4469934_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	1.3e-91
WP_000092318.1|4469930_4470368_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000881326.1|4470517_4471135_+	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001307652.1|4471322_4471517_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000235447.1|4471911_4472421_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.5	8.0e-12
WP_106898804.1|4472392_4474321_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.9e-261
WP_000259002.1|4474304_4474511_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001397759.1|4474507_4476100_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	5.5e-184
WP_001253987.1|4476089_4477595_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.6e-100
WP_000256821.1|4477631_4477979_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_000522623.1|4478036_4479065_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201512.1|4479116_4479500_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204526.1|4479492_4479846_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000974988.1|4479861_4480395_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	1.5e-56
WP_000683079.1|4480391_4480787_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_033803723.1|4480794_4481535_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	93.1	3.3e-123
WP_000479164.1|4481550_4481973_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_000459458.1|4481954_4482389_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_159032745.1|4484167_4484929_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	93.8	1.1e-126
WP_000847386.1|4484925_4485255_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.6	3.5e-53
WP_001154410.1|4485254_4485953_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	2.8e-132
WP_000140700.1|4485958_4486702_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_071529460.1|4486638_4487271_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_096847732.1|4487330_4490729_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.2	0.0e+00
WP_001585354.1|4490795_4491395_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	5.2e-111
WP_106898820.1|4491459_4492773_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	97.7	1.4e-76
WP_025380472.1|4492812_4494351_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	1.9e-298
WP_000612591.1|4494400_4494748_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4494744_4495125_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001101707.1|4495224_4495494_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
WP_001201825.1|4500773_4501727_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177453.1|4502239_4503001_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
4502150:4502196	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224614.1|4503183_4504074_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001396984.1|4504074_4507047_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383934.1|4507033_4509271_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_032312763.1|4509539_4510676_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP027544	Escherichia coli strain 2013C-3264 chromosome, complete genome	5486407	4944016	5063698	5486407	terminase,head,tail,integrase,capsid,transposase,holin,tRNA,protease	Enterobacteria_phage(29.23%)	113	4983278:4983293	5073392:5073407
WP_000156526.1|4944016_4945777_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|4945962_4946415_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|4946490_4947531_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|4947887_4948397_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839145.1|4948615_4949245_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875026.1|4949207_4951370_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|4951379_4951826_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001397074.1|4951948_4954003_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	5.0e-20
WP_000424181.1|4954034_4954493_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|4954588_4955251_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|4955423_4955837_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|4955881_4956199_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|4956256_4957447_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048233.1|4957541_4957820_+	acylphosphatase	NA	NA	NA	NA	NA
WP_001397075.1|4957816_4958146_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|4958236_4958896_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_001299701.1|4959303_4960323_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.7e-85
WP_000273151.1|4960300_4960543_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_106898810.1|4960610_4963082_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.4	1.0e-59
WP_001090200.1|4963174_4963366_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|4963362_4963551_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000394557.1|4964080_4964455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379580.1|4964466_4964619_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000103686.1|4964891_4965608_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000693949.1|4965868_4966294_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_106898811.1|4966365_4967484_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	66.2	8.0e-65
WP_000788751.1|4967490_4968237_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000451007.1|4968258_4969029_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001141099.1|4969044_4969437_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001443294.1|4969433_4969730_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_001209474.1|4969726_4970164_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|4970165_4970357_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207957.1|4970359_4970953_+	DUF551 domain-containing protein	NA	G9L6B4	Escherichia_phage	60.8	4.7e-56
WP_001278450.1|4971068_4971173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887479.1|4971361_4971574_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	5.1e-29
WP_001341388.1|4971741_4972020_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265154.1|4972021_4973071_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	2.5e-108
