The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	0	32633	3505422	tRNA	Bacillus_phage(30.77%)	28	NA	NA
WP_106910419.1|231_2247_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_064978021.1|2404_2953_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_064978020.1|3058_4105_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_106910420.1|4092_5196_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_106910421.1|5230_7279_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.5e-37
WP_106910422.1|7332_7812_+	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_106910423.1|7987_8401_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_039045613.1|8712_9483_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.5	1.3e-26
WP_106910424.1|9650_10445_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010864139.1|10556_11258_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_106910425.1|11283_12018_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_039045615.1|12167_12974_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	30.1	1.9e-07
WP_010864136.1|13956_14460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010864135.1|14710_15544_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	38.2	1.0e-11
WP_106910426.1|15696_16248_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_106910427.1|16348_17263_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_106910428.1|17368_18598_+	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	1.1e-06
WP_106910429.1|18605_19988_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	36.8	3.1e-74
WP_106910430.1|20424_21333_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	49.3	7.2e-64
WP_106910431.1|21355_22369_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.9	8.2e-85
WP_106910432.1|22401_23751_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	3.7e-80
WP_106910433.1|23798_24806_+	NAD-dependent epimerase	NA	A0A222YY99	Synechococcus_phage	25.7	6.2e-16
WP_010864126.1|24961_25372_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_106910434.1|25969_27556_+	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_010864124.1|27670_28252_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.4	1.1e-52
WP_159033643.1|28393_28900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106910435.1|29115_30885_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	7.7e-46
WP_106910436.1|30878_32633_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	2.0e-41
>prophage 2
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	41954	43079	3505422		Bacillus_virus(100.0%)	1	NA	NA
WP_039045633.1|41954_43079_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.7e-30
>prophage 3
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	54116	56177	3505422		Bacillus_phage(100.0%)	1	NA	NA
WP_106910446.1|54116_56177_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	24.4	2.8e-39
>prophage 4
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	59239	67322	3505422		Acinetobacter_phage(25.0%)	6	NA	NA
WP_106910448.1|59239_60700_-	dipeptide/tripeptide permease DtpA	NA	A0A0P0IY73	Acinetobacter_phage	27.6	2.4e-45
WP_010864096.1|61132_61678_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.3	1.2e-29
WP_106910449.1|61870_64099_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	38.6	5.5e-41
WP_010864093.1|64183_64516_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_010864092.1|64527_65136_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_039045714.1|65438_67322_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.1	1.3e-112
>prophage 5
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	75742	80783	3505422	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_010864084.1|75742_76366_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.1	2.9e-64
WP_010864083.1|76449_77724_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.8	1.1e-129
WP_010864082.1|77907_80265_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	54.1	2.4e-228
WP_010864081.1|80507_80783_+	DNA-binding protein HU-beta	NA	B5TA87	Burkholderia_phage	60.0	5.1e-21
>prophage 6
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	86123	86816	3505422		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_106910455.1|86123_86816_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	66.0	9.9e-82
>prophage 7
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	98515	102107	3505422		Tetraselmis_virus(100.0%)	2	NA	NA
WP_010864065.1|98515_99256_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.8	4.5e-24
WP_010864064.1|99824_102107_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	7.6e-163
>prophage 8
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	126201	139442	3505422		Pseudomonas_phage(16.67%)	9	NA	NA
WP_010864042.1|126201_127332_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.3	7.1e-170
WP_106910469.1|127400_129686_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	66.2	5.1e-300
WP_106910470.1|130192_130855_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_047707845.1|130854_131568_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_106910471.1|131830_134458_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.3	1.5e-106
WP_010864037.1|134654_135074_-	HdeA	NA	NA	NA	NA	NA
WP_039045663.1|135364_136453_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	49.0	7.7e-89
WP_106910472.1|136563_137988_-	NADP-dependent phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	33.1	1.7e-35
WP_106910473.1|138338_139442_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	27.4	2.1e-17
>prophage 9
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	143681	143969	3505422		Geobacillus_virus(100.0%)	1	NA	NA
WP_010864030.1|143681_143969_+	integration host factor subunit beta	NA	A0A0H3UZA0	Geobacillus_virus	38.9	2.5e-10
>prophage 10
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	147012	147546	3505422		Escherichia_phage(100.0%)	1	NA	NA
WP_106910476.1|147012_147546_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	53.7	4.6e-26
>prophage 11
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	156800	158396	3505422	transposase	Shigella_phage(50.0%)	2	NA	NA
WP_106910487.1|156800_157969_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.8	1.2e-167
WP_159033649.1|158015_158396_+	hypothetical protein	NA	A0A1I9SF20	Klebsiella_phage	42.0	7.7e-20
>prophage 12
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	165286	167308	3505422		Moraxella_phage(100.0%)	1	NA	NA
WP_039046728.1|165286_167308_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.4	1.9e-85
>prophage 13
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	172015	173359	3505422		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_106910495.1|172015_173359_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.5	5.1e-42
>prophage 14
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	209817	211955	3505422	transposase	uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_106910508.1|209817_210750_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.9	4.5e-21
WP_001339197.1|210746_211955_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 15
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	216459	220467	3505422		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_159033651.1|216459_218499_+	prolyl oligopeptidase family serine peptidase	NA	F2Y2Z7	Organic_Lake_phycodnavirus	31.1	7.3e-24
WP_106910513.1|218748_220467_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.6	2.5e-17
>prophage 16
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	224233	225619	3505422		Acinetobacter_phage(100.0%)	1	NA	NA
WP_106910517.1|224233_225619_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.6	1.4e-39
>prophage 17
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	233857	240313	3505422	protease	Bodo_saltans_virus(50.0%)	5	NA	NA
WP_010863941.1|233857_234922_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	5.7e-20
WP_159033652.1|235163_235538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106912029.1|235648_235915_-	YciN family protein	NA	NA	NA	NA	NA
WP_106910525.1|236031_237405_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_106910526.1|237697_240313_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	33.7	1.3e-89
>prophage 18
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	248210	253364	3505422		Pandoravirus(50.0%)	4	NA	NA
WP_106910530.1|248210_249770_-	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	41.2	6.6e-41
WP_106910531.1|249973_251488_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_039044868.1|251649_251907_+	YoaH family protein	NA	NA	NA	NA	NA
WP_106910532.1|252029_253364_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	34.5	5.2e-63
>prophage 19
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	263569	265090	3505422		Escherichia_phage(100.0%)	1	NA	NA
WP_106910536.1|263569_265090_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	42.6	7.7e-18
>prophage 20
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	270363	271131	3505422		Mollivirus(100.0%)	1	NA	NA
WP_106910542.1|270363_271131_+	7-alpha-hydroxysteroid dehydrogenase	NA	A0A0M4JSW6	Mollivirus	28.0	2.7e-11
>prophage 21
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	279233	285217	3505422	tRNA	Catovirus(50.0%)	5	NA	NA
WP_106912031.1|279233_280196_+	D-2-hydroxyacid dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	30.8	1.5e-22
WP_106910549.1|280317_282363_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	23.9	1.1e-22
