The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028105	Fusobacterium ulcerans strain ATCC 49185 chromosome, complete genome	3537675	3618	46835	3537675	capsid,holin,protease,terminase,portal,plate,head,tail,tRNA	Clostridium_phage(50.0%)	47	NA	NA
WP_005982208.1|3618_4890_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.8	2.7e-93
WP_005982206.1|4921_5515_-	DUF2344 domain-containing protein	NA	NA	NA	NA	NA
WP_005982204.1|5598_6609_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_005982202.1|6629_7109_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_005982200.1|7138_9220_-	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_005982198.1|9235_13678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982197.1|13695_14397_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_005982195.1|14399_16286_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_005982193.1|16313_16970_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_005982192.1|16996_18334_-	potassium transporter KtrB	NA	NA	NA	NA	NA
WP_005982190.1|18517_19759_-	peptidase T	NA	NA	NA	NA	NA
WP_005982188.1|19836_21225_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_005982187.1|21262_21697_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005982184.1|22005_22476_-|holin	phage holin family protein	holin	M9Q253	Clostridium_phage	39.4	1.3e-16
WP_005982182.1|22489_22978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982180.1|22990_23563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982178.1|23606_24131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982177.1|24203_24911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982174.1|24923_25475_-	YmfQ family protein	NA	A0A0A7RTU9	Clostridium_phage	41.9	2.9e-28
WP_005982172.1|25475_26534_-|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	40.5	5.4e-63
WP_005982170.1|26530_26983_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_005982168.1|26961_27516_-	DUF2577 family protein	NA	NA	NA	NA	NA
WP_005982166.1|27512_28490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982164.1|28482_28923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982162.1|28936_30808_-	hypothetical protein	NA	A0A0E3Y5G6	Fusobacterium_phage	33.7	3.7e-30
WP_005982160.1|30916_31063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982158.1|31214_31628_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_005982156.1|31646_32081_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_005982154.1|32093_33158_-|terminase	terminase	terminase	A0A0A8WJL8	Clostridium_phage	35.5	4.6e-54
WP_005982152.1|33150_33603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982150.1|33602_34022_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_005982148.1|34027_34363_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_005982146.1|34363_34642_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0A7S0C9	Clostridium_phage	46.2	6.0e-14
WP_005982141.1|34653_35766_-|capsid	phage major capsid protein	capsid	Q2I8F7	Bacillus_phage	31.7	9.5e-42
WP_005982138.1|35768_36509_-|protease	Clp protease ClpP	protease	J9QE31	Clostridium_phage	38.9	5.5e-38
WP_005982136.1|36501_37722_-|portal	phage portal protein	portal	A6M949	Geobacillus_virus	47.5	1.0e-97
WP_005982134.1|37744_39451_-|terminase	terminase large subunit	terminase	A0A0A7RVS5	Clostridium_phage	49.7	3.6e-157
WP_005982132.1|39454_39946_-|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	34.2	1.6e-17
WP_005982129.1|40036_40468_-	hypothetical protein	NA	I2E8Y8	Clostridium_phage	36.4	4.5e-08
WP_005982128.1|40703_41114_-	hypothetical protein	NA	A0A2K5B275	Erysipelothrix_phage	26.5	1.4e-06
WP_005982126.1|41116_41368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982124.1|41364_41889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982122.1|41889_42069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040490925.1|42195_43131_-	site-specific DNA-methyltransferase	NA	G1D1F5	Mycobacterium_virus	39.0	6.5e-52
WP_005982117.1|43134_43890_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_005982115.1|43873_44080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982113.1|44522_46835_-	toprim domain-containing protein	NA	A0A1B1IP14	uncultured_Mediterranean_phage	27.1	6.8e-18
>prophage 2