WP_001121082.1|4973083_4973458_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.4e-35
WP_033803818.1|4973454_4974276_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.5	2.4e-82
WP_001344632.1|4974872_4975004_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_106898812.1|4975447_4977298_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_024165672.1|4977736_4977952_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_024199498.1|4977956_4978505_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	95.8	7.2e-59
WP_001092850.1|4978983_4979517_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.7	3.9e-102
WP_032140280.1|4980071_4980158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|4980379_4980565_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736096.1|4980650_4980875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095736.1|4981243_4981471_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279810.1|4981512_4981878_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	8.4e-64
WP_000958380.1|4982165_4982729_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001368653.1|4982725_4984387_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.3	0.0e+00
4983278:4983293	attL	ATTGATGAACTGTGGC	NA	NA	NA	NA
WP_000173079.1|4984450_4986388_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_001063025.1|4986432_4986654_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|4989179_4989506_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007889.1|4989516_4989867_+|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000573374.1|4989863_4990310_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|4990306_4990651_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|4990709_4991426_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|4991431_4991806_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_000807964.1|4995395_4995737_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152217.1|4995736_4996435_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	99.6	2.8e-132
WP_001443504.1|4996440_4997184_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	94.3	1.7e-143
WP_046036880.1|4997129_4997762_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.5	6.9e-98
WP_106898813.1|5001553_5002153_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	96.0	1.3e-106
WP_044686009.1|5002212_5003529_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	3.1e-76
WP_001101703.1|5003530_5003800_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	100.0	4.9e-45
WP_001121228.1|5005553_5006204_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	98.1	2.3e-120
WP_173909681.1|5006358_5007587_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.3	4.7e-175
WP_024199508.1|5010302_5011511_-	hypothetical protein	NA	H6WZN3	Escherichia_phage	99.0	8.5e-230
WP_001295431.1|5012144_5013830_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|5013826_5014546_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|5014592_5015063_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|5015103_5015565_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001292770.1|5017685_5018822_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
WP_001294362.1|5018814_5021094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000074859.1|5021104_5022193_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636944.1|5022499_5022817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001215594.1|5026519_5030314_-	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001295427.1|5030454_5032488_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|5032619_5033729_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|5033991_5034273_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|5034565_5035108_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677395.1|5035188_5035863_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000405711.1|5038374_5039409_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|5039490_5039829_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134597.1|5040047_5040884_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019942.1|5041004_5041277_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195623.1|5041499_5042288_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822266.1|5042284_5043085_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001352238.1|5043149_5043968_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000434038.1|5044019_5044766_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011956.1|5044739_5045705_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846233.1|5045701_5046706_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	6.4e-13
WP_000858505.1|5046702_5047980_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|5048236_5049289_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289788.1|5049596_5050451_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853861.1|5050479_5051742_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182904.1|5051751_5052204_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000490679.1|5052522_5053878_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844220.1|5053924_5054965_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178556.1|5055064_5055844_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|5055925_5056825_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001397258.1|5057230_5057548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985256.1|5057813_5058827_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
WP_001306384.1|5058942_5059242_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|5059356_5059632_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001005161.1|5059642_5059813_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.2	3.0e-24
WP_000217684.1|5059809_5060310_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	3.8e-91
WP_000557701.1|5060373_5060598_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_001277895.1|5060597_5060900_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	96.0	5.0e-46
WP_001113264.1|5060899_5061124_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027664.1|5061120_5061396_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268583.1|5061385_5063698_+	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	96.8	0.0e+00
5073392:5073407	attR	ATTGATGAACTGTGGC	NA	NA	NA	NA
>prophage 16