WP_106910550.1|282628_283741_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010863906.1|283825_284470_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.5	2.3e-32
WP_039044857.1|284635_285217_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.7	1.4e-33
>prophage 22
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	299534	300661	3505422		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_010863893.1|299534_300269_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.7	2.0e-16
WP_010863892.1|300427_300661_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	48.5	1.5e-10
>prophage 23
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	303987	305605	3505422		Bacteriophage(50.0%)	2	NA	NA
WP_106910556.1|303987_304623_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	38.6	5.1e-24
WP_159033654.1|304624_305605_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	31.4	1.9e-06
>prophage 24
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	310640	312638	3505422		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_159033655.1|310640_312638_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.7	9.7e-29
>prophage 25
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	328024	328729	3505422		Planktothrix_phage(100.0%)	1	NA	NA
WP_010863870.1|328024_328729_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	35.8	5.1e-33
>prophage 26
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	334596	339223	3505422	tRNA	Hokovirus(50.0%)	4	NA	NA
WP_039044833.1|334596_336192_-	ABC-F family ATPase	NA	A0A1V0SGN0	Hokovirus	26.0	2.6e-56
WP_106910573.1|336425_337571_+	elongation factor P maturation arginine rhamnosyltransferase EarP	NA	NA	NA	NA	NA
WP_010863855.1|337615_338185_+	elongation factor P	NA	NA	NA	NA	NA
WP_036769823.1|338284_339223_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	83.7	1.9e-128
>prophage 27
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	344828	347288	3505422		uncultured_virus(100.0%)	1	NA	NA
WP_106910578.1|344828_347288_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	31.1	1.0e-80
>prophage 28
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	355695	356349	3505422		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_106910581.1|355695_356349_+	type B chloramphenicol O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	41.5	5.4e-21
>prophage 29
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	360081	360810	3505422		Vibrio_phage(100.0%)	1	NA	NA
WP_106910584.1|360081_360810_+	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	24.3	2.2e-15
>prophage 30
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	364629	365211	3505422		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_010863829.1|364629_365211_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	44.8	8.1e-45
>prophage 31
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	384809	391221	3505422		Bacillus_phage(50.0%)	6	NA	NA
WP_106910594.1|384809_385472_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	26.5	3.0e-11
WP_106910595.1|385511_387656_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.7	2.7e-16
WP_010863812.1|387675_387864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039044812.1|388196_388787_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.8	4.3e-41
WP_106910596.1|389125_390037_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_178026570.1|390369_391221_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	32.8	1.7e-19
>prophage 32
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	394227	395346	3505422		Bacillus_virus(100.0%)	1	NA	NA
WP_010863805.1|394227_395346_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	35.0	8.4e-30
>prophage 33
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	399115	401377	3505422		Hokovirus(100.0%)	1	NA	NA
WP_106910600.1|399115_401377_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.3	2.1e-59
>prophage 34
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	410834	418112	3505422		Phage_TP(33.33%)	5	NA	NA
WP_106912036.1|410834_412691_+	U32 family peptidase	NA	Q6DW11	Phage_TP	29.7	5.9e-20
WP_047706932.1|412793_413228_-	lecithin retinol acyltransferase family protein	NA	NA	NA	NA	NA
WP_106910604.1|413404_414454_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	49.0	1.1e-84
WP_106910605.1|414603_415437_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_106910606.1|415730_418112_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.9	1.3e-173
>prophage 35
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	436180	517960	3505422	terminase,transposase,plate,holin,tail,tRNA,head,integrase	Vibrio_phage(58.93%)	97	431263:431278	469507:469522
431263:431278	attL	AGCTGGCGATTGATGA	NA	NA	NA	NA
WP_106910617.1|436180_437548_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.7	1.1e-108
WP_106910618.1|437575_438202_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_010863770.1|438206_439310_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_047706909.1|439500_439947_-	NUDIX hydrolase	NA	Q6WHZ2	Vibrio_phage	33.8	4.8e-05
WP_106910619.1|439936_440608_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_106910620.1|440745_441999_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	81.5	4.1e-17
WP_106910621.1|442148_443288_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	48.5	2.8e-89
WP_159033660.1|443280_443520_-	excisionase	NA	NA	NA	NA	NA
WP_159033661.1|443611_444190_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	35.7	1.1e-25
WP_106910624.1|444186_444915_-	hypothetical protein	NA	A0A0F7LCR3	Escherichia_phage	35.9	5.8e-16
WP_106910625.1|444917_445499_-	DUF2313 domain-containing protein	NA	A0A2I7S9L6	Vibrio_phage	58.3	1.1e-60
WP_106910626.1|445483_446551_-|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	62.1	4.6e-126
WP_106912038.1|446540_446993_-	phage GP46 family protein	NA	M4MB61	Vibrio_phage	57.1	3.9e-34
WP_178080930.1|447000_447534_-|plate	phage baseplate assembly protein V	plate	M4MCP6	Vibrio_phage	48.7	6.8e-38
WP_106910628.1|447536_448619_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	47.7	2.1e-86
WP_106910629.1|448611_450006_-	DNA circularization N-terminal domain-containing protein	NA	A0A2I7S9E8	Vibrio_phage	49.5	1.6e-115
WP_106910630.1|450017_451979_-|tail	phage tail tape measure protein	tail	A0A2P9JZK0	Alteromonadaceae_phage	40.8	1.3e-89
WP_106910631.1|452118_452490_-|tail	phage tail assembly protein	tail	M4MB64	Vibrio_phage	56.8	3.4e-28
WP_047709085.1|452492_452849_-|tail	phage tail tube protein	tail	A0A2I7S9D5	Vibrio_phage	59.3	3.3e-33
WP_106910632.1|452858_454337_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1Q565	Vibrio_phage	59.4	2.1e-166
WP_047709083.1|454340_454544_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_047709082.1|454551_455172_-	hypothetical protein	NA	A0A2I7S9D4	Vibrio_phage	50.7	2.5e-52
WP_106910633.1|455168_455726_-	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	65.9	2.7e-61
WP_106910634.1|455725_456160_-	DUF1320 domain-containing protein	NA	M1PVU7	Vibrio_phage	72.2	3.2e-54
WP_106910635.1|456159_456582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106910636.1|456701_457601_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A2I7S9D0	Vibrio_phage	66.4	2.6e-114
WP_106910637.1|457603_458569_-	peptidase	NA	M1Q578	Vibrio_phage	54.9	1.9e-94
WP_106910638.1|458938_459724_-	hypothetical protein	NA	M1PVV7	Vibrio_phage	65.8	6.1e-104
WP_106910639.1|459716_461279_-	DUF935 domain-containing protein	NA	M4M9P3	Vibrio_phage	70.1	1.4e-213
WP_106910640.1|461275_462889_-	hypothetical protein	NA	M4MHG0	Vibrio_phage	68.1	8.5e-209
WP_106910641.1|463034_463616_-	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	68.1	4.5e-59
WP_047709073.1|463774_464068_-	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	70.5	9.8e-31
WP_106910642.1|464079_464403_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_047709071.1|464392_464629_-	TraR/DksA C4-type zinc finger protein	NA	M4MHG5	Vibrio_phage	62.9	1.1e-16
WP_106910643.1|464625_465234_-	hypothetical protein	NA	M4MB79	Vibrio_phage	50.3	2.3e-34
WP_106910645.1|465564_466035_-	glycoside hydrolase family protein	NA	H9C148	Vibrio_phage	37.7	2.0e-25
WP_106910646.1|466159_466567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106910647.1|466566_466986_-	hypothetical protein	NA	M4MHG9	Vibrio_phage	39.4	2.6e-24
WP_106912039.1|467104_467752_-	regulatory protein GemA	NA	A0A2I7S9B8	Vibrio_phage	48.9	2.2e-38
WP_106910648.1|467738_467963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106910649.1|467928_468426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106910650.1|468425_468695_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106910651.1|468684_468960_-	hypothetical protein	NA	M1PJ71	Vibrio_phage	52.9	1.5e-20
WP_178080911.1|468949_469360_-	hypothetical protein	NA	A0A1V0E8G7	Vibrio_phage	60.2	7.1e-27
WP_106910652.1|469370_470006_-	DUF3164 family protein	NA	M4MHH7	Vibrio_phage	59.3	8.6e-64
469507:469522	attR	TCATCAATCGCCAGCT	NA	NA	NA	NA
WP_106910653.1|469989_470307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106910654.1|470317_470674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106910655.1|470740_471673_-	AAA family ATPase	NA	A0A2I7S9C3	Vibrio_phage	63.5	1.2e-106
WP_106910656.1|471735_473748_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	M4M9R2	Vibrio_phage	62.5	7.8e-236
WP_047709058.1|473759_473996_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	62.9	3.4e-18