NZ_CP028105	Fusobacterium ulcerans strain ATCC 49185 chromosome, complete genome	3537675	395571	425523	3537675	transposase,holin,terminase,plate,integrase,capsid	Fusobacterium_phage(71.43%)	45	407261:407280	429146:429165
WP_040490909.1|395571_396018_-|holin	phage holin family protein	holin	D7RWK5	Brochothrix_phage	38.8	1.8e-12
WP_005981462.1|396063_396315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981460.1|396317_396701_-	M15 family metallopeptidase	NA	A0A076YI70	Citrobacter_phage	41.8	1.1e-18
WP_005981457.1|396716_397319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981455.1|397331_398027_-	hypothetical protein	NA	A0A0E3Y6G8	Fusobacterium_phage	31.1	6.4e-12
WP_005981453.1|398027_398558_-	hypothetical protein	NA	A0A0E3Y5G1	Fusobacterium_phage	43.0	4.5e-34
WP_005981451.1|398562_399717_-|plate	baseplate J/gp47 family protein	plate	A0A0E3Y634	Fusobacterium_phage	51.5	2.4e-104
WP_005981449.1|399713_400064_-	hypothetical protein	NA	A0A0E3U2P9	Fusobacterium_phage	58.9	1.2e-19
WP_005981447.1|400073_400727_-	hypothetical protein	NA	A0A0E3U262	Fusobacterium_phage	46.0	3.2e-29
WP_005981445.1|400732_401545_-	hypothetical protein	NA	A0A0E3Y4V7	Fusobacterium_phage	41.0	6.0e-54
WP_005981442.1|401541_401874_-	hypothetical protein	NA	A0A0E3Y6B2	Fusobacterium_phage	46.3	2.5e-22
WP_005981440.1|401870_402446_-	hypothetical protein	NA	A0A0E3U263	Fusobacterium_phage	49.6	7.3e-22
WP_005981438.1|402438_404133_-	hypothetical protein	NA	A0A0E3Y5G6	Fusobacterium_phage	41.0	5.6e-86
WP_005981435.1|404321_404774_-	hypothetical protein	NA	A0A0E3Y638	Fusobacterium_phage	35.3	1.6e-19
WP_005981433.1|404777_405221_-	DUF3277 family protein	NA	NA	NA	NA	NA
WP_005981432.1|405233_406232_-	hypothetical protein	NA	A0A0E3U2Q2	Fusobacterium_phage	54.7	6.6e-95
WP_005981431.1|406224_406725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981429.1|406717_407050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981426.1|407052_407505_-	hypothetical protein	NA	A0A0E3Y6H6	Fusobacterium_phage	41.4	1.3e-26
407261:407280	attL	CTTTTTTCATAAAGCTTTTT	NA	NA	NA	NA
WP_005981425.1|407504_407903_-	hypothetical protein	NA	A0A0E3Y5G9	Fusobacterium_phage	47.1	9.3e-24
WP_005981423.1|407904_408075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981421.1|408076_409189_-	DUF5309 family protein	NA	A0A2H4J2M3	uncultured_Caudovirales_phage	31.3	7.0e-37
WP_005981419.1|409205_409796_-	phage scaffolding protein	NA	NA	NA	NA	NA
WP_005981417.1|409795_410584_-|capsid	minor capsid protein	capsid	A0A0E3Y641	Fusobacterium_phage	38.1	5.7e-41
WP_005981415.1|410583_412077_-	hypothetical protein	NA	A0A0E3Y4W1	Fusobacterium_phage	39.9	1.9e-93
WP_040490877.1|412188_413532_-|terminase	PBSX family phage terminase large subunit	terminase	S6AVV7	Thermus_phage	53.6	9.8e-126
WP_005981411.1|413464_413908_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005981409.1|414113_414611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005981407.1|414628_414865_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005981405.1|414979_415876_-	DNA adenine methylase	NA	NA	NA	NA	NA
WP_167537218.1|416143_416281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981403.1|416422_417157_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005981401.1|417250_417844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981399.1|417884_418679_-	prohibitin family protein	NA	NA	NA	NA	NA
WP_167537217.1|418696_418846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981395.1|418889_419123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981393.1|419139_419412_-	hypothetical protein	NA	A0A0A7RWV6	Clostridium_phage	55.6	2.0e-22
WP_005981391.1|419408_419786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981389.1|419866_420268_-	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
WP_005981387.1|420270_420915_-	DUF3164 family protein	NA	NA	NA	NA	NA
WP_005981384.1|420977_421229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981383.1|421239_422208_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005981382.1|422217_424107_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A0N7ACC7	Bacillus_phage	27.3	3.7e-38
WP_005981380.1|424118_424529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981375.1|424737_425523_-|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
429146:429165	attR	CTTTTTTCATAAAGCTTTTT	NA	NA	NA	NA
>prophage 3