NZ_CP027544	Escherichia coli strain 2013C-3264 chromosome, complete genome	5486407	5067149	5095387	5486407	terminase,head,plate,tail,lysis,holin,capsid,portal,tRNA	Escherichia_phage(48.39%)	35	NA	NA
WP_000038148.1|5067149_5068184_-|portal	phage portal protein	portal	Q7Y4E8	Escherichia_virus	99.7	3.2e-201
WP_000156872.1|5068183_5069956_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085942.1|5070129_5070984_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	95.1	8.1e-150
WP_001248536.1|5071042_5072116_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	4.8e-200
WP_000203462.1|5072119_5072863_+|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	100.0	2.1e-122
WP_000988626.1|5072962_5073472_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	5.6e-90
WP_000846409.1|5073471_5073675_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|5073678_5073960_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|5073959_5074457_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736568.1|5074471_5074897_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	97.2	4.2e-59
WP_000040674.1|5074884_5075310_+|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	95.0	1.0e-65
WP_000917180.1|5075417_5075885_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	4.3e-81
WP_001001796.1|5075877_5076330_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.0	3.4e-75
WP_000490544.1|5076401_5077187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093749.1|5077270_5077906_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	1.1e-111
WP_000127163.1|5077902_5078250_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121482.1|5078254_5079163_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.0e-162
WP_001285314.1|5079155_5079686_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	100.0	1.0e-102
WP_032313511.1|5079696_5081928_+|tail	tail fiber protein	tail	Q7Y4D4	Escherichia_virus	54.8	1.1e-158
WP_000972117.1|5081929_5082457_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	88.6	2.5e-85
WP_024199507.1|5082726_5083272_+	hypothetical protein	NA	Q858S7	Enterobacteria_phage	97.2	2.3e-94
WP_001286726.1|5083601_5084792_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.8e-224
WP_001251408.1|5084804_5085323_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031307.1|5085379_5085655_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|5085687_5085807_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069986.1|5085799_5088247_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.5	0.0e+00
WP_000978908.1|5088261_5088741_+|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
WP_000882975.1|5088740_5089904_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	3.7e-206
WP_000468308.1|5089985_5090204_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476036.1|5090474_5091836_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.4e-217
WP_001220181.1|5091938_5092235_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|5092236_5092533_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|5092741_5093074_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|5093264_5093987_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675156.1|5093983_5095387_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
>prophage 17
NZ_CP027544	Escherichia coli strain 2013C-3264 chromosome, complete genome	5486407	5207392	5299462	5486407	terminase,head,tail,lysis,capsid,transposase,holin	Stx2-converting_phage(37.93%)	97	NA	NA
WP_162829241.1|5207392_5208606_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001300307.1|5212013_5212811_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001171554.1|5213678_5214059_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|5214055_5214403_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_025380472.1|5214452_5215991_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	1.9e-298
WP_000096344.1|5216521_5216725_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000102146.1|5216783_5219225_-	exonuclease	NA	V5UQJ3	Shigella_phage	47.2	7.0e-114
WP_001070255.1|5219318_5219510_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854558.1|5219506_5219695_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001296188.1|5220094_5220259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|5220262_5220481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|5220640_5220796_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001397087.1|5221088_5221427_-	peptidase S24-like family protein	NA	H9C160	Pectobacterium_phage	30.7	2.5e-06
WP_000747951.1|5221818_5222061_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693868.1|5222044_5222470_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262333.1|5222541_5223612_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	61.6	1.1e-58
WP_001151202.1|5223649_5224072_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	3.3e-64
WP_000004322.1|5224068_5224323_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	94.0	4.8e-42
WP_001002677.1|5224315_5224627_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	95.1	2.6e-58
WP_001204666.1|5224932_5225511_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_000156213.1|5225470_5226568_-	beta family protein	NA	A0A0U2S621	Escherichia_phage	99.7	9.5e-212
WP_000882662.1|5227068_5227281_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_001429486.1|5227739_5228018_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	4.3e-12
WP_001121082.1|5229080_5229455_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.4e-35
WP_044706643.1|5229451_5230273_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.5	1.8e-82
WP_000917749.1|5230497_5230695_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000935502.1|5230845_5231922_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	87.9	5.9e-182
WP_001443281.1|5232517_5232844_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	62.9	5.1e-36
WP_106898821.1|5233145_5235083_+	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	97.1	0.0e+00
WP_000143458.1|5235217_5235397_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290221.1|5235437_5235710_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	97.8	9.1e-23
WP_000284510.1|5235786_5236002_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000087733.1|5236006_5236540_+	lysozyme	NA	G9L6J6	Escherichia_phage	100.0	1.0e-102