WP_159033779.1|474237_474834_+	transcriptional regulator	NA	A0A2I7S9A5	Vibrio_phage	59.8	5.8e-54
WP_159033662.1|475076_475322_-	hypothetical protein	NA	A0A1I9KG69	Aeromonas_phage	56.7	9.1e-14
WP_106912040.1|475639_476530_-	Kdo hydroxylase family protein	NA	NA	NA	NA	NA
WP_106910660.1|478052_479213_-	hypothetical protein	NA	M4MHC3	Vibrio_phage	37.1	1.1e-24
WP_106912041.1|479227_480325_-	recombinase RecT	NA	A0A0F6TJP0	Escherichia_coli_O157_typing_phage	60.7	8.1e-62
WP_084978075.1|482056_482269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106910663.1|482272_482500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106910664.1|483000_483732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106912042.1|483770_484442_-	helix-turn-helix transcriptional regulator	NA	A0A2D1GM27	Escherichia_phage	63.0	5.1e-83
WP_106910665.1|484578_484806_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.0	1.9e-21
WP_010863613.1|484882_485221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910666.1|485223_485433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910667.1|485433_485715_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159033663.1|485716_486832_+	hypothetical protein	NA	K4NZ18	Pseudomonas_phage	53.2	3.3e-26
WP_159033664.1|486734_487298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910670.1|488000_490730_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_106910671.1|491399_491666_+	DUF5334 family protein	NA	NA	NA	NA	NA
WP_106910672.1|492029_492842_-	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_106910673.1|492871_493132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106910674.1|493230_493590_-	VOC family protein	NA	NA	NA	NA	NA
WP_106910675.1|493633_493987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106910676.1|494226_494877_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_106910677.1|494972_495152_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_106912043.1|495216_496392_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_159033665.1|500561_501101_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_159033666.1|501129_501690_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_106910680.1|501721_502252_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_106910681.1|502278_502791_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_084978094.1|503196_503673_+	DUF1367 family protein	NA	H6WRY7	Salmonella_phage	36.2	2.8e-27
WP_106910682.1|503669_503963_+	hypothetical protein	NA	A0A0M3ULJ7	Salmonella_phage	65.6	1.4e-29
WP_106910683.1|503968_504388_+	hypothetical protein	NA	A0A1I9KG18	Aeromonas_phage	58.1	7.2e-35
WP_106910684.1|504439_505231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010863594.1|505803_506160_+|holin	phage holin, lambda family	holin	A0A1B0YZZ1	Pseudomonas_phage	34.4	2.7e-06
WP_106910686.1|506146_506635_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	51.2	5.2e-37
WP_106910687.1|506631_507048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084978100.1|507077_507386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910688.1|507385_508312_+|terminase	terminase	terminase	A0A1I9KFG9	Aeromonas_phage	42.3	5.3e-46
WP_159033667.1|508302_508446_+	hypothetical protein	NA	A0A1I9KFB6	Aeromonas_phage	67.5	2.3e-09
WP_106910689.1|508449_509618_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.8	1.2e-167
WP_106910690.1|509701_510403_+	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	47.6	7.5e-53
WP_106910691.1|510732_512388_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.5	4.1e-33
WP_159033668.1|512457_513225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910693.1|513241_513502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084977412.1|514170_514335_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	81.5	4.1e-18
WP_178080912.1|514420_515458_-	alkene reductase	NA	NA	NA	NA	NA
WP_106910695.1|515806_516763_-	HTH-type transcriptional regulator YidZ	NA	NA	NA	NA	NA
WP_106910696.1|516781_517960_-	MdtL family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.7	3.4e-13
>prophage 36
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	522168	522372	3505422		Salmonella_phage(100.0%)	1	NA	NA
WP_106910702.1|522168_522372_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	70.1	1.3e-21
>prophage 37
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	530002	534316	3505422		Bacillus_phage(50.0%)	2	NA	NA
WP_106910708.1|530002_530968_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	29.0	3.8e-15
WP_106910709.1|531628_534316_+	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	28.4	2.5e-72
>prophage 38
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	545910	553228	3505422	transposase	Cedratvirus(33.33%)	5	NA	NA
WP_106910718.1|545910_546558_+	CatB-related O-acetyltransferase	NA	A0A1M7XU28	Cedratvirus	33.1	2.6e-15
WP_010863714.1|546813_548262_+	chitinase	NA	NA	NA	NA	NA
WP_001339197.1|548504_549713_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_159033671.1|549946_551485_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_064977782.1|551587_553228_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.0	2.2e-42
>prophage 39
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	562304	563327	3505422		Escherichia_phage(100.0%)	1	NA	NA
WP_010863702.1|562304_563327_+	hydrogenase 2 operon protein HybA	NA	A0A077SL61	Escherichia_phage	29.8	1.2e-22
>prophage 40
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	573930	575844	3505422		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_159033673.1|573930_575844_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.7	3.4e-39
>prophage 41
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	579260	582070	3505422		Vibrio_phage(50.0%)	2	NA	NA
WP_106910732.1|579260_581381_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	62.6	4.8e-260
WP_010863685.1|581602_582070_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	A0A2H5BH04	Vibrio_virus	61.0	1.7e-53
>prophage 42
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	587333	588281	3505422		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_064977764.1|587333_588281_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	24.7	9.6e-11
>prophage 43
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	592353	593673	3505422		Klosneuvirus(100.0%)	1	NA	NA
WP_178080913.1|592353_593673_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.0	1.1e-17
>prophage 44
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	600400	601588	3505422		Salmonella_phage(100.0%)	1	NA	NA
WP_010863666.1|600400_601588_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.8	2.7e-18
>prophage 45
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	609490	613329	3505422		Enterobacteria_phage(66.67%)	4	NA	NA
WP_106910747.1|609490_611122_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.9	4.8e-18
WP_106910748.1|611127_611823_-	thermostable hemolysin	NA	NA	NA	NA	NA
WP_010863655.1|611902_612136_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	42.7	2.4e-08
WP_010863654.1|612312_613329_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	29.5	6.4e-29
>prophage 46
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	625742	633125	3505422		Vibrio_phage(33.33%)	7	NA	NA
WP_106912052.1|625742_627347_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	27.1	5.4e-30
WP_106910759.1|627816_629319_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_064977743.1|629458_630637_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	43.5	6.4e-81
WP_106910760.1|630907_631210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910761.1|631288_632116_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_010863636.1|632232_632445_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_010863635.1|632630_633125_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	48.3	1.4e-32
>prophage 47
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	643726	644374	3505422		Indivirus(100.0%)	1	NA	NA
WP_106910769.1|643726_644374_+	riboflavin synthase subunit alpha	NA	A0A1V0SE20	Indivirus	39.2	7.0e-21
>prophage 48
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	648294	662580	3505422	tRNA	Tupanvirus(25.0%)	14	NA	NA
WP_064977733.1|648294_650223_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	3.6e-129
WP_071596471.1|650227_650770_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	6.3e-15
WP_010863568.1|650857_651055_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_010863567.1|651093_651450_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_010863566.1|651994_652981_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_106910772.1|652999_655387_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_010863564.1|655391_655688_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	42.2	6.4e-14
WP_106910773.1|655946_657035_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_106910774.1|657034_658030_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_106910775.1|658013_658823_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.5	7.7e-09
WP_010863560.1|659075_659531_+	C40 family peptidase	NA	S5MM68	Bacillus_phage	34.0	2.3e-10
WP_010863559.1|659826_660069_+	DUF2960 domain-containing protein	NA	NA	NA	NA	NA
WP_010863558.1|660670_660880_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	67.7	6.1e-19
WP_106910776.1|661752_662580_-	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	26.6	8.1e-06