NZ_CP028105	Fusobacterium ulcerans strain ATCC 49185 chromosome, complete genome	3537675	1848477	1860379	3537675		Staphylococcus_phage(40.0%)	12	NA	NA
WP_040490854.1|1848477_1850331_+	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	26.7	3.0e-24
WP_040490792.1|1850350_1850728_+	response regulator	NA	A0A220YL79	Alteromonas_virus	27.0	1.0e-08
WP_008698289.1|1850724_1851396_+	response regulator	NA	A0A1V0SGR9	Hokovirus	30.3	3.5e-07
WP_005979065.1|1851405_1852548_+	universal stress protein	NA	NA	NA	NA	NA
WP_040490796.1|1852611_1853445_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	54.3	4.9e-19
WP_005979069.1|1853462_1854797_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_005979071.1|1855174_1855636_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	55.7	1.1e-41
WP_005979073.1|1855653_1856715_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.5	4.5e-49
WP_040490855.1|1856732_1857380_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.7	8.8e-32
WP_005979077.1|1857397_1858591_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.9	1.8e-115
WP_005979079.1|1858704_1859646_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	32.3	3.3e-11
WP_005979081.1|1859659_1860379_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	43.0	2.3e-28
>prophage 4
NZ_CP028105	Fusobacterium ulcerans strain ATCC 49185 chromosome, complete genome	3537675	2611926	2668966	3537675	head,protease,terminase,portal,integrase,tail,capsid,tRNA	Clostridium_phage(26.67%)	63	2651976:2651994	2671957:2671975
WP_005976710.1|2611926_2612655_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_005976712.1|2612651_2613188_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_005976714.1|2613228_2613792_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_005976716.1|2613813_2618154_+	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	34.1	1.8e-24
WP_005976718.1|2618162_2619080_+	EamA family transporter	NA	NA	NA	NA	NA
WP_005976720.1|2619157_2619436_+	HU family DNA-binding protein	NA	G4WAL8	Salmonella_phage	40.7	1.6e-11
WP_106878589.1|2619688_2620891_+	threonine ammonia-lyase	NA	A0A1W6JHY1	Lactococcus_phage	29.3	2.3e-09
WP_005976724.1|2620969_2622244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976726.1|2622233_2622980_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_005976728.1|2623003_2624386_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_005976730.1|2624476_2625346_+	DUF2156 domain-containing protein	NA	NA	NA	NA	NA
WP_005976732.1|2625495_2626905_+	[FeFe] hydrogenase H-cluster radical SAM maturase HydG	NA	NA	NA	NA	NA
WP_005976734.1|2626976_2627216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005976736.1|2627381_2627981_-	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_005976738.1|2628238_2628622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976740.1|2628785_2629031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976742.1|2629159_2629936_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_005976746.1|2630210_2631083_+	AAA family ATPase	NA	Q56VQ0	Pseudomonas_phage	35.0	4.2e-21
WP_005976749.1|2631149_2631932_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_005976751.1|2631957_2633244_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_005976753.1|2633236_2633713_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_005976755.1|2633727_2634729_-	C4-dicarboxylate TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005976757.1|2634801_2635845_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.9	7.8e-22
WP_005976759.1|2636110_2637220_-	alanine racemase	NA	NA	NA	NA	NA
WP_005976761.1|2637235_2638561_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_005976763.1|2638608_2639967_-	GntP family permease	NA	NA	NA	NA	NA
WP_005976765.1|2640385_2640943_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_005976767.1|2641070_2641919_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_005976769.1|2642127_2644089_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_170067064.1|2644724_2645843_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_005976771.1|2645877_2646267_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005976773.1|2646426_2646639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976775.1|2646669_2646834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976777.1|2646946_2647360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976781.1|2647594_2648062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167537209.1|2648054_2648222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976785.1|2648429_2649362_+	phage replisome organizer N-terminal domain-containing protein	NA	A0A1P8BKV2	Lactococcus_phage	37.6	9.1e-14
