The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027546	Escherichia coli strain 2013C-4187 chromosome, complete genome	5509931	26481	80004	5509931	lysis,holin,transposase,terminase,head,tail,integrase,portal,protease	Enterobacteria_phage(48.53%)	72	22229:22244	29300:29315
22229:22244	attL	ATGGCGGCGCGGCAGG	NA	NA	NA	NA
WP_000533654.1|26481_27552_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
WP_001303849.1|27529_27748_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001281774.1|27854_28199_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_000545733.1|28227_28395_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000002107.1|28467_28752_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_012817743.1|28744_29047_-	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	97.0	9.4e-53
WP_000104414.1|29043_29661_-	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
29300:29315	attR	ATGGCGGCGCGGCAGG	NA	NA	NA	NA
WP_000034231.1|29662_30220_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
WP_000812206.1|30216_30774_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
WP_001214436.1|30770_30935_-	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
WP_001111278.1|30945_31239_-	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_000951334.1|31262_31646_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_000031370.1|31645_32251_-	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_001243354.1|32507_32660_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
WP_000638547.1|32644_32776_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_085948186.1|33263_34420_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000073663.1|35291_35831_+	superinfection exclusion protein B	NA	A0A192Y7Z0	Salmonella_phage	44.9	8.1e-39
WP_000088201.1|35854_36127_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	7.4e-41
WP_000193240.1|36733_37096_-	hypothetical protein	NA	A0A1P8DTD0	Proteus_phage	51.4	6.2e-19
WP_000428099.1|37364_38069_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	99.6	4.3e-133
WP_000064150.1|38182_38416_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	97.4	4.0e-35
WP_000438538.1|38554_38854_+	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	99.0	4.8e-49
WP_000185473.1|38886_39825_+	replication protein	NA	O48421	Enterobacteria_phage	99.7	1.4e-171
WP_000788880.1|39821_40523_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	3.8e-129
WP_000145926.1|40519_40810_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000344573.1|41106_41463_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_085948186.1|41733_42889_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001254255.1|43108_43285_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000924601.1|43287_43689_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001341811.1|43648_43858_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.6e-30
WP_001003989.1|43850_44573_+	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
WP_000002261.1|44572_44863_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_001008193.1|44859_45222_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_000994516.1|45218_45407_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000750155.1|45618_46578_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|46915_47038_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|47052_47742_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|47926_48670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|48755_48914_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000411802.1|51524_51731_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|51730_52228_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092325.1|52224_52662_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000881326.1|52811_53429_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001307652.1|53616_53811_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000235451.1|54206_54716_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_009442816.1|54687_56616_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
WP_000259002.1|56599_56806_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_106889257.1|56802_58395_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.5e-183
WP_001254029.1|58384_58561_+	hypothetical protein	NA	E4WL22	Enterobacteria_phage	56.4	1.1e-08
WP_000839179.1|58638_59043_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|59039_59387_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|59435_60974_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_032284507.1|60970_61339_+	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	88.0	2.4e-50
WP_001143013.1|61346_62099_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000479086.1|62112_62544_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533431.1|62570_62984_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000082320.1|62964_65544_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
WP_000847304.1|65540_65870_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_032325234.1|65869_66568_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	98.3	2.4e-131
WP_069358375.1|66578_67322_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.8	2.9e-148
WP_096844540.1|67267_67900_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_106913804.1|68135_71528_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	84.1	0.0e+00
WP_001230449.1|71595_72195_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_000268998.1|72259_73474_+	short-chain dehydrogenase	NA	B6DZB7	Enterobacteria_phage	95.8	6.6e-81
WP_001023459.1|73475_73745_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000950982.1|73850_74732_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_000652081.1|74955_75783_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.2	3.1e-154
WP_021351651.1|75906_76278_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_000381395.1|76752_78324_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|78343_78691_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|78690_79368_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001448642.1|79428_80004_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
>prophage 2
NZ_CP027546	Escherichia coli strain 2013C-4187 chromosome, complete genome	5509931	295107	408095	5509931	capsid,holin,terminase,transposase,head,tail,integrase,portal,protease	Escherichia_phage(33.63%)	146	314768:314786	361821:361839
WP_000156528.1|295107_296868_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|297053_297506_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|297580_298621_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|298977_299487_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|299705_300335_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|300297_302460_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|302469_302916_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001297106.1|303038_305093_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
WP_000424181.1|305124_305583_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|305678_306341_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|306513_306927_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|306971_307289_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116301.1|307346_308537_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048244.1|308631_308910_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|308906_309236_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375138.1|309326_309986_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
WP_001299351.1|310393_311413_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|311390_311633_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_009448824.1|311700_314151_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_001098307.1|314244_314436_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|314432_314621_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
314768:314786	attL	CACCGCATCACAAAATTCA	NA	NA	NA	NA
WP_001133037.1|315188_315398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|315398_316037_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001345283.1|316048_316201_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000362152.1|316467_316887_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_000391948.1|316986_317268_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693883.1|317251_317677_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_025380294.1|317748_318855_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.8e-64
WP_021498074.1|318861_319602_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_032324560.1|319627_320398_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	68.5	2.5e-86
WP_001151235.1|320413_320836_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000935423.1|320941_321154_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	97.1	5.6e-36
WP_000209148.1|321186_321405_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_000224233.1|321406_321670_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000208016.1|321680_322550_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	79.2	8.5e-123
WP_001278454.1|322665_322770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018421.1|322959_323172_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001341388.1|323339_323618_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265133.1|323619_324669_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001217436.1|324681_325053_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|325042_325414_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|325565_326384_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|326670_326868_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000261909.1|327005_327719_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874348.1|328486_330337_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000411814.1|330785_330992_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000138558.1|331247_331520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003111.1|331679_332213_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	1.4e-99
WP_000675931.1|332433_332547_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|332768_332954_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|333481_333796_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|333877_334102_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000453587.1|334498_335044_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027379.1|335018_336944_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|336940_337147_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001415980.1|337143_338745_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.3e-307
WP_000123251.1|338725_340045_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001365129.1|340054_340387_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|340442_341468_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|341509_341905_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|341916_342270_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975098.1|342281_342860_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
WP_000683137.1|342856_343252_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235067.1|343259_344012_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479051.1|344025_344448_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533442.1|344474_344888_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081792.1|344868_347481_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
WP_000847298.1|347477_347807_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001443841.1|347806_348505_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	97.4	4.4e-130
WP_069358375.1|348515_349259_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.8	2.9e-148
WP_096844540.1|349204_349837_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_106913809.1|350072_353555_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	94.0	0.0e+00
WP_032271866.1|353623_354247_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	8.7e-69
WP_106881528.1|354311_355625_+|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	97.9	8.5e-74
WP_001023455.1|355626_355896_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_012817749.1|356020_356773_-	type III effector	NA	NA	NA	NA	NA
WP_001299351.1|357576_358596_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|358573_358816_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_106889259.1|358883_361334_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000199475.1|361429_361618_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|361614_361803_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001331716.1|362203_362368_+	hypothetical protein	NA	NA	NA	NA	NA
361821:361839	attR	TGAATTTTGTGATGCGGTG	NA	NA	NA	NA
WP_001171921.1|362371_362590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024182289.1|362682_362883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000692026.1|363296_363599_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_001022415.1|363601_363961_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
WP_000578360.1|364007_364400_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_001172789.1|364526_364787_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
WP_000693932.1|364783_365221_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
WP_000729535.1|365307_366318_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.8	4.9e-170