>prophage 49
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	668757	670155	3505422		Aichi_virus(100.0%)	1	NA	NA
WP_106912055.1|668757_670155_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.4	8.9e-29
>prophage 50
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	679582	683497	3505422		Catovirus(100.0%)	1	NA	NA
WP_106910785.1|679582_683497_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.1	1.7e-53
>prophage 51
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	687065	687941	3505422		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_106910789.1|687065_687941_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	8.0e-12
>prophage 52
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	701546	703370	3505422		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_106910796.1|701546_703370_-	glycerophosphodiester phosphodiesterase	NA	M1I378	Acanthocystis_turfacea_Chlorella_virus	30.9	2.7e-17
>prophage 53
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	708361	709027	3505422		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_106910801.1|708361_709027_+	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	26.2	2.0e-07
>prophage 54
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	714633	715626	3505422		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_010863514.1|714633_715626_+	2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	41.9	1.6e-64
>prophage 55
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	723482	724382	3505422		Enterobacteria_phage(100.0%)	1	NA	NA
WP_106910810.1|723482_724382_-	class A beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	50.2	2.5e-56
>prophage 56
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	732303	806611	3505422	integrase,transposase	Cronobacter_phage(18.75%)	70	730762:730776	810648:810662
730762:730776	attL	CAAACCCAGCAGCAT	NA	NA	NA	NA
WP_047708613.1|732303_732993_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.6	4.8e-36
WP_106910816.1|732991_733600_+	arylesterase	NA	NA	NA	NA	NA
WP_106910817.1|733673_734162_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_106910818.1|734398_735331_+	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_106910819.1|735752_736709_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	31.4	1.6e-21
WP_106910820.1|736894_737665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910821.1|738001_738289_-	hypothetical protein	NA	A0A1B0UY37	Roseobacter_phage	36.8	1.2e-12
WP_106912059.1|738382_739087_+	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	30.7	1.0e-17
WP_106910822.1|739192_739690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910487.1|739942_741111_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.8	1.2e-167
WP_178080917.1|741873_742320_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	50.7	1.7e-29
WP_106910824.1|742611_743412_+	dioxygenase	NA	NA	NA	NA	NA
WP_159033780.1|743805_744510_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_106910826.1|744954_745539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910828.1|746678_747053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910829.1|747440_748517_+	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_159033682.1|748845_749139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106910831.1|749217_749676_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_010863407.1|749967_750204_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_106910832.1|750779_751328_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_159033683.1|752455_752884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910834.1|753425_753842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910835.1|754252_754675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910836.1|754946_755759_-	metal-binding protein	NA	A0A0F7L9X0	Escherichia_phage	43.1	3.4e-65
WP_106910837.1|756080_756641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910838.1|757071_757560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084976542.1|757793_758204_-	glyoxalase	NA	NA	NA	NA	NA
WP_106910839.1|758615_759572_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	31.9	6.5e-23
WP_106910840.1|760325_760880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159033684.1|761308_761668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910842.1|762882_763284_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_106910843.1|763504_764107_-	putative adenosine monophosphate-protein transferase Fic	NA	NA	NA	NA	NA
WP_159033685.1|764099_764561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106910845.1|764966_765197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910846.1|765210_765588_+	GFA family protein	NA	NA	NA	NA	NA
WP_106910847.1|765939_766761_+	DUF2002 family protein	NA	NA	NA	NA	NA
WP_010865012.1|767242_767539_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_159033686.1|767966_768392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910849.1|768592_769597_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_106910487.1|769930_771098_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.8	1.2e-167
WP_106910850.1|771119_772316_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_106910851.1|774121_774670_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_106910852.1|775010_775874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910853.1|776017_776950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159033781.1|777310_777739_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	52.9	2.9e-31
WP_178080918.1|778073_778520_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	52.2	6.7e-31
WP_106910856.1|778864_779113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159033687.1|779596_780349_+	RES domain-containing protein	NA	NA	NA	NA	NA
WP_106910858.1|780613_781249_+	NADPH-dependent F420 reductase	NA	NA	NA	NA	NA
WP_106910859.1|781649_782237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910860.1|782705_783467_+	hypothetical protein	NA	I3NLD0	Bifidobacterium_phage	34.3	1.2e-06
WP_159033688.1|783989_784718_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_159033689.1|785169_785685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910851.1|786026_786575_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_106910862.1|786952_787717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910863.1|788172_788406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106912060.1|789471_790734_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_159033690.1|790726_791590_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_106910865.1|792590_793328_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_106910866.1|793620_794154_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010863417.1|794150_794420_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_156669244.1|794651_795452_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_106910867.1|795704_796463_+|integrase	integron integrase	integrase	NA	NA	NA	NA
WP_001339197.1|796441_797650_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_106910868.1|797774_798014_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_106910869.1|798019_800881_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	30.1	3.6e-37
WP_106910870.1|800961_801987_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_106910871.1|802024_802720_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	29.2	2.0e-18
WP_039045284.1|802856_804020_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_106910872.1|804031_806611_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.9	1.0e-67
810648:810662	attR	CAAACCCAGCAGCAT	NA	NA	NA	NA
>prophage 57
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	814452	815070	3505422		Pithovirus(100.0%)	1	NA	NA
WP_039045288.1|814452_815070_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	W5SAS9	Pithovirus	27.3	5.7e-12
>prophage 58
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	822936	829384	3505422	integrase	Ralstonia_phage(40.0%)	5	822744:822761	838256:838273
822744:822761	attL	AATTTGGCGGTGAGGGAG	NA	NA	NA	NA
WP_106910881.1|822936_824145_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	38.7	3.4e-61
WP_106910882.1|826151_827237_+	thymidylate synthase	NA	A0A1W6DY47	Aeromonas_phage	37.7	4.4e-60
WP_023321450.1|827233_827791_+	hypothetical protein	NA	A0A0X8WPM2	Ralstonia_phage	30.0	1.0e-12
WP_023321451.1|827783_828806_+	hypothetical protein	NA	S6C8U0	Klebsiella_phage	28.8	6.5e-37
WP_023321452.1|828892_829384_+	TIR domain-containing protein	NA	A0A2H4J496	uncultured_Caudovirales_phage	45.7	1.1e-05
838256:838273	attR	AATTTGGCGGTGAGGGAG	NA	NA	NA	NA
>prophage 59
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	835313	840405	3505422	transposase	Shigella_phage(50.0%)	5	NA	NA
WP_106910487.1|835313_836482_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.8	1.2e-167
WP_178080919.1|837183_837528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910886.1|837557_837737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910887.1|837733_838096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_178080920.1|838671_840405_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	28.2	1.1e-33
>prophage 60
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	859433	860267	3505422		Pelagibacter_phage(100.0%)	1	NA	NA
WP_039045301.1|859433_860267_+	curli production assembly/transporter CsgG	NA	M1ICK2	Pelagibacter_phage	40.0	7.1e-42
>prophage 61