WP_032313590.1|5236838_5237333_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	98.7	7.6e-76
WP_000736096.1|5237329_5237554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095736.1|5237922_5238150_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_001303046.1|5238191_5238557_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_001358663.1|5238597_5239794_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_000958380.1|5240299_5240863_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001368653.1|5240859_5242521_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.3	0.0e+00
WP_000173079.1|5242584_5244522_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_001063025.1|5244566_5244788_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|5247313_5247640_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007889.1|5247650_5248001_+|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000573374.1|5247997_5248444_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|5248440_5248785_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|5248843_5249560_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|5249565_5249940_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|5250035_5250245_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_173909683.1|5251675_5253538_+|tail	phage tail tape measure protein	tail	Q6H9T7	Enterobacteria_phage	100.0	0.0e+00
WP_000807964.1|5253530_5253872_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152217.1|5253871_5254570_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	99.6	2.8e-132
WP_001443504.1|5254575_5255319_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	94.3	1.7e-143
WP_046036880.1|5255264_5255897_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.5	6.9e-98
WP_106898779.1|5256143_5259623_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.9	0.0e+00
WP_044686008.1|5259689_5260289_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	95.5	1.0e-106
WP_044686009.1|5260348_5261665_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	3.1e-76
WP_001101703.1|5261666_5261936_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	100.0	4.9e-45
WP_122993429.1|5262341_5263355_+	peptidase M85	NA	NA	NA	NA	NA
WP_001079090.1|5264589_5265120_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_001007759.1|5265462_5266113_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001240091.1|5266369_5267005_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000740094.1|5267005_5268010_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920132.1|5268118_5268532_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001339045.1|5268664_5269336_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826749.1|5269335_5270694_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	6.6e-05
WP_000218204.1|5270801_5271653_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824367.1|5272244_5273318_-	porin	NA	Q1MVN1	Enterobacteria_phage	51.3	3.1e-98
WP_001313057.1|5273884_5274250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365559.1|5274289_5274985_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001157238.1|5275051_5276470_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000786005.1|5276450_5276921_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
WP_001212248.1|5276909_5277830_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922682.1|5278002_5278920_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|5278998_5279181_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_106898815.1|5279351_5281046_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000491497.1|5281042_5281858_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_000844800.1|5282155_5282383_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000867217.1|5282545_5282734_+	protein DsrB	NA	NA	NA	NA	NA
WP_000103987.1|5282777_5283401_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000983977.1|5283690_5284476_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000187358.1|5284484_5284754_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253441.1|5284763_5285501_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_001299290.1|5285500_5285866_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001282098.1|5285868_5286282_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001295641.1|5286278_5287283_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133124.1|5287287_5287752_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000807661.1|5288979_5289423_-	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000213295.1|5289441_5290815_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_001282685.1|5290814_5291501_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000067950.1|5291493_5292489_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000994405.1|5292481_5294140_-	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_001274295.1|5294354_5294669_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001070440.1|5295002_5295335_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000734031.1|5295503_5296055_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000879833.1|5296064_5296862_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064734585.1|5298253_5299462_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	1.3e-209
>prophage 18
NZ_CP027544	Escherichia coli strain 2013C-3264 chromosome, complete genome	5486407	5319000	5352807	5486407	head,terminase,plate,tail,integrase,capsid,portal,holin	Enterobacteria_phage(90.24%)	48	5317938:5317997	5352914:5353037
5317938:5317997	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_000078920.1|5319000_5319141_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488112.1|5319332_5319593_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132816.1|5319635_5320745_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.4	1.4e-202
WP_000005384.1|5320902_5322087_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	4.7e-225
WP_000290462.1|5322086_5322599_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651572.1|5322654_5323029_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000333503.1|5323037_5323193_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853434.1|5323179_5325987_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.9	0.0e+00
WP_000979948.1|5325999_5326488_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	2.6e-84