WP_072096947.1|366229_366772_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	1.8e-78
WP_000450641.1|366805_367531_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.2e-77
WP_001040234.1|367546_367939_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
WP_001266133.1|367935_368232_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_001209480.1|368228_368690_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403783.1|368667_369024_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_000935422.1|369074_369287_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_001224662.1|369320_369503_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_001289353.1|369668_370304_+	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_000209152.1|370391_370610_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
WP_001229296.1|370611_370977_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000206830.1|370973_371318_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	1.7e-58
WP_000220601.1|371522_371822_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_001260977.1|371827_372085_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_001342259.1|372220_372493_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_001265113.1|372494_373541_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_000904103.1|373553_373913_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_000640048.1|373921_374452_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917770.1|374693_374891_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301785.1|375025_375739_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|376188_376620_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_085948186.1|378822_379978_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_122368378.1|380032_380302_+	hypothetical protein	NA	A0A0P0ZBP4	Stx2-converting_phage	98.9	2.1e-43
WP_000143463.1|380437_380617_+	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_001290230.1|380657_380903_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|380980_381196_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087714.1|381200_381734_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001056883.1|382008_382578_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000455402.1|382577_382727_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_001208680.1|382954_383140_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|383666_383981_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001448509.1|384062_384287_-	YlcI/YnfO family protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_000279796.1|384328_384694_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958380.1|384986_385550_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_033816804.1|385546_387208_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_000173079.1|387271_389209_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_001063025.1|389253_389475_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_032325002.1|392001_392328_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	99.1	1.2e-53
WP_001007905.1|392338_392689_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|392685_393132_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|393128_393473_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_106881370.1|393538_394255_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	3.1e-126
WP_001030063.1|394260_394635_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|394730_394940_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_106889265.1|394991_398234_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	94.2	0.0e+00
WP_000807940.1|398226_398568_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001335877.1|398567_399266_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_001429308.1|399271_400015_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_096844540.1|399960_400593_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_106913810.1|400828_404305_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	97.3	0.0e+00
WP_001230429.1|404371_404971_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.3e-111
WP_000279017.1|405035_406349_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_001023995.1|406350_406620_+|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	7.1e-44
WP_000767050.1|406841_407384_+	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_106420821.1|407328_407523_+	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	84.6	4.1e-09
WP_001131653.1|407513_408095_+	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	64.2	5.1e-63
>prophage 3
NZ_CP027546	Escherichia coli strain 2013C-4187 chromosome, complete genome	5509931	723797	774462	5509931	capsid,integrase,holin,terminase,head,tail,transposase	Stx2-converting_phage(29.79%)	61	720902:720916	780312:780326
720902:720916	attL	AGCAGAAAGTCAAAA	NA	NA	NA	NA
WP_000113674.1|723797_724928_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|724905_725154_-	excisionase	NA	NA	NA	NA	NA
WP_000048478.1|725218_727690_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000199480.1|727785_727974_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|727970_728159_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001342117.1|728558_728726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|728719_728953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|728930_729338_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|729360_729579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|729651_729951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|730215_730623_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|730699_730927_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705622.1|730910_731462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|731433_732474_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|732385_732928_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_001505071.1|733691_733856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|734554_735313_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|735591_735804_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|736024_736282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106913812.1|736351_736630_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265290.1|736631_737687_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	4.9e-88
WP_000140002.1|737687_738053_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_032324106.1|738049_738739_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.5	1.8e-59
WP_000023141.1|740259_742113_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
WP_000284522.1|742262_742478_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_032325202.1|742482_742827_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	96.5	7.9e-56
WP_000992088.1|742877_743411_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_001056803.1|743681_744248_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	99.5	2.9e-103
WP_000539792.1|744247_744394_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|744621_744828_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|744892_745117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|745211_746367_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000347013.1|746740_746881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001428130.1|747010_747196_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	92.3	1.3e-20
WP_000829192.1|747237_747603_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958380.1|747891_748455_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_062890118.1|748451_750113_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.1	0.0e+00
WP_044165196.1|750176_752114_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.1	0.0e+00
WP_001063096.1|752158_752380_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125984.1|754906_755233_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007911.1|755242_755593_+|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000573391.1|755589_756036_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|756032_756377_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275479.1|756445_757162_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_001030060.1|757167_757542_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001453698.1|757637_757847_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_106913813.1|757898_761141_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	99.5	0.0e+00
WP_000807927.1|761133_761475_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_025404404.1|761474_762173_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.4	8.9e-131
WP_106889273.1|762178_762922_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.8	7.0e-150
WP_064755952.1|762867_763500_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	1.4e-103
WP_000649829.1|763690_764218_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_106913814.1|764351_767849_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.2	0.0e+00
WP_001230550.1|767919_768519_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_106913815.1|768583_769789_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	95.8	7.3e-80
WP_001023992.1|769790_770060_+|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_001131659.1|770172_770748_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001443810.1|770820_771450_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|771531_772173_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|772753_773188_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837924.1|773328_774462_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
780312:780326	attR	AGCAGAAAGTCAAAA	NA	NA	NA	NA
>prophage 4
NZ_CP027546	Escherichia coli strain 2013C-4187 chromosome, complete genome	5509931	919710	1033912	5509931	capsid,tRNA,terminase,holin,integrase,head,tail,transposase	Escherichia_phage(41.18%)	115	904032:904047	1031659:1031674
904032:904047	attL	GCGATTTCATCCGCCA	NA	NA	NA	NA
WP_085948178.1|919710_920923_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000520676.1|921190_922105_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000825452.1|922163_922667_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000876763.1|922679_923210_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000123648.1|923223_925875_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001195166.1|925916_926627_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001296758.1|926987_927551_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001125458.1|928502_929825_-	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001296726.1|929824_930091_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_000127325.1|930313_930793_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	54.7	1.7e-43
WP_000154339.1|937688_938642_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194888.1|938890_940426_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.7e-20
WP_000911171.1|940419_941448_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222721.1|941447_942440_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000172466.1|942451_943474_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774200.1|943500_944370_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_072097594.1|944323_944830_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001341531.1|944833_945748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854640.1|945954_947406_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000558044.1|947632_949051_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
WP_001191027.1|949189_949549_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|949548_950475_-	glutaminase B	NA	NA	NA	NA	NA
WP_001296740.1|950538_951927_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366496.1|952027_952909_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001323836.1|952986_953445_+	putative protein YneK	NA	NA	NA	NA	NA
WP_001341528.1|953393_954101_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|954250_955441_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|955465_956131_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000843419.1|956342_956777_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|956796_957180_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|957211_957430_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_085948186.1|957889_959045_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001022772.1|960217_961891_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_001296721.1|961946_962258_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001375402.1|962285_963608_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000722571.1|963722_964034_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000577179.1|964232_964931_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000087216.1|964975_965875_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054196.1|966069_967257_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|967383_967479_+	protein MgtS	NA	NA	NA	NA	NA
WP_000671731.1|969617_970010_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024559.1|970285_970804_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_001341522.1|970848_972894_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|973030_973777_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|973865_974552_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214712.1|974729_974933_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527750.1|974968_976429_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