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	868053	872472	3505422		Vibriophage(50.0%)	4	NA	NA
WP_010861747.1|868053_868710_-	GTP cyclohydrolase I FolE	NA	I6XC45	Vibriophage	55.8	1.2e-57
WP_106910900.1|869143_870397_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_106910901.1|870402_871203_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_106910902.1|871404_872472_-	molybdenum ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	9.2e-18
>prophage 62
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	881640	882570	3505422		Streptococcus_phage(100.0%)	1	NA	NA
WP_106910908.1|881640_882570_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	28.9	2.1e-26
>prophage 63
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	894719	916955	3505422	protease,tRNA	uncultured_Mediterranean_phage(20.0%)	17	NA	NA
WP_106910915.1|894719_895160_-	UV protection and mutation protein	NA	A0A218MND2	uncultured_virus	35.0	9.6e-14
WP_106910916.1|895405_896230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039045318.1|896551_897841_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.1	4.9e-98
WP_047707950.1|897944_899285_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.2	5.8e-78
WP_106910917.1|899453_900065_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_106910918.1|900451_904630_-	DNA translocase FtsK 4TM domain-containing protein	NA	S5VNE3	Mycobacterium_phage	49.9	9.3e-90
WP_010861779.1|904825_905320_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_106910919.1|905473_906601_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_106910920.1|906761_907718_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.6e-59
WP_106910921.1|908053_909871_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	26.4	1.5e-28
WP_106910922.1|909873_911619_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.8	3.9e-18
WP_064977597.1|911845_912607_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_039045326.1|912647_913367_+	arginyltransferase	NA	NA	NA	NA	NA
WP_010861786.1|913467_913686_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_106910923.1|913790_916094_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	6.1e-168
WP_010861788.1|916168_916486_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	39.5	3.2e-11
WP_010861789.1|916727_916955_+	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.5	2.4e-16
>prophage 64
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	930843	951533	3505422	tRNA	Enterobacteria_phage(25.0%)	15	NA	NA
WP_106910935.1|930843_931647_+	heme ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.2	1.1e-10
WP_106910936.1|931823_933041_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_081632822.1|933148_934765_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.2	4.0e-09
WP_106910937.1|935113_935815_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A088FAQ4	Vibrio_phage	30.4	1.3e-17
WP_010861808.1|935903_936266_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_106912068.1|936377_937535_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_106912069.1|937542_938676_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.8	1.4e-19
WP_106910938.1|938675_939656_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_106912070.1|939857_942308_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	43.0	5.7e-124
WP_106910939.1|942428_942977_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_106910940.1|943119_944826_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_106912071.1|945210_946611_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.1	8.2e-83
WP_106910941.1|947204_948389_+	porin	NA	Q1MVN1	Enterobacteria_phage	39.0	5.7e-61
WP_106910942.1|948787_950038_+	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
WP_010861818.1|950417_951533_+	porin	NA	Q1MVN1	Enterobacteria_phage	30.7	9.2e-45
>prophage 65
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	969484	970366	3505422		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_106910950.1|969484_970366_-	histidine decarboxylase, pyruvoyl type	NA	A0A1B1ISG5	uncultured_Mediterranean_phage	31.6	9.2e-32
>prophage 66
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	974862	982078	3505422		Bacillus_phage(33.33%)	5	NA	NA
WP_010861837.1|974862_976611_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	28.8	1.3e-53
WP_159033696.1|976645_979000_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	25.1	7.2e-15
WP_106910954.1|979012_979534_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_010861840.1|979736_979910_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_084976633.1|980152_982078_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	27.8	3.6e-49
>prophage 67
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	995425	996484	3505422		Pandoravirus(100.0%)	1	NA	NA
WP_106910962.1|995425_996484_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	S4W5F1	Pandoravirus	48.3	1.7e-80
>prophage 68
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1020282	1021779	3505422		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_106910976.1|1020282_1021779_+	sugar ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	29.8	6.6e-06
>prophage 69
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1047735	1048785	3505422		Enterobacteria_phage(100.0%)	1	NA	NA
WP_106910990.1|1047735_1048785_-	porin	NA	Q1MVN1	Enterobacteria_phage	37.7	1.5e-57
>prophage 70
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1056984	1057470	3505422		Fowlpox_virus(100.0%)	1	NA	NA
WP_010861880.1|1056984_1057470_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	43.2	6.4e-27
>prophage 71
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1067781	1068591	3505422		Bacillus_virus(100.0%)	1	NA	NA
WP_039046209.1|1067781_1068591_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	1.0e-13
>prophage 72
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1072195	1074214	3505422		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_106910998.1|1072195_1074214_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	22.0	7.3e-08
>prophage 73
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1084538	1085108	3505422		Clostridium_phage(100.0%)	1	NA	NA
WP_036768515.1|1084538_1085108_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A0A8WIF2	Clostridium_phage	30.6	3.5e-08
>prophage 74
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1089178	1090774	3505422		Planktothrix_phage(100.0%)	1	NA	NA
WP_106912074.1|1089178_1090774_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.7	4.5e-21
>prophage 75
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1096975	1097938	3505422		Escherichia_phage(100.0%)	1	NA	NA
WP_039046194.1|1096975_1097938_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	35.5	2.4e-41
>prophage 76
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1110451	1115795	3505422	tRNA	uncultured_virus(33.33%)	6	NA	NA
WP_010861929.1|1110451_1111465_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	31.6	4.8e-08
WP_010861930.1|1111537_1112161_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_106911014.1|1112258_1112780_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	31.5	2.2e-09
WP_010861932.1|1112783_1113527_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_106911015.1|1113582_1114023_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_010861934.1|1114025_1115795_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	26.6	1.8e-10
>prophage 77
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1120199	1120940	3505422		Freshwater_phage(100.0%)	1	NA	NA
WP_039046187.1|1120199_1120940_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1B0XTP2	Freshwater_phage	31.7	7.0e-17
>prophage 78
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1127675	1129409	3505422	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_010861947.1|1127675_1129409_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	33.3	4.2e-89
>prophage 79
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1134004	1137584	3505422		Feldmannia_irregularis_virus(50.0%)	3	NA	NA
WP_010861952.1|1134004_1134664_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	24.2	9.4e-05
WP_052021454.1|1134793_1135141_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_039046179.1|1135859_1137584_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.6e-16
>prophage 80
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1144487	1145696	3505422	transposase	Bluetongue_virus(100.0%)	1	NA	NA
WP_001339197.1|1144487_1145696_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 81
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1152851	1153508	3505422		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_064977517.1|1152851_1153508_+	Bax inhibitor-1 family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	51.0	1.1e-42
>prophage 82
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1164140	1165064	3505422		Bacillus_phage(100.0%)	1	NA	NA
WP_159033702.1|1164140_1165064_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.5	1.4e-19
>prophage 83
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1169484	1174112	3505422		Acanthamoeba_polyphaga_moumouvirus(33.33%)	4	NA	NA
WP_106911037.1|1169484_1170336_+	deoxyribonuclease IV	NA	L7RDB2	Acanthamoeba_polyphaga_moumouvirus	34.2	2.6e-31
WP_039046160.1|1170480_1171308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106911038.1|1171499_1171943_+	NUDIX domain-containing protein	NA	A0A192YCC8	Morganella_phage	37.6	4.3e-06