WP_000954196.1|5326644_5327217_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144023.1|5327260_5327839_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	5.9e-96
WP_000108539.1|5327838_5329971_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.7	4.2e-131
WP_000071739.1|5329973_5330504_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_001111942.1|5330496_5331393_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
WP_001067548.1|5331396_5331726_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001369311.1|5331743_5332310_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.8	2.1e-98
WP_000356339.1|5332321_5332957_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_000920603.1|5332949_5333417_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.7	2.9e-85
WP_000780572.1|5333554_5333962_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000072327.1|5333958_5334351_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|5334347_5334671_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|5334673_5334874_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063082.1|5334873_5335368_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000632344.1|5335470_5336271_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_001055115.1|5336316_5337369_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	98.6	2.4e-196
WP_001262673.1|5337391_5338228_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_000613766.1|5338382_5340134_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	99.5	0.0e+00
WP_000087819.1|5340133_5341180_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.4	1.1e-201
WP_000236497.1|5341194_5341719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080493.1|5342278_5342686_-	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	91.7	4.0e-22
WP_000211274.1|5342784_5343096_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	94.2	1.0e-46
WP_000686521.1|5343100_5344060_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.9e-180
WP_001288333.1|5344136_5346977_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	86.1	0.0e+00
WP_000567053.1|5346973_5347363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106898816.1|5347359_5347977_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.7	5.3e-10
WP_001274217.1|5347988_5348288_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	92.9	5.1e-43
WP_000153683.1|5348284_5348530_-	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	97.5	9.6e-40
WP_000985159.1|5348526_5348730_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000021668.1|5348816_5348930_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.2e-08
WP_000514277.1|5348926_5349169_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000158971.1|5349180_5349468_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000739025.1|5349478_5349829_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	82.8	1.3e-50
WP_000014504.1|5349850_5350054_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|5350125_5350263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|5350352_5350757_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290355.1|5350772_5351423_+	membrane protein	NA	NA	NA	NA	NA
WP_000865208.1|5351452_5351800_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|5351805_5352807_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
5352914:5353037	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 1
NZ_CP027545	Escherichia coli strain 2013C-3264 plasmid unnamed, complete sequence	101089	39716	99617	101089	transposase	Stx2-converting_phage(42.86%)	35	NA	NA
WP_025380472.1|39716_41255_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	1.9e-298
WP_106898822.1|41938_42127_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001213545.1|42193_43633_-	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_000987096.1|43636_45757_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	1.6e-45
WP_000217745.1|45806_48803_-	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000839950.1|48804_49320_-	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000091308.1|50429_50795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947772.1|51558_52772_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001302199.1|55055_55877_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|55876_56983_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|57076_58798_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_077629919.1|58871_59870_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_106898823.1|60173_61712_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	4.2e-298
WP_000612591.1|61761_62109_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|62105_62486_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_032257629.1|62646_62859_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013009342.1|69004_70975_+	variant type II secretion system secretin EtpD	NA	A7BJX1	Enterobacteria_phage	27.6	2.0e-26
WP_001173149.1|72474_73698_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001420206.1|74723_75071_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_071526091.1|76677_77850_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000998852.1|77836_78352_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_001222320.1|79329_79731_+	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000083841.1|80841_81090_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_000222761.1|82422_82710_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	47.4	1.4e-18
WP_000594717.1|82813_83404_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000633741.1|84148_84442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106898824.1|84650_84782_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	97.7	3.9e-16
WP_000766060.1|86425_86722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165382802.1|90682_91896_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001358663.1|92220_93417_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_000731192.1|94001_94346_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_072164699.1|95084_95267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001208680.1|95634_95820_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000491532.1|97440_98316_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	93.1	1.0e-152
WP_165382802.1|98404_99617_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