WP_000347482.1|976517_977801_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_096846665.1|977860_978175_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_122993102.1|978545_979559_-	peptidase M85	NA	NA	NA	NA	NA
WP_122988840.1|979773_979851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023407.1|979961_980231_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_032325331.1|980232_981546_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	1.7e-77
WP_106913818.1|981610_982210_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	5.7e-110
WP_106913819.1|982276_985753_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.1	0.0e+00
WP_159032308.1|985988_986621_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	2.5e-103
WP_106889273.1|986566_987310_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.8	7.0e-150
WP_025404404.1|987315_988014_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.4	8.9e-131
WP_000807927.1|988013_988355_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_106913813.1|988347_991590_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	99.5	0.0e+00
WP_001453698.1|991641_991851_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030060.1|991946_992321_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275479.1|992326_993043_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_106913821.1|993111_993747_-	DUF3168 domain-containing protein	NA	A0A0N7KZI9	Stx2-converting_phage	93.8	3.0e-61
WP_001007911.1|993743_994094_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125984.1|994103_994430_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|996956_997178_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_096948424.1|997222_999160_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.8	0.0e+00
WP_106913822.1|999223_1000882_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.1	0.0e+00
WP_000958380.1|1000878_1001442_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|1001730_1002096_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_032277401.1|1002137_1002338_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	95.5	2.8e-29
WP_000828070.1|1002469_1002796_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_012817877.1|1003196_1003382_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001280923.1|1003604_1003736_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_000661712.1|1003830_1004526_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_000992086.1|1004799_1005333_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_032325202.1|1005383_1005728_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	96.5	7.9e-56
WP_000284522.1|1005732_1005948_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000143077.1|1006097_1007951_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_032324351.1|1008525_1008957_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	96.5	5.6e-67
WP_000640158.1|1009518_1010073_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000247761.1|1010069_1010360_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000940319.1|1010359_1010959_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000138556.1|1011458_1012850_+	ATPase	NA	NA	NA	NA	NA
WP_000016656.1|1012849_1013839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100703.1|1013806_1014958_-	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000365100.1|1015389_1015635_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_000208018.1|1015713_1015875_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000224233.1|1015885_1016149_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_042350895.1|1016150_1016315_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000935420.1|1016400_1016613_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001141110.1|1016718_1017141_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000450712.1|1017156_1017918_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_000788980.1|1017940_1018687_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_001304174.1|1018693_1019482_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|1019559_1019982_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|1019978_1020233_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|1020312_1020732_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001326317.1|1020974_1021154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169151.1|1021164_1021320_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|1021316_1021805_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|1022246_1022468_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|1022467_1022638_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_001344816.1|1022712_1022988_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_000105153.1|1023089_1025690_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	6.7e-248
WP_000166313.1|1025682_1026492_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|1026547_1026697_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|1026734_1026923_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|1027022_1027238_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|1027239_1028475_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001157407.1|1028526_1029462_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_032323876.1|1029590_1030964_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|1031441_1032425_-	zinc transporter ZntB	NA	NA	NA	NA	NA
1031659:1031674	attR	GCGATTTCATCCGCCA	NA	NA	NA	NA
WP_000628065.1|1032679_1033912_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 5
NZ_CP027546	Escherichia coli strain 2013C-4187 chromosome, complete genome	5509931	1110454	1248882	5509931	capsid,terminase,holin,integrase,head,tail,transposase,portal,protease	Enterobacteria_phage(26.92%)	153	1148796:1148811	1258140:1258155
WP_000422045.1|1110454_1111504_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559281.1|1111723_1112482_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_001278906.1|1112478_1113069_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|1113108_1113981_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001342101.1|1114081_1114702_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|1114698_1115580_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|1115717_1115762_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194584.1|1115853_1117416_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_032323871.1|1117415_1119011_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001342102.1|1119014_1120373_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	1.5e-36
WP_000209520.1|1120384_1121578_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|1121577_1122384_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|1122764_1122944_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|1123029_1123530_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|1123575_1124082_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000147167.1|1124583_1124802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144877.1|1127564_1128155_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|1128338_1128986_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|1129122_1129269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|1129696_1129975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938103.1|1131142_1131712_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|1131777_1132689_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|1132795_1132918_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001023357.1|1136863_1137133_-|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_001339397.1|1137193_1137871_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|1137870_1138218_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|1138237_1139809_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000216552.1|1139841_1141155_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	6.9e-76
WP_001228278.1|1141306_1141906_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	95.5	5.9e-107
WP_000902073.1|1141973_1143023_-	DUF1983 domain-containing protein	NA	Q9EYE7	Enterobacteria_phage	100.0	4.5e-195
WP_000099160.1|1143045_1144584_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|1144632_1144980_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|1144976_1145381_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_106913823.1|1145458_1147909_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	96.0	0.0e+00
WP_159032308.1|1148144_1148777_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	2.5e-103
WP_106889273.1|1148722_1149466_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.8	7.0e-150
1148796:1148811	attL	CGCCAGACAGAATGCG	NA	NA	NA	NA
WP_025404404.1|1149471_1150170_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.4	8.9e-131
WP_000807956.1|1150169_1150511_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	1.5e-62
WP_106913824.1|1150503_1153746_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	94.1	0.0e+00
WP_001453698.1|1153797_1154007_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|1154102_1154477_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_032325206.1|1154482_1155199_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	8.0e-127
WP_000133388.1|1155264_1155609_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_106881388.1|1155605_1156052_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	1.2e-75
WP_001007905.1|1156048_1156399_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_032325002.1|1156409_1156736_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	99.1	1.2e-53
WP_001063099.1|1159262_1159484_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_032325321.1|1159528_1161307_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	90.1	0.0e+00
WP_106889267.1|1161370_1163032_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000958380.1|1163028_1163592_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000279801.1|1163883_1164249_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	2.3e-61
WP_000095732.1|1164290_1164491_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	95.5	3.7e-29
WP_000828072.1|1164622_1164949_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	3.4e-56
WP_001109019.1|1165294_1165846_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_071529499.1|1166084_1166270_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	1.3e-17
WP_001280922.1|1166492_1166624_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	90.7	8.5e-11
WP_000661712.1|1166718_1167414_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_000087733.1|1167687_1168221_-	lysozyme	NA	G9L6J6	Escherichia_phage	100.0	1.0e-102
WP_001072901.1|1168225_1168441_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|1168518_1168764_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143463.1|1168804_1168984_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_106889297.1|1169119_1171057_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	99.2	0.0e+00
WP_000752026.1|1171556_1171826_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|1171835_1172783_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_032324021.1|1173289_1173724_-	antitermination protein	NA	Q5MBW8	Stx1-converting_phage	100.0	4.8e-82
WP_000144759.1|1173716_1173911_-	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_085948186.1|1173987_1175143_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001303849.1|1175417_1175636_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533665.1|1175613_1176687_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	98.9	2.0e-198
WP_001444338.1|1176781_1179526_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_000818472.1|1179597_1180671_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|1180718_1180892_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001316982.1|1180881_1181112_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|1181086_1181275_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|1181285_1181498_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|1181783_1181996_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001295358.1|1182437_1182743_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001247610.1|1182849_1183494_+	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001038062.1|1183490_1184237_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742345.1|1184236_1186333_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|1186378_1187518_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|1187505_1187952_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208650.1|1187971_1190152_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001300464.1|1190266_1191565_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000270305.1|1191644_1191737_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460810.1|1191749_1192886_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_071527988.1|1192897_1194394_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004899.1|1194576_1195434_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063972.1|1195430_1195829_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003671.1|1195825_1196413_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186421.1|1196409_1197117_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|1197135_1198929_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|1198925_1200044_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_095585410.1|1200639_1200792_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