WP_005976787.1|2649375_2650185_+	ATP-binding protein	NA	A0A0S2SXI8	Bacillus_phage	32.5	5.0e-24
WP_005976789.1|2650198_2650714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976791.1|2650729_2651473_+	ParA family protein	NA	A0A0E3Y677	Fusobacterium_phage	46.9	2.7e-48
WP_005976793.1|2651469_2652480_+	hypothetical protein	NA	NA	NA	NA	NA
2651976:2651994	attL	AAAATCGCAACTTCCGAAA	NA	NA	NA	NA
WP_005976795.1|2652480_2652741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976798.1|2652832_2653009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976799.1|2653001_2653778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976800.1|2653780_2653981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976801.1|2653961_2655029_+|integrase	site-specific integrase	integrase	A0A0A8WF08	Clostridium_phage	51.0	4.8e-91
WP_145959521.1|2655300_2655618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976803.1|2655625_2656168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976804.1|2656226_2657906_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_167537210.1|2658257_2658425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976806.1|2658714_2659815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976807.1|2659975_2660515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976808.1|2660514_2660946_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_005976809.1|2661059_2661515_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_005976810.1|2661516_2663232_+|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	44.1	6.4e-130
WP_005976811.1|2663228_2664503_+|portal	phage portal protein	portal	A6M949	Geobacillus_virus	45.0	6.5e-87
WP_005976812.1|2664471_2665230_+|protease	Clp protease ClpP	protease	A0A0A7RTN2	Clostridium_phage	47.0	6.0e-48
WP_005976813.1|2665230_2666382_+|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	46.8	1.7e-73
WP_005976814.1|2666394_2666676_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A6M953	Geobacillus_virus	42.6	2.8e-06
WP_005976815.1|2666676_2667009_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_005976816.1|2667012_2667420_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_005976817.1|2667429_2667873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976818.1|2667874_2668966_+	hypothetical protein	NA	A0A090D804	Clostridium_phage	27.6	1.0e-24
2671957:2671975	attR	AAAATCGCAACTTCCGAAA	NA	NA	NA	NA
>prophage 5
NZ_CP028105	Fusobacterium ulcerans strain ATCC 49185 chromosome, complete genome	3537675	2915969	2921732	3537675		Prochlorococcus_phage(33.33%)	6	NA	NA
WP_005977780.1|2915969_2916449_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	46.7	1.4e-26
WP_005977777.1|2916512_2917229_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	43.2	4.0e-41
WP_005977775.1|2917228_2918626_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	34.6	8.8e-61
WP_005977773.1|2918648_2919650_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FC27	Synechococcus_phage	44.0	1.4e-65
WP_005977769.1|2919637_2920213_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.8	6.0e-24
WP_040490711.1|2920226_2921732_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.0	3.6e-68
>prophage 6
NZ_CP028105	Fusobacterium ulcerans strain ATCC 49185 chromosome, complete genome	3537675	3358405	3401732	3537675	capsid,holin,protease,terminase,portal,plate,integrase,tail,tRNA	Fusobacterium_phage(71.43%)	49	3362177:3362197	3377044:3377064
WP_005979964.1|3358405_3359485_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005979966.1|3359509_3360286_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_005979967.1|3360494_3362174_+	hydroxylamine reductase	NA	NA	NA	NA	NA
3362177:3362197	attL	TTAAATTATAATTTTTATAAA	NA	NA	NA	NA
WP_005979968.1|3362358_3363765_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	34.8	4.7e-54
WP_005979969.1|3363957_3365667_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.2	2.8e-69
WP_040490831.1|3365741_3368318_-	ATP-dependent chaperone ClpB	NA	A0A0A8J958	Klebsiella_phage	36.6	5.3e-120