WP_106911039.1|1172486_1174112_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.3	7.4e-27
>prophage 84
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1181805	1183844	3505422		Planktothrix_phage(100.0%)	2	NA	NA
WP_106912077.1|1181805_1182843_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	34.2	2.3e-21
WP_010861995.1|1182878_1183844_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.5e-14
>prophage 85
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1197907	1209655	3505422		Vibrio_phage(50.0%)	10	NA	NA
WP_106911044.1|1197907_1198843_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.3	1.1e-11
WP_106911045.1|1198946_1199969_+	TDT family transporter	NA	NA	NA	NA	NA
WP_106911046.1|1200137_1200578_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_106911047.1|1200691_1203808_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.4	1.6e-107
WP_064977490.1|1203844_1204291_+	DUF411 domain-containing protein	NA	NA	NA	NA	NA
WP_159033703.1|1204599_1205436_+	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_106911049.1|1205684_1205927_+	YecH family protein	NA	NA	NA	NA	NA
WP_106911050.1|1206273_1208040_+	DEAD/DEAH box helicase family protein	NA	M4Q3N1	Vibrio_phage	42.7	1.3e-96
WP_010862014.1|1208282_1208573_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_106911051.1|1208644_1209655_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	45.5	4.5e-83
>prophage 86
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1218084	1287207	3505422	integrase,transposase,tRNA	uncultured_Caudovirales_phage(21.43%)	53	1213212:1213227	1296277:1296292
1213212:1213227	attL	ATTTTGTGAGAATAAT	NA	NA	NA	NA
WP_106911057.1|1218084_1219101_+	LysR family transcriptional regulator	NA	A9CR10	Bovine_papillomavirus	100.0	1.6e-11
WP_001339197.1|1219040_1220249_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_106911058.1|1220509_1221907_-	DUF4832 domain-containing protein	NA	NA	NA	NA	NA
WP_106911059.1|1221916_1222369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106911060.1|1222480_1223665_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_106911061.1|1223707_1224919_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_106911062.1|1225011_1226013_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_106911063.1|1226009_1227392_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_106911064.1|1227388_1228600_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_106911065.1|1228670_1230848_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_159033706.1|1230875_1231487_-	polysaccharide biosynthesis/export family protein	NA	NA	NA	NA	NA
WP_106911067.1|1231509_1232865_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_039046137.1|1232848_1234249_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_010862039.1|1234718_1235939_-	DUF945 family protein	NA	NA	NA	NA	NA
WP_106911068.1|1236246_1237734_+	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_106911069.1|1237831_1238758_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.8	9.4e-19
WP_010862043.1|1239200_1239680_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_010862044.1|1239684_1240065_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_010862045.1|1241078_1241633_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_010862046.1|1241864_1243529_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_106911070.1|1243790_1245119_-	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_106911071.1|1245364_1247248_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.5	1.7e-22
WP_106911072.1|1247533_1249420_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.0	2.0e-23
WP_010862050.1|1249592_1250447_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.9	6.4e-46
WP_159033707.1|1250474_1251299_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_010862052.1|1251416_1251794_-	SirB2 family protein	NA	NA	NA	NA	NA
WP_106911074.1|1251886_1252747_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_010862054.1|1252752_1253835_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	39.0	9.6e-07
WP_010862055.1|1253867_1255121_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_039046128.1|1255292_1255898_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_106911075.1|1255881_1256769_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_010862058.1|1256917_1257865_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L8D8	Tupanvirus	37.1	5.1e-44
WP_010862059.1|1258025_1258616_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_010862060.1|1258749_1259841_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_106911076.1|1260493_1260745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106911077.1|1260898_1261609_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_106911078.1|1262218_1262563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106911079.1|1262559_1262742_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106911080.1|1263160_1264417_-|integrase	site-specific integrase	integrase	A0A2H4IYX8	uncultured_Caudovirales_phage	24.6	1.8e-17
WP_106911081.1|1264899_1265847_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_106911082.1|1266137_1267346_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	39.2	2.0e-61
WP_106911083.1|1267792_1270546_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_106911084.1|1270538_1271108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106911085.1|1271097_1273509_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_159033708.1|1275017_1275479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106911086.1|1276698_1277490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106911087.1|1277541_1277826_-	hypothetical protein	NA	A0A1I9KG18	Aeromonas_phage	63.2	5.2e-29
WP_106911088.1|1278867_1279977_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	32.9	1.4e-13
WP_106911089.1|1280054_1281521_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_106911090.1|1281841_1282498_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_106911091.1|1282640_1284491_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_001339197.1|1284589_1285798_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_106912079.1|1286515_1287207_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	86.4	1.2e-111
1296277:1296292	attR	ATTTTGTGAGAATAAT	NA	NA	NA	NA
>prophage 87
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1294638	1301400	3505422		Vibrio_phage(25.0%)	9	NA	NA
WP_047707998.1|1294638_1294857_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	42.1	2.1e-06
WP_159033709.1|1295041_1296358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106911096.1|1296448_1297411_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	42.1	1.0e-55
WP_106911097.1|1297441_1297990_+	lecithin retinol acyltransferase family protein	NA	NA	NA	NA	NA
WP_106911098.1|1297978_1298320_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J5G9	uncultured_Caudovirales_phage	36.6	4.8e-05
WP_106911099.1|1298468_1299650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106911100.1|1299731_1300286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159033710.1|1300495_1300867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106911101.1|1300938_1301400_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.6	9.1e-15
>prophage 88
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1307086	1309288	3505422		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_106912081.1|1307086_1309288_+	bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.3	1.6e-32
>prophage 89
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1312398	1313157	3505422		Planktothrix_phage(100.0%)	1	NA	NA
WP_106911109.1|1312398_1313157_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.5	5.5e-17
>prophage 90
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1317916	1320631	3505422		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_106911112.1|1317916_1320631_+	magnesium-translocating P-type ATPase	NA	M1HN09	Paramecium_bursaria_Chlorella_virus	24.7	2.6e-37
>prophage 91
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1334854	1335445	3505422		Escherichia_phage(100.0%)	1	NA	NA
WP_159033712.1|1334854_1335445_-	molecular chaperone TorD family protein	NA	A0A077SLS7	Escherichia_phage	37.6	6.0e-27
>prophage 92
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1347758	1348079	3505422		Rhodobacter_phage(100.0%)	1	NA	NA
WP_010862098.1|1347758_1348079_-	heavy metal-binding domain-containing protein	NA	M4STD1	Rhodobacter_phage	38.2	3.8e-12
>prophage 93
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1351363	1358451	3505422	tRNA	Enterococcus_phage(20.0%)	7	NA	NA
WP_010862101.1|1351363_1352221_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.3	2.9e-30
WP_106911130.1|1352338_1353223_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	36.1	3.3e-05
WP_106911131.1|1353316_1354702_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	1.9e-47
WP_010862104.1|1354999_1355494_+	peptidylprolyl isomerase B	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	34.2	1.4e-13
WP_106911132.1|1355603_1356341_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_106911133.1|1356547_1357696_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_047708101.1|1357956_1358451_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.8	1.4e-16
>prophage 94
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1361900	1366379	3505422		Moraxella_phage(50.0%)	4	NA	NA