WP_000938124.1|1201168_1202530_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_001023483.1|1202984_1203254_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
WP_000381395.1|1203291_1204863_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1204882_1205230_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1205229_1205907_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_032325383.1|1205962_1207276_-|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	98.2	2.2e-77
WP_001230428.1|1207340_1207940_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_106913825.1|1208006_1211480_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	98.1	0.0e+00
WP_123010699.1|1211725_1212358_-|tail	tail assembly protein	tail	A0A0N7KZG2	Stx2-converting_phage	95.7	1.6e-94
WP_000194707.1|1212303_1213047_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.2	1.2e-149
WP_001443841.1|1213057_1213756_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	97.4	4.4e-130
WP_000847298.1|1213755_1214085_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_106913826.1|1214081_1216694_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.3	0.0e+00
WP_000533442.1|1216674_1217088_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479051.1|1217114_1217537_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235067.1|1217550_1218303_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683137.1|1218310_1218706_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000975098.1|1218702_1219281_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
WP_000752994.1|1219292_1219646_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_022581670.1|1219657_1220053_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	5.3e-56
WP_000063258.1|1220094_1221120_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|1221175_1221508_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123292.1|1221517_1222837_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	1.5e-232
WP_001443752.1|1222817_1224419_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000198153.1|1224415_1224622_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_000453587.1|1226518_1227064_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_044705177.1|1227452_1227677_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	7.8e-20
WP_001302717.1|1227758_1228073_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|1228598_1228784_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|1229006_1229153_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|1229152_1229722_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_085948186.1|1229858_1231014_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_106913827.1|1231011_1231698_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.6	1.3e-113
WP_001375683.1|1231711_1232761_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	4.6e-115
WP_012817785.1|1232762_1233032_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	3.0e-10
WP_001452497.1|1233085_1233313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032325073.1|1233536_1233908_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000042395.1|1233900_1234218_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000882662.1|1234320_1234533_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000211993.1|1234747_1235299_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000215512.1|1235650_1235836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450895.1|1235895_1236657_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	63.6	2.4e-73
WP_000790460.1|1236686_1237427_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	4.7e-114
WP_000054520.1|1237433_1238399_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
WP_000705368.1|1238379_1238901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920571.1|1238884_1239115_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000379972.1|1239198_1239606_+	helix-turn-helix domain-containing protein	NA	B1B6L9	Salmonella_phage	58.7	3.1e-14
WP_000380319.1|1239772_1239925_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_000394548.1|1239936_1240575_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|1240575_1240785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|1241349_1241538_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|1241534_1241723_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102128.1|1241815_1244278_+	exonuclease	NA	V5UQJ3	Shigella_phage	47.5	2.3e-125
WP_001368608.1|1244365_1244602_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001206148.1|1244621_1245917_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_072095801.1|1245936_1246047_-	transporter	NA	NA	NA	NA	NA
WP_000836079.1|1246104_1247124_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|1247135_1248350_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1248555_1248882_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
1258140:1258155	attR	CGCCAGACAGAATGCG	NA	NA	NA	NA
>prophage 6
NZ_CP027546	Escherichia coli strain 2013C-4187 chromosome, complete genome	5509931	1265167	1283218	5509931	capsid,terminase,integrase,head,transposase,portal,protease	uncultured_Caudovirales_phage(83.33%)	25	1270792:1270807	1294398:1294413
WP_001260840.1|1265167_1265989_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000046661.1|1266027_1266357_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000276149.1|1266343_1266709_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001303517.1|1266815_1266986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000133423.1|1268022_1268304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127891.1|1268317_1269979_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	2.0e-277
WP_000113645.1|1269962_1270319_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001145905.1|1270608_1271049_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
1270792:1270807	attL	ATTAATCGGGATAATG	NA	NA	NA	NA
WP_000134113.1|1271048_1271345_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020674.1|1271341_1271680_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
WP_001398592.1|1271676_1272852_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	4.8e-185
WP_000504055.1|1272889_1273462_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	4.7e-61
WP_001137345.1|1273501_1274659_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_085948186.1|1275064_1276221_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_159026385.1|1276277_1276442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233310.1|1276567_1276840_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126691.1|1276850_1277261_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000125509.1|1277257_1277503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000710169.1|1277790_1279608_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	48.3	7.5e-129
WP_001261490.1|1279604_1279904_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001113154.1|1279910_1280231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024184083.1|1280223_1280514_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001496008.1|1280446_1281373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000953271.1|1281425_1281614_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_000085277.1|1281988_1283218_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.4	1.6e-130
1294398:1294413	attR	ATTAATCGGGATAATG	NA	NA	NA	NA
>prophage 7
NZ_CP027546	Escherichia coli strain 2013C-4187 chromosome, complete genome	5509931	1479651	1574250	5509931	lysis,capsid,tRNA,holin,integrase,head,tail,transposase,portal,protease	Escherichia_phage(36.51%)	107	1519157:1519171	1575697:1575711
WP_071830504.1|1479651_1480860_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	1.7e-206
WP_000604932.1|1480867_1481299_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	4.8e-42
WP_000513743.1|1481314_1481503_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_000939317.1|1481506_1481866_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457202.1|1482038_1482677_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_001061578.1|1482803_1483727_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000978494.1|1483829_1484915_+	multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase	NA	NA	NA	NA	NA
WP_000987525.1|1485165_1486776_+	BCCT family transporter YeaV	NA	NA	NA	NA	NA
WP_000067805.1|1486807_1487932_+	carnitine monooxygenase subunit YeaW	NA	NA	NA	NA	NA
WP_001287005.1|1487987_1488953_+	carnitine monooxygenase subunit YeaX	NA	NA	NA	NA	NA
WP_001342154.1|1489006_1490122_-	ribonuclease D	NA	NA	NA	NA	NA
WP_000758422.1|1490203_1491889_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|1492093_1492675_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001221003.1|1492714_1493410_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|1493467_1495378_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|1495509_1495854_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|1496216_1496576_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|1496695_1496875_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854972.1|1496948_1498310_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000456725.1|1498313_1498892_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_032324016.1|1499075_1500440_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001295494.1|1500570_1502169_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000150551.1|1504190_1505162_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406926.1|1505224_1506025_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000228655.1|1506037_1506889_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156255.1|1506943_1507402_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001296134.1|1507830_1508397_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010107.1|1508393_1509203_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001062678.1|1509368_1509578_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001295496.1|1509590_1509734_-	YobF family protein	NA	NA	NA	NA	NA
WP_001006866.1|1510402_1510690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|1510764_1510908_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001211011.1|1511066_1511306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262174.1|1511448_1512240_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001127210.1|1512416_1513790_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984517.1|1513835_1514717_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001427396.1|1514908_1516957_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|1516976_1517675_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|1517771_1518269_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207284.1|1518398_1519682_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
1519157:1519171	attL	CCCGCTACGCCTGCG	NA	NA	NA	NA
WP_001299674.1|1519650_1522284_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057024.1|1522363_1523803_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|1523920_1524157_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|1524261_1524453_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812724.1|1524453_1525110_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_001121225.1|1526064_1526715_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491545.1|1526939_1527815_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
WP_001023379.1|1527955_1528225_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_106875077.1|1528226_1529540_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	2.8e-77
WP_044722165.1|1529604_1530204_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	5.2e-111
WP_106913828.1|1530271_1533664_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	84.6	0.0e+00
WP_136865658.1|1533899_1534532_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.6e-102
WP_032325227.1|1534477_1535221_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.2	4.5e-149
WP_001152185.1|1535231_1535930_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.7	3.1e-131
WP_000847302.1|1535929_1536259_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	94.5	1.2e-53
WP_106889282.1|1536255_1538835_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.1	0.0e+00
WP_000533431.1|1538815_1539229_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|1539255_1539687_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_032325228.1|1539700_1540453_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	95.6	1.3e-130