WP_005979973.1|3368701_3369199_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_005979975.1|3369291_3370521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005979978.1|3370885_3371491_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_005979980.1|3371587_3372382_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_005979982.1|3372505_3374044_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_005979984.1|3374169_3374619_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	38.5	1.2e-16
WP_005979986.1|3374631_3374868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005979988.1|3374879_3375443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106878625.1|3375457_3375973_-	hypothetical protein	NA	A0A0E3U2P7	Fusobacterium_phage	36.3	5.1e-06
WP_005979991.1|3375985_3376960_-|integrase	site-specific integrase	integrase	A0A0E3U2P3	Fusobacterium_phage	39.8	4.5e-56
WP_040490632.1|3377480_3377711_-	hypothetical protein	NA	NA	NA	NA	NA
3377044:3377064	attR	TTAAATTATAATTTTTATAAA	NA	NA	NA	NA
WP_106878603.1|3377747_3378899_-	hypothetical protein	NA	A0A0E3Y5F3	Fusobacterium_phage	37.3	7.0e-48
WP_005979998.1|3378895_3379534_-|tail	phage tail protein I	tail	A0A0E3U255	Fusobacterium_phage	44.8	1.5e-44
WP_005980000.1|3379526_3380624_-|plate	baseplate J/gp47 family protein	plate	A0A0E3U2P1	Fusobacterium_phage	56.3	1.7e-115
WP_005980002.1|3380616_3380922_-	hypothetical protein	NA	A0A0E3Y6F8	Fusobacterium_phage	53.7	6.9e-19
WP_005980004.1|3380921_3381314_-|tail	phage tail protein	tail	A0A0E3Y6A2	Fusobacterium_phage	54.6	7.0e-32
WP_005980007.1|3381322_3381820_-|plate	phage baseplate assembly protein V	plate	A0A0E3Y4V1	Fusobacterium_phage	50.3	2.7e-41
WP_005980009.1|3381816_3382905_-	hypothetical protein	NA	A0A0E3U253	Fusobacterium_phage	44.3	1.3e-88
WP_005980012.1|3382906_3383116_-|tail	tail protein X	tail	A0A0C5AEF4	Bacteriophage	38.1	9.8e-09
WP_005980014.1|3383102_3386165_-|tail	phage tail tape measure protein	tail	A0A0E3U2N9	Fusobacterium_phage	38.3	7.5e-105
WP_005980016.1|3386229_3386622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005980018.1|3386704_3387523_-	phage antirepressor KilAC domain-containing protein	NA	A0A2H4JAT4	uncultured_Caudovirales_phage	37.6	3.0e-37
WP_005980021.1|3387536_3387836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005980023.1|3387959_3388133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005980025.1|3388385_3388715_-	hypothetical protein	NA	A0A0E3Y5E7	Fusobacterium_phage	60.4	2.6e-24
WP_005980027.1|3388723_3389260_-|tail	phage major tail tube protein	tail	A0A0E3Y6F4	Fusobacterium_phage	57.0	1.3e-49
WP_005980028.1|3389276_3390692_-|tail	phage tail protein	tail	A0A0E3U251	Fusobacterium_phage	62.2	4.4e-177
WP_005980030.1|3390691_3390964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005980032.1|3390973_3391435_-	hypothetical protein	NA	A0A0E3Y698	Fusobacterium_phage	43.1	2.0e-30
WP_005980034.1|3391431_3391998_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_005980036.1|3391997_3392348_-	hypothetical protein	NA	A0A0E3Y618	Fusobacterium_phage	45.1	3.7e-16
WP_005980038.1|3392322_3392553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005980040.1|3392604_3393630_-|capsid	major capsid protein	capsid	A0A0E3U2N5	Fusobacterium_phage	54.4	3.9e-98
WP_005980043.1|3393641_3393968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005980045.1|3393982_3395086_-|protease	Clp protease ClpP	protease	A0A0E3Y6E9	Fusobacterium_phage	41.5	1.0e-67
WP_005980047.1|3395078_3396614_-|portal	phage portal protein	portal	A0A0E3Y693	Fusobacterium_phage	64.6	2.1e-180
WP_005980049.1|3396617_3396836_-	hypothetical protein	NA	A0A0C5AEE0	Bacteriophage	45.6	3.0e-08
WP_051006467.1|3396835_3398602_-|terminase	phage terminase large subunit family protein	terminase	A0A0E3U2N4	Fusobacterium_phage	70.3	1.7e-247
WP_005980053.1|3398573_3399029_-	hypothetical protein	NA	A0A0E3Y4U4	Fusobacterium_phage	50.3	1.6e-32
WP_005980055.1|3399140_3399653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005980057.1|3399811_3400834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005980059.1|3400823_3401144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005980061.1|3401189_3401732_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0U4I901	Vibrio_phage	35.1	1.0e-20