WP_036768559.1|1361900_1363268_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.2	5.8e-158
WP_106911136.1|1363624_1364203_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_010862115.1|1364184_1364664_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_010862116.1|1364867_1366379_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.4	4.1e-88
>prophage 95
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1377105	1382995	3505422		Paramecium_bursaria_Chlorella_virus(33.33%)	7	NA	NA
WP_039046033.1|1377105_1378233_-	4-phosphoerythronate dehydrogenase PdxB	NA	M1H502	Paramecium_bursaria_Chlorella_virus	26.7	2.5e-18
WP_039046053.1|1378591_1378981_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_010862127.1|1378991_1379684_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_084977139.1|1379941_1380580_+	YjfK family protein	NA	NA	NA	NA	NA
WP_010862129.1|1380708_1381119_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_064977429.1|1381130_1381832_+	DUF1190 domain-containing protein	NA	A0A191ZBZ0	Erwinia_phage	37.8	7.1e-27
WP_106911142.1|1381831_1382995_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	44.3	5.9e-87
>prophage 96
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1386575	1388051	3505422		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_106911145.1|1386575_1388051_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.8	4.2e-53
>prophage 97
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1401919	1408325	3505422		Pandoravirus(50.0%)	5	NA	NA
WP_106911154.1|1401919_1403020_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.4	9.6e-87
WP_039046023.1|1403184_1404117_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_039046022.1|1404193_1404718_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_106911155.1|1404802_1405279_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_106911156.1|1405547_1408325_+	insulinase family protein	NA	A0A1V0SJA4	Klosneuvirus	26.6	1.2e-90
>prophage 98
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1429969	1437530	3505422		Macacine_betaherpesvirus(33.33%)	4	NA	NA
WP_106911169.1|1429969_1431835_-	cyclic nucleotide-binding/CBS domain-containing protein	NA	A0A2I6B2Q9	Macacine_betaherpesvirus	26.1	2.2e-06
WP_010862168.1|1432038_1433748_-	solute:sodium symporter family transporter	NA	A0A219Y9P9	Aeromonas_phage	26.4	1.3e-34
WP_106911170.1|1433879_1434866_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_106911171.1|1435595_1437530_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.0	5.3e-16
>prophage 99
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1441763	1442897	3505422		Bacillus_phage(100.0%)	1	NA	NA
WP_106911173.1|1441763_1442897_-	chemotaxis response regulator protein-glutamate methylesterase	NA	W8CYM9	Bacillus_phage	32.7	5.5e-05
>prophage 100
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1445996	1446380	3505422		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_010862179.1|1445996_1446380_-	chemotaxis response regulator CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	4.4e-07
>prophage 101
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1473576	1476440	3505422		Moumouvirus(33.33%)	3	NA	NA
WP_064977397.1|1473576_1474575_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A2P1ELS8	Moumouvirus	36.8	6.5e-42
WP_106911183.1|1474578_1475751_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2K9L0G1	Tupanvirus	33.5	2.5e-32
WP_106911184.1|1475747_1476440_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	31.6	2.3e-06
>prophage 102
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1485557	1486526	3505422		Sulfitobacter_phage(100.0%)	1	NA	NA
WP_039045253.1|1485557_1486526_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A088F6W1	Sulfitobacter_phage	37.3	1.7e-23
>prophage 103
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1493959	1494901	3505422		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_010862229.1|1493959_1494901_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	33.4	1.0e-36
>prophage 104
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1501892	1581906	3505422	transposase,plate	Ralstonia_phage(28.57%)	61	NA	NA
WP_106911201.1|1501892_1503296_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	32.5	5.5e-55
WP_106910487.1|1503353_1504522_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.8	1.2e-167
WP_106911202.1|1504903_1505425_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_159033720.1|1505705_1505849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010862250.1|1506001_1506499_-	lactoylglutathione lyase family protein	NA	NA	NA	NA	NA
WP_106911204.1|1506597_1507491_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106911205.1|1508076_1509042_+	acyltransferase	NA	NA	NA	NA	NA
WP_106912088.1|1509210_1512363_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_106912089.1|1512362_1513412_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_106912090.1|1513622_1515146_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_106912091.1|1515634_1517728_-	MBL fold metallo-hydrolase	NA	M1HPV7	Paramecium_bursaria_Chlorella_virus	57.1	6.0e-207
WP_106911206.1|1517899_1518745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106911207.1|1518791_1519004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010862259.1|1519031_1520672_-	MFS transporter	NA	NA	NA	NA	NA
WP_106911208.1|1520752_1521772_-	glutaminase A	NA	NA	NA	NA	NA
WP_106911209.1|1522087_1525588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106911210.1|1525771_1528825_-	peptidase M66	NA	NA	NA	NA	NA
WP_106911211.1|1529045_1531247_-	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_159033721.1|1531343_1531484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106911212.1|1531908_1533336_-	N-acetylglucosamine-binding protein GbpA	NA	NA	NA	NA	NA
WP_106911214.1|1534046_1534628_-	type II secretion system protein M	NA	NA	NA	NA	NA
WP_159033722.1|1534627_1535935_-	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_106911216.1|1535931_1537083_-	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_106911217.1|1537079_1537712_-	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_106912092.1|1537756_1538227_-	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_106911218.1|1538239_1538800_-	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_064977361.1|1538800_1539259_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_106911219.1|1539307_1540582_-	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_106911220.1|1540587_1542195_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_106912093.1|1542187_1544185_-	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_106911221.1|1544356_1545277_-	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_159033723.1|1545315_1545741_-	type II secretion system pilot lipoprotein GspS-beta	NA	NA	NA	NA	NA
WP_106911223.1|1546597_1547515_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106911224.1|1547957_1548611_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_106911225.1|1548703_1548973_-	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_106911226.1|1549169_1550114_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_106911227.1|1550245_1550962_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_106911228.1|1551296_1551482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106911229.1|1551512_1552979_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_159033724.1|1553203_1553860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339197.1|1554470_1555679_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_159033725.1|1555716_1556262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159033726.1|1556615_1556888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159033727.1|1556937_1557477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106911233.1|1557982_1558546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106911234.1|1558538_1561241_-	hypothetical protein	NA	A0A0X8WP64	Ralstonia_phage	31.6	2.5e-11
WP_106911235.1|1561275_1563306_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.0	4.9e-28
WP_106911236.1|1563333_1563621_-	type VI secretion system PAAR protein	NA	NA	NA	NA	NA
WP_106911237.1|1563661_1565074_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_106911238.1|1565120_1568618_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_106911239.1|1568643_1570065_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_106911240.1|1570073_1570682_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_106911241.1|1570678_1572220_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_106911242.1|1572222_1574829_-	type VI secretion system ATPase TssH	NA	A0A1S6UBG5	Serratia_phage	33.4	1.5e-93
WP_010862301.1|1574846_1575623_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_106911243.1|1575631_1576972_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_106911244.1|1576974_1577490_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_106911245.1|1577489_1578731_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_036768593.1|1578733_1579732_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_106911246.1|1579695_1581468_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_039045467.1|1581474_1581906_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 105
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1616078	1618091	3505422		Serratia_phage(100.0%)	1	NA	NA
WP_106911259.1|1616078_1618091_-	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	47.3	3.0e-131