WP_000683137.1|1540460_1540856_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000975096.1|1540852_1541431_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000752994.1|1541442_1541796_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|1541807_1542203_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|1542244_1543270_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|1543325_1543658_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123251.1|1543667_1544987_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001443752.1|1544967_1546569_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000198153.1|1546565_1546772_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_000453587.1|1548668_1549214_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001307652.1|1549602_1549797_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881326.1|1549984_1550602_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092325.1|1550751_1551189_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000075132.1|1551185_1551683_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|1551682_1551889_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000143049.1|1552336_1554187_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000762928.1|1555357_1556179_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217413.1|1556175_1556550_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_001265229.1|1556562_1557612_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|1557613_1557886_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|1558007_1558352_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|1558471_1558684_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|1558917_1559475_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|1559476_1559695_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|1559822_1560134_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|1560126_1560354_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|1560350_1560632_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450872.1|1560664_1561426_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.2	3.9e-79
WP_001444941.1|1562199_1563162_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.5	2.7e-69
WP_000693943.1|1563184_1563610_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|1563606_1563909_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_001169687.1|1564006_1564378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302048.1|1564398_1564590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|1564591_1564870_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001427316.1|1565156_1565309_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_000560218.1|1565729_1565951_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
WP_001427414.1|1565950_1566121_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_001307773.1|1566194_1566470_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	3.0e-42
WP_000105101.1|1566568_1569220_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.6	0.0e+00
WP_000166317.1|1569212_1570022_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_042853000.1|1570078_1570273_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_001356607.1|1570265_1570454_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_001443927.1|1570560_1570842_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001189091.1|1570807_1571884_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	5.3e-98
WP_000976492.1|1572276_1572618_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|1572630_1573503_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|1573506_1573881_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1574019_1574250_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
1575697:1575711	attR	CGCAGGCGTAGCGGG	NA	NA	NA	NA
>prophage 8
NZ_CP027546	Escherichia coli strain 2013C-4187 chromosome, complete genome	5509931	1620523	1694444	5509931	capsid,tRNA,terminase,holin,head,tail,plate,integrase,portal	Enterobacteria_phage(75.0%)	81	1658058:1658117	1695387:1695507
WP_000564746.1|1620523_1621495_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_032323745.1|1621659_1624089_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214304.1|1624113_1625214_-	cytochrome c	NA	NA	NA	NA	NA
WP_032323742.1|1625601_1626348_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001300190.1|1626361_1626928_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025336.1|1627143_1628877_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_001297434.1|1629053_1629542_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|1629661_1630054_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067000.1|1630053_1632132_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_106889285.1|1632124_1633273_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|1633474_1634119_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|1634129_1634519_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|1634533_1635583_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|1635585_1636446_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483235.1|1636464_1638069_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	1.2e-13
WP_001342228.1|1638114_1639776_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|1639920_1640424_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001300654.1|1640444_1642409_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|1642413_1643340_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906335.1|1643336_1644224_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|1644350_1644929_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|1644931_1645282_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122426.1|1646061_1646490_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|1646496_1647921_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001295645.1|1647895_1648696_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|1648862_1649849_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187810.1|1649863_1651378_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548675.1|1651447_1652437_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179469.1|1653233_1653737_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082123.1|1653815_1654067_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|1654181_1654268_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237869.1|1654530_1654854_+	lipoprotein, function unknown	NA	NA	NA	NA	NA
WP_000917208.1|1655024_1655522_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|1655559_1655799_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797573.1|1655989_1657201_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847902.1|1657262_1657928_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
1658058:1658117	attL	AAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCT	NA	NA	NA	NA
WP_001342226.1|1658284_1659286_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.2	9.3e-105
WP_000865208.1|1659291_1659639_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290352.1|1659668_1660319_-	membrane protein	NA	NA	NA	NA	NA
WP_000786769.1|1660334_1660739_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|1660828_1660966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|1661037_1661241_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000742491.1|1661262_1661613_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.0	1.2e-48
WP_000158976.1|1661623_1661902_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	6.9e-34
WP_000357025.1|1661913_1662156_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_032323740.1|1662152_1662266_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	5.2e-09
WP_000985152.1|1662352_1662556_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000564224.1|1662879_1663269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272083.1|1663265_1666106_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
WP_000686499.1|1666182_1667142_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
WP_000211289.1|1667146_1667458_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_001289969.1|1667521_1668112_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.7	1.8e-31
WP_000087812.1|1668601_1669648_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613774.1|1669647_1671399_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_001262641.1|1671553_1672390_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	7.9e-150
WP_001055094.1|1672413_1673466_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_000632311.1|1673511_1674312_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	1.5e-126
WP_000063100.1|1674413_1674908_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_106913831.1|1674907_1675162_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	2.9e-31
WP_001342221.1|1675109_1675433_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000072343.1|1675429_1675822_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	2.9e-70
WP_000780555.1|1675818_1676226_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_000202151.1|1676364_1678242_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	82.2	1.1e-305
WP_001342220.1|1678265_1678733_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
WP_032324046.1|1678725_1679361_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_001271909.1|1679357_1679939_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.2e-101
WP_000213447.1|1679935_1680286_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111967.1|1680289_1681186_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.9e-154
WP_000071738.1|1681178_1681709_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
WP_000108514.1|1681711_1683844_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.2	8.0e-130
WP_000144010.1|1683843_1684422_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.2e-95
WP_000954196.1|1684465_1685038_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979950.1|1685194_1685683_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.1	7.5e-84
WP_000763327.1|1688488_1688617_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665308.1|1688652_1689018_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|1689072_1689585_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005439.1|1689584_1690769_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	3.4e-223
WP_000132847.1|1690926_1692027_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.1e-203
WP_001317900.1|1692426_1693566_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_000488107.1|1693852_1694113_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078921.1|1694303_1694444_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	5.9e-18
1695387:1695507	attR	AAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 9
NZ_CP027546	Escherichia coli strain 2013C-4187 chromosome, complete genome	5509931	1843495	1853404	5509931		Enterobacteria_phage(25.0%)	10	NA	NA
WP_001484691.1|1843495_1844602_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	31.0	5.2e-40
WP_024168774.1|1844621_1845017_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_016247326.1|1845012_1845561_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	48.4	4.2e-43
WP_001484692.1|1845598_1846408_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_001383307.1|1846434_1847307_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.1	2.8e-105
WP_016247327.1|1847364_1848264_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	4.4e-29
WP_001383310.1|1848263_1849349_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	8.8e-101
WP_000183060.1|1849720_1850614_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000999466.1|1850856_1851852_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_016247328.1|1852009_1853404_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	8.3e-19
>prophage 10
NZ_CP027546	Escherichia coli strain 2013C-4187 chromosome, complete genome	5509931	1945161	1955089	5509931	transposase	Enterobacteria_phage(62.5%)	9	NA	NA
WP_001292774.1|1945161_1946298_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001342301.1|1946294_1948295_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001171523.1|1948626_1949007_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1949003_1949351_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998019.1|1949400_1950786_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000950404.1|1951217_1951688_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_000598641.1|1951734_1952454_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1952450_1954136_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|1954357_1955089_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
>prophage 11
NZ_CP027546	Escherichia coli strain 2013C-4187 chromosome, complete genome	5509931	2025913	2128063	5509931	lysis,integrase,terminase,holin,head,tail,transposase,portal,protease	Enterobacteria_phage(37.5%)	117	2063062:2063080	2137278:2137296
WP_000101718.1|2025913_2027155_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.2e-98
WP_000387479.1|2027651_2027858_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001443784.1|2028541_2029102_+	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	45.5	9.0e-17
WP_001372127.1|2029091_2029313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204070.1|2029305_2029527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204970.1|2029528_2029762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|2029767_2030067_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833625.1|2030063_2031464_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
WP_001080641.1|2031665_2031911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391151.1|2032041_2032236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018604.1|2032239_2032401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229487.1|2032528_2033017_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	4.6e-25
WP_000624042.1|2033179_2034103_+	hypothetical protein	NA	A0A0R6PHC6	Moraxella_phage	24.9	6.9e-14
WP_001113637.1|2037481_2038129_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001211567.1|2038163_2039216_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_106889291.1|2039212_2039770_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_000982426.1|2039766_2041710_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_001026418.1|2041706_2042186_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000186540.1|2042182_2042392_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001295447.1|2042388_2043126_-	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000971723.1|2043167_2043830_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000888560.1|2043826_2044444_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000528376.1|2044462_2045065_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000835177.1|2045074_2045524_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000013509.1|2045520_2046384_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091291.1|2046370_2047066_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000778069.1|2047072_2049559_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000557378.1|2049555_2049819_-	chaperone NapD	NA	NA	NA	NA	NA
WP_000686723.1|2049808_2050303_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001296837.1|2050411_2050576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000849214.1|2050711_2051200_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000758074.1|2051348_2052995_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000422231.1|2053212_2054856_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|2054931_2055582_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786386.1|2055581_2056646_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|2056719_2057775_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|2057886_2058978_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_001249127.1|2059716_2062389_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061917.1|2062405_2063056_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
2063062:2063080	attL	TGTAGGCCAGATAAGACGC	NA	NA	NA	NA
WP_000876014.1|2063141_2065991_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001225855.1|2066265_2067042_-	YfaP family protein	NA	NA	NA	NA	NA
WP_001104541.1|2067046_2068696_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_001676637.1|2068696_2073091_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001025664.1|2073892_2075215_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.7	2.5e-227
WP_001448330.1|2075908_2076556_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.3	2.4e-37
WP_001023397.1|2076765_2077035_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	3.2e-44
WP_106913835.1|2077036_2078350_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.2e-77
WP_001228241.1|2078414_2079014_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_001230644.1|2079081_2079297_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	95.8	2.9e-32
WP_000099160.1|2079359_2080898_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|2080946_2081294_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|2081290_2081695_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_032325348.1|2081723_2085023_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	94.9	0.0e+00
WP_000090884.1|2085083_2085716_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_000194778.1|2085652_2086396_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	6.6e-148
WP_001152619.1|2086401_2087100_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000847413.1|2087099_2087429_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
WP_000082375.1|2087425_2089987_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.0	0.0e+00
WP_000533403.1|2089967_2090381_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479086.1|2090407_2090839_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_001143013.1|2090852_2091605_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000683071.1|2091612_2092008_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_000975037.1|2092004_2092580_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_001204544.1|2092594_2092948_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201528.1|2092940_2093315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522643.1|2093366_2094251_-	hypothetical protein	NA	C6ZCY2	Enterobacteria_phage	54.1	6.5e-94
WP_000256849.1|2094308_2094656_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
WP_001254039.1|2094692_2096198_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_001430223.1|2096187_2097780_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.1e-184
WP_000258991.1|2097776_2097983_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_024017589.1|2097966_2099895_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
WP_000235436.1|2099866_2100376_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001427981.1|2100770_2100965_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000738423.1|2101324_2101618_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|2101708_2101891_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000075153.1|2102107_2102605_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	96.4	1.6e-89
WP_000284524.1|2102604_2102820_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|2102962_2103361_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|2103441_2103600_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|2103685_2104429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235460.1|2104681_2105305_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001028854.1|2105301_2105967_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223927.1|2105963_2106566_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001108084.1|2106540_2107107_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001429269.1|2107600_2109436_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
WP_001254228.1|2109939_2110122_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_000153270.1|2110118_2110646_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_000810176.1|2110642_2111089_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000229807.1|2111096_2111303_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	97.1	1.8e-26
WP_000145926.1|2111375_2111666_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788878.1|2111662_2112364_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_032325349.1|2112360_2113299_-	replication protein	NA	C1JJ53	Enterobacteria_phage	99.7	1.8e-171
WP_000035947.1|2113331_2113628_-	hypothetical protein	NA	A0A0N7C1W0	Escherichia_phage	96.9	1.3e-46
WP_000276885.1|2113737_2113923_-	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_001095982.1|2114003_2114654_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_000256573.1|2114968_2115274_+	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
WP_000930321.1|2115276_2115615_+	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
WP_000167595.1|2115748_2116219_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065385.1|2116368_2116737_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
WP_001198860.1|2116809_2116974_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372926.1|2116942_2117107_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.1	3.2e-23
WP_000995439.1|2117161_2117458_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|2117463_2118249_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|2118245_2118923_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|2118922_2119105_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|2119077_2119269_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|2119279_2119561_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763358.1|2119659_2119881_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_001289868.1|2119877_2120483_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	96.9	1.7e-45
WP_001345188.1|2120479_2120830_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	80.2	3.3e-33
WP_000457736.1|2120904_2121147_+	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	96.2	3.7e-36
WP_001281192.1|2121265_2121610_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001444001.1|2121715_2121934_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_000533670.1|2121911_2122982_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001215756.1|2122996_2123602_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000012302.1|2123598_2125287_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001281242.1|2125435_2128063_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
2137278:2137296	attR	GCGTCTTATCTGGCCTACA	NA	NA	NA	NA
>prophage 12
NZ_CP027546	Escherichia coli strain 2013C-4187 chromosome, complete genome	5509931	2503150	2614612	5509931	capsid,tRNA,terminase,holin,integrase,head,tail,transposase	Stx2-converting_phage(33.8%)	108	2600493:2600507	2612853:2612867
WP_001298974.1|2503150_2503888_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2504019_2505354_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001341633.1|2505562_2506444_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|2506546_2507134_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|2507189_2507573_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|2507877_2508567_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|2508614_2509652_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2509858_2510278_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001341635.1|2510346_2511045_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000083007.1|2511076_2513737_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|2513850_2515206_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|2515251_2515575_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|2515571_2516870_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|2522722_2525296_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|2525425_2526157_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079094.1|2526153_2527134_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2527268_2528006_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2528276_2528618_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2528721_2528769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|2528867_2530028_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|2530070_2531192_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|2531202_2532273_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000976004.1|2532482_2532848_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|2532997_2533516_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969036.1|2533505_2534732_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|2534747_2535230_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2535306_2535654_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|2535695_2536463_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2536493_2537042_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2537060_2537309_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460032.1|2537557_2538919_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|2539085_2539877_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2539897_2541184_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|2541238_2541832_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|2541954_2542833_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|2542918_2544580_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2544728_2545070_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|2545131_2545422_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|2545411_2545888_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_032324018.1|2546019_2546502_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.2	1.5e-28
WP_032324038.1|2549993_2553395_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.0e-219
WP_001301673.1|2553986_2556335_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|2556354_2556444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023420.1|2556550_2556820_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_000268987.1|2556821_2558135_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
WP_001228241.1|2558199_2558799_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_001339397.1|2558861_2559539_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2559538_2559886_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|2559905_2561477_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_085948186.1|2562021_2563177_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_122996338.1|2566553_2567186_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.1	4.9e-104
WP_000194787.1|2567131_2567875_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.1e-146
WP_001341641.1|2567885_2568584_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	97.4	7.6e-130
WP_000807927.1|2568583_2568925_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_000212998.1|2568917_2572160_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.5	0.0e+00
WP_122993730.1|2572210_2572420_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	92.8	2.6e-30
WP_000710952.1|2572515_2572890_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275441.1|2572904_2573621_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133393.1|2573687_2574032_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2574028_2574475_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007889.1|2574471_2574822_-|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000125996.1|2574832_2575159_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	1.6e-53
WP_001063099.1|2577685_2577907_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_032325321.1|2577951_2579730_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	90.1	0.0e+00
WP_032323913.1|2579793_2581455_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_000958380.1|2581451_2582015_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_025380422.1|2582303_2582669_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.8e-65
WP_000095736.1|2582710_2582938_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_085948186.1|2583424_2584581_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_050438101.1|2584702_2585611_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_000088311.1|2585556_2585859_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_047091958.1|2586150_2586336_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.3	1.3e-17
WP_000992122.1|2586854_2587388_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000731236.1|2587438_2587783_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000284519.1|2587787_2588003_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_001290231.1|2588079_2588352_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143462.1|2588392_2588572_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_032212763.1|2588707_2590645_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.7	0.0e+00
WP_001131907.1|2592678_2593227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205460.1|2593239_2593581_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001379493.1|2593598_2594588_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	7.3e-195
WP_024220650.1|2594595_2595405_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	97.8	4.5e-150
WP_000767117.1|2595424_2595814_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	100.0	7.1e-69
WP_000210187.1|2595810_2596137_-	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
WP_000066917.1|2596133_2596787_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_001305611.1|2596786_2597281_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_000104954.1|2597277_2598219_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_001250269.1|2598208_2598388_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|2598563_2599115_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|2599107_2599368_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|2599465_2600158_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000559922.1|2600477_2600993_-	hypothetical protein	NA	NA	NA	NA	NA
2600493:2600507	attL	AAGTTTTCTGGACAA	NA	NA	NA	NA
WP_000135680.1|2601463_2601826_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081319.1|2601891_2602716_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	5.0e-149
WP_106913837.1|2602844_2603381_+	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	98.9	1.1e-99
WP_032323952.1|2603371_2604250_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	94.5	1.2e-169
WP_032323951.1|2604246_2604450_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	1.2e-30
WP_000476199.1|2604442_2604682_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	3.7e-36
WP_000034210.1|2604678_2605008_+	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	37.5	1.1e-25
WP_000206753.1|2605009_2605873_+	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	53.6	3.2e-69
WP_000457722.1|2605957_2606200_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	82.5	1.8e-30
WP_000557643.1|2606203_2606350_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	90.9	1.7e-20
WP_000516611.1|2606522_2607698_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	91.2	4.6e-204
WP_001431537.1|2608180_2609089_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	100.0	2.3e-171
WP_001341819.1|2609387_2610617_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|2610655_2611072_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214985.1|2611143_2612892_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	100.0	0.0e+00
2612853:2612867	attR	AAGTTTTCTGGACAA	NA	NA	NA	NA
WP_000577251.1|2612893_2614612_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	100.0	6.5e-308
>prophage 13
NZ_CP027546	Escherichia coli strain 2013C-4187 chromosome, complete genome	5509931	2687534	2694674	5509931		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|2687534_2690096_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141347.1|2690201_2690858_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001297141.1|2690908_2691676_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2691871_2692780_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|2692776_2694039_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2694035_2694674_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 14
NZ_CP027546	Escherichia coli strain 2013C-4187 chromosome, complete genome	5509931	2846606	2853513	5509931	transposase,integrase	Stx2-converting_phage(50.0%)	6	2844563:2844579	2853648:2853664
2844563:2844579	attL	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
WP_000381395.1|2846606_2848178_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2848197_2848545_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2848544_2849222_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000082600.1|2849616_2850345_-	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	41.2	7.1e-14
WP_000852869.1|2851253_2851913_-	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	33.9	3.6e-33
WP_000935135.1|2851905_2853513_-|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	28.0	4.3e-11
2853648:2853664	attR	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
>prophage 15
NZ_CP027546	Escherichia coli strain 2013C-4187 chromosome, complete genome	5509931	3732357	3745690	5509931	integrase,transposase	Enterobacteria_phage(66.67%)	15	3732175:3732197	3746175:3746197
3732175:3732197	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001218979.1|3732357_3733527_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.1	1.7e-198
WP_000119815.1|3733546_3735406_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
WP_000186475.1|3735402_3735828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446132.1|3736155_3736728_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638629.1|3736801_3737302_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283024.1|3737298_3738033_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.0	5.7e-128
WP_001149160.1|3738584_3738851_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_106889314.1|3738847_3739447_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.0	1.3e-50
WP_001244665.1|3739439_3739727_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459320.1|3739719_3740175_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	6.1e-64
WP_000381395.1|3740250_3741822_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|3741841_3742189_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|3742188_3742866_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000856729.1|3743021_3743342_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783645.1|3743356_3745690_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
3746175:3746197	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 16
NZ_CP027546	Escherichia coli strain 2013C-4187 chromosome, complete genome	5509931	4344048	4375738	5509931	transposase,integrase,protease	Stx2-converting_phage(36.36%)	25	4337900:4337916	4376121:4376137
4337900:4337916	attL	ATCCAGCGCCTGACGGA	NA	NA	NA	NA
WP_071830505.1|4344048_4345668_+|transposase	ISL3-like element ISEc38 family transposase	transposase	NA	NA	NA	NA
WP_032325301.1|4345664_4347236_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.4	2.2e-294
WP_001218841.1|4347352_4348618_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_001188520.1|4348997_4349573_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068905.1|4349609_4351307_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883338.1|4351282_4351621_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|4351736_4353038_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000069437.1|4353155_4354592_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|4354928_4355405_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015837.1|4355420_4356677_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|4356952_4357246_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|4357289_4358936_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|4359073_4359427_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000399685.1|4359679_4360660_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000471889.1|4360887_4363584_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|4363724_4363778_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_032323928.1|4363962_4364910_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	3.5e-13
WP_001297258.1|4365028_4366450_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001341327.1|4366499_4368155_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_000187778.1|4368548_4370687_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106238.1|4370845_4371310_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000839179.1|4371745_4372150_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|4372146_4372494_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|4372542_4374081_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_001162171.1|4374385_4375738_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
4376121:4376137	attR	TCCGTCAGGCGCTGGAT	NA	NA	NA	NA
>prophage 17
NZ_CP027546	Escherichia coli strain 2013C-4187 chromosome, complete genome	5509931	4463273	4526785	5509931	transposase,integrase,tRNA	Stx2-converting_phage(46.15%)	60	4472069:4472084	4508518:4508533
WP_000399648.1|4463273_4464254_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000047539.1|4464530_4464917_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|4464989_4465451_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|4465463_4466399_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|4466402_4466537_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230273.1|4466817_4467213_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500687.1|4467343_4468057_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256681.1|4468127_4468721_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000583470.1|4468865_4469318_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_001074121.1|4469440_4470952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012897.1|4471128_4472142_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
4472069:4472084	attL	TGCAGCAGGCTGTTGA	NA	NA	NA	NA
WP_000002953.1|4472303_4472720_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059398.1|4472765_4473269_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000416407.1|4474711_4477567_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786398.1|4477566_4478010_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|4478363_4479875_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584109.1|4480141_4481242_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|4481241_4482324_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001332879.1|4482442_4483945_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_000061768.1|4484074_4485094_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
WP_000772685.1|4485537_4486800_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	2.8e-74
WP_000356577.1|4487043_4487883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000091133.1|4488022_4489609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|4489898_4490576_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4490575_4490923_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|4490942_4492514_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001185332.1|4492823_4493096_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	46.9	8.3e-08
WP_000991130.1|4493097_4493652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214377.1|4493648_4494401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001084853.1|4495315_4495576_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	67.5	4.6e-24
WP_000761643.1|4495572_4496121_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.8	5.9e-29
WP_001014979.1|4496120_4496345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000842358.1|4496341_4496665_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_000016235.1|4496679_4499013_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.8	0.0e+00
WP_000594911.1|4499918_4500743_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_000227281.1|4500791_4501364_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000177060.1|4502717_4502975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|4503533_4504301_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|4504301_4505258_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_106889325.1|4505254_4506253_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879164.1|4506249_4507152_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_106889324.1|4507196_4509521_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
4508518:4508533	attR	TGCAGCAGGCTGTTGA	NA	NA	NA	NA
WP_001068910.1|4509607_4510561_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|4510557_4511079_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555341.1|4512829_4513087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159026387.1|4513819_4515178_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000998019.1|4515416_4516802_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|4516851_4517199_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|4517195_4517576_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001221615.1|4517930_4518365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271003.1|4518352_4518754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221529.1|4518919_4519489_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000381395.1|4520228_4521800_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|4521819_4522167_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|4522166_4522844_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001344112.1|4522911_4523088_-	hemolysin activation protein	NA	NA	NA	NA	NA
WP_077221339.1|4523721_4524000_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000839179.1|4524449_4524854_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|4524850_4525198_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|4525246_4526785_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
>prophage 18
NZ_CP027546	Escherichia coli strain 2013C-4187 chromosome, complete genome	5509931	5248063	5316890	5509931	lysis,capsid,tRNA,integrase,terminase,head,tail,transposase,portal,protease	Enterobacteria_phage(56.9%)	79	5258224:5258270	5308364:5308410
WP_000912342.1|5248063_5249449_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_001143540.1|5249484_5250006_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|5250113_5250326_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|5250327_5251194_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|5251674_5252217_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988363.1|5252436_5253129_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000701359.1|5253159_5255769_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|5255747_5256788_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255226.1|5256798_5257314_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|5257316_5257949_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
5258224:5258270	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_085948186.1|5258977_5260134_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_106913845.1|5260195_5260606_-|integrase	integrase	integrase	A0A088CD23	Shigella_phage	83.1	2.6e-61
WP_000446905.1|5260569_5260941_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|5260912_5261191_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763390.1|5261238_5261457_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_001443983.1|5261555_5261837_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|5261847_5262039_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|5262011_5262194_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|5262190_5262871_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000100847.1|5262867_5263653_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|5263658_5263955_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000206913.1|5264030_5264321_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	82.4	2.5e-26
WP_001444023.1|5264787_5265108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000066829.1|5265243_5265507_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
WP_000858975.1|5265588_5266278_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|5266382_5266613_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182773.1|5266682_5267222_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_159032309.1|5267308_5268238_+	Replication protein O	NA	M1FN81	Enterobacteria_phage	66.7	2.9e-108
WP_000788789.1|5268234_5268936_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
WP_000152742.1|5269140_5269488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001415151.1|5270240_5270849_+	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_001038620.1|5271148_5271565_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_000520500.1|5271543_5271945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097617.1|5272068_5272170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053023.1|5272166_5272622_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_000224914.1|5272621_5272792_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774477.1|5272784_5273075_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_001099712.1|5273071_5273434_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971074.1|5273430_5273571_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204791.1|5273656_5274040_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737278.1|5274228_5275311_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
WP_000839596.1|5275899_5276115_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_032325290.1|5276114_5276612_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	1.6e-89
WP_001228695.1|5276828_5277011_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|5277101_5277395_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001427981.1|5277754_5277949_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000453558.1|5278337_5278883_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027295.1|5278857_5280783_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|5280779_5280986_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001444138.1|5280982_5282584_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	8.5e-310
WP_000381395.1|5283056_5284628_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|5284647_5284995_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|5284994_5285672_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000088640.1|5285712_5286591_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.0	1.7e-147
WP_001345004.1|5286600_5286933_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063244.1|5286988_5288014_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_000158868.1|5288055_5288451_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752961.1|5288462_5288837_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
WP_000985132.1|5288827_5289406_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683110.1|5289402_5289798_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_001342267.1|5289805_5290546_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|5290561_5290984_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|5290965_5291400_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_032324072.1|5293949_5294279_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	2.6e-56
WP_001152557.1|5294278_5294977_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	3.4e-130
WP_000090884.1|5295662_5296295_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_000515439.1|5296355_5299769_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_001230523.1|5299839_5300439_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
WP_000279150.1|5300503_5303464_+	membrane protein	NA	A0A2D1UII2	Escherichia_phage	98.3	3.0e-58
WP_000885569.1|5303463_5304048_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_000239881.1|5304102_5304771_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|5304827_5305133_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226384.1|5305316_5306801_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|5306987_5307941_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177453.1|5308453_5309215_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
5308364:5308410	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|5309397_5310288_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001375368.1|5310288_5313261_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383941.1|5313247_5315485_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420938.1|5315753_5316890_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP027547	Escherichia coli strain 2013C-4187 plasmid unnamed, complete sequence	95367	90	74362	95367	integrase,protease,transposase	Stx2-converting_phage(48.15%)	59	69986:70045	76074:77337
WP_106881567.1|90_1659_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	55.8	1.1e-157
WP_000631725.1|1662_2010_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|2006_2681_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_136139077.1|2611_3031_+	DUF1449 family protein	NA	NA	NA	NA	NA
WP_106889344.1|3968_7871_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	7.2e-238
WP_136138333.1|8674_9088_-	DUF1449 family protein	NA	NA	NA	NA	NA
WP_106881565.1|9086_10299_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	98.6	3.5e-167
WP_001341409.1|11067_11388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001291056.1|14339_14672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000157095.1|14903_15239_+	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
WP_001341408.1|15324_16173_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000148286.1|16750_17002_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077776889.1|17032_17254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000038351.1|17277_18168_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	4.4e-66
WP_001247865.1|18232_18499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218854.1|18591_19026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000117628.1|19753_20254_-	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_032313270.1|20715_21033_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.8	4.5e-05
WP_001276261.1|21309_22029_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001341455.1|22025_22508_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000274418.1|22552_22987_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001443814.1|22998_23217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032324142.1|23216_23900_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	2.1e-28
WP_001431782.1|24283_24721_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000921957.1|25459_26419_+	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.9	5.4e-62
WP_000445934.1|26418_26814_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_085948186.1|27518_28675_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001172748.1|29041_29431_-	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_000387727.1|29474_31484_-	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_101981703.1|31471_31684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086163899.1|31792_31891_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.5e-07
WP_106881565.1|31856_33070_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	98.6	3.5e-167
WP_000361610.1|33875_34853_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_000381395.1|35099_36671_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|36690_37038_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|37037_37715_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_106913852.1|37755_37950_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	100.0	5.9e-24
WP_001341423.1|38003_38678_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|38674_39022_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_106881567.1|39025_40594_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	55.8	1.1e-157
WP_000091308.1|41417_41783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937603.1|41782_42970_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000422675.1|46948_47425_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.7	3.0e-45
WP_001443774.1|50551_50782_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000907857.1|61358_62390_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000335839.1|63098_63740_+	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_000154135.1|63880_64546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106881567.1|65205_66774_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	55.8	1.1e-157
WP_000631725.1|66777_67125_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|67121_67796_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001066949.1|67849_68236_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000704534.1|68363_69224_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
WP_157776129.1|69712_69988_+	hypothetical protein	NA	NA	NA	NA	NA
69986:70045	attL	TGAGGTGTACTGGCAATAGCGGACACTACCATTTGTTCTTTTTTTAAGCAGCCATCTGAT	NA	NA	NA	NA
WP_085948186.1|70028_71185_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001165114.1|71252_71798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044768.1|71959_72376_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261287.1|72372_72603_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000465041.1|73164_73578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001164205.1|73579_74362_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
76074:77337	attR	ATCAGATGGCTGCTTAAAAAAAGAACAAATGGTAGTGTCCGCTATTGCCAGTACACCTCATGTTGAATATGCGAATGACTAATACACTGTTATAAAGGCTGCATAAAAAGGCCGGAATCCCGGCCCTTATATTCTCGCTTACCACTTTCTTTAATGTGAATTTCACCAGGAAGCAGTATCTGGTACTCTTTACCAGAAAACATCGCCCCGAGCCTTGTGAGCGACTCTCCGATGATGCCACGGTGAGTGCTGGCGTTAAAATCGTATTTATCATCATATGAACATTGTAAAAGAAGATGTTCCTGTGCTGGATATAATTGCTCATTCTGTTGTTGATAGATAATAACTTTATCAAGTAATTTAATACTATCCATTCCATTAACTCTTTTTAAAGATAAAAACTGTATCATAGCTTGTTTAAATAACATAGATAATCTTTACGAGATTATTTCATAAATCTATATCATATAAAAAGCCAATATGTTATTTATATACTAACGTTCACGTAAACTTTCATTAATAGTTTCCTTTAATGGACTAAGAAGATAGCTGATAACACTACGCACCCCGGTTTTTATTTCTGCCATAACAGTCATTCCAGCTGTAACAGGGATTTTTTTTCTTTCTCCCTGTATATCATTCCGATCAACAGATATAATCACGTTAAATACAAGCCCTGTATCCGGAACAGAAACAGAATCTGCAGTTATATTTTTTACTTTCCCTGTAAGGTAACCATGACGTGTATATGGATATGCATCTACTTTAATAACGACCTCCTGTCCAGGTTGTATAAAACCGATATCCTTGTTAAGTACAGATGCTGTTACTTCGAGAATATCATTATCAGGGACAATAATCATCAGCGTTTCTGCTGTTGTGACAACACCACCTTCTGTATGTATATTTAACTCCTGAACAGTACCACTCACAGGAGCTTTAATAAAAGATGATGCTTTTCTCTGCCTGTTTTTTTCAAGCTCATGCTCCAGCAACACAATGTTATCTGTTGATTTTCTGTGCTTCTCGATAATTTCACTTCTGAAGATATTCGTCTCCAGTGCCAGTTCTTCCCGCACAAGTTCTATTTCTTTTTCAAGTTGAGAAACCTGTGCAAGCCAGACTGCATGTTCATTTTTTGCCTGAATATAGCTATTTTCCTGCTCCATAACTGAATGTTGAGAAACAGCTTTTTTATTCAACAAATACTTAAAATCATTGAGTTTTCTTCCTTCCTGTGATACCTGATGCTCATACAGGCTAA	NA	NA	NA	NA