>prophage 106
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1621807	1625150	3505422		Streptococcus_phage(50.0%)	3	NA	NA
WP_010862333.1|1621807_1622776_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.1	5.0e-71
WP_010862334.1|1623107_1623365_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_010862335.1|1623422_1625150_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.4	3.7e-16
>prophage 107
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1633130	1635335	3505422	tRNA	Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_106912096.1|1633130_1635335_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	Q56AQ2	Bacillus_thuringiensis_phage	26.5	3.3e-06
>prophage 108
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1644722	1645436	3505422		Synechococcus_phage(100.0%)	1	NA	NA
WP_010862350.1|1644722_1645436_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	37.4	4.8e-39
>prophage 109
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1651845	1652193	3505422		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_106911271.1|1651845_1652193_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	50.0	3.1e-23
>prophage 110
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1656846	1661300	3505422		Prochlorococcus_phage(33.33%)	5	NA	NA
WP_106911275.1|1656846_1657887_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.6	2.6e-73
WP_010862366.1|1657886_1658537_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.0	8.6e-27
WP_052241784.1|1658759_1659587_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_010862368.1|1659758_1660466_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_010862369.1|1660481_1661300_-	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.3	1.1e-15
>prophage 111
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1669220	1676672	3505422		Bacillus_phage(40.0%)	7	NA	NA
WP_106911279.1|1669220_1670114_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	29.8	3.4e-10
WP_159033729.1|1670397_1670748_+	DsrE family protein	NA	NA	NA	NA	NA
WP_106911281.1|1671053_1672244_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.5	5.4e-43
WP_106912097.1|1672320_1673346_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	2.3e-18
WP_010862378.1|1673451_1674423_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_010862379.1|1674596_1675907_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	29.4	1.9e-25
WP_010862380.1|1675982_1676672_-	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	39.4	4.4e-37
>prophage 112
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1680593	1691006	3505422	tRNA	Bacillus_phage(20.0%)	5	NA	NA
WP_106911283.1|1680593_1681877_-	exonuclease SbcCD subunit D C-terminal domain-containing protein	NA	G9J1Y4	Bacillus_phage	23.1	1.5e-06
WP_106911284.1|1682131_1683049_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	60.2	1.9e-96
WP_010862384.1|1683404_1684778_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	83.2	3.7e-181
WP_106911285.1|1685479_1688602_+	chitinase C-terminal domain-containing protein	NA	A0A1X9VNM7	Mimivirus	27.8	8.0e-30
WP_106911286.1|1688903_1691006_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.0	3.2e-22
>prophage 113
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1694773	1697674	3505422	tRNA	uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_010862390.1|1694773_1695031_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.1	6.2e-21
WP_106911290.1|1695193_1697026_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_106911291.1|1697248_1697674_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	42.7	2.7e-13
>prophage 114
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1711709	1726712	3505422	tRNA	Bacillus_phage(33.33%)	11	NA	NA
WP_047708350.1|1711709_1712963_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	2.8e-98
WP_010862400.1|1713174_1713513_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_106911296.1|1713522_1715172_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	35.5	3.4e-88
WP_010862402.1|1715346_1716690_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	39.2	1.6e-11
WP_159033730.1|1716649_1717441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010862404.1|1717454_1718891_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.5	2.1e-17
WP_159033731.1|1719323_1719563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_178080925.1|1719729_1723623_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.0	3.1e-124
WP_010862407.1|1723872_1725438_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_106911298.1|1725912_1726116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106911299.1|1726220_1726712_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	41.8	3.7e-06
>prophage 115
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1731307	1734289	3505422		Klosneuvirus(50.0%)	2	NA	NA
WP_010862416.1|1731307_1732771_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.1	2.8e-86
WP_106911301.1|1732951_1734289_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	2.1e-40
>prophage 116
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1744021	1763097	3505422	protease,tRNA	uncultured_Mediterranean_phage(33.33%)	20	NA	NA
WP_106911305.1|1744021_1744450_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	8.2e-18
WP_106911306.1|1744828_1746109_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	39.4	9.6e-30
WP_106912100.1|1746234_1747527_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	35.7	1.3e-31
WP_047708334.1|1747753_1747954_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_039046707.1|1748001_1748340_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_106911307.1|1748342_1750196_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.3	4.4e-100
WP_039046705.1|1750210_1750729_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_010862435.1|1750756_1751080_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	49.1	3.7e-23
WP_010862436.1|1751113_1751503_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	80.2	1.9e-53
WP_010862437.1|1751527_1752742_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.1	5.1e-33
WP_010862438.1|1752783_1753284_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_106911308.1|1753361_1754111_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_010862440.1|1754608_1755412_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_052021520.1|1755738_1756647_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	41.4	1.3e-49
WP_010862442.1|1756712_1758572_-	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	24.4	3.0e-08
WP_010862443.1|1758599_1758935_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	30.4	1.7e-07
WP_010862444.1|1758953_1760081_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.4	9.2e-93
WP_106911310.1|1760222_1761269_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_159033732.1|1761334_1762345_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_072038667.1|1762575_1763097_+	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	27.5	6.9e-11
>prophage 117
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1769542	1770124	3505422		Caulobacter_phage(100.0%)	1	NA	NA
WP_106911313.1|1769542_1770124_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.7	8.2e-13
>prophage 118
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1776044	1780527	3505422		Bradyrhizobium_phage(33.33%)	5	NA	NA
WP_106911317.1|1776044_1776776_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	2.3e-36
WP_010862458.1|1776830_1777298_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	59.7	3.6e-51
WP_052181344.1|1777260_1778013_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_106911318.1|1778177_1778936_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_106911319.1|1779009_1780527_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	38.1	6.5e-09
>prophage 119
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1786261	1790188	3505422		Bacillus_phage(50.0%)	2	NA	NA
WP_106911325.1|1786261_1788184_-	murein transglycosylase	NA	A0A0S2SXL7	Bacillus_phage	37.3	6.3e-09
WP_047708041.1|1788520_1790188_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	26.8	5.1e-39
>prophage 120
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1799369	1800701	3505422		Geobacillus_virus(100.0%)	1	NA	NA
WP_106911331.1|1799369_1800701_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.3	1.9e-76
>prophage 121
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1806598	1808179	3505422		Streptococcus_phage(100.0%)	1	NA	NA
WP_106911334.1|1806598_1808179_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	24.8	1.5e-29
>prophage 122
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1812159	1812918	3505422		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_010862487.1|1812159_1812918_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.2	2.5e-17
>prophage 123
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1821347	1822907	3505422		Tupanvirus(100.0%)	1	NA	NA
WP_106911341.1|1821347_1822907_+	sulfatase	NA	A0A2K9L1A5	Tupanvirus	23.8	1.5e-16
>prophage 124
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1834241	1837712	3505422		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_106911348.1|1834241_1837712_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.8	1.2e-26
>prophage 125
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1842444	1844438	3505422		Bacillus_virus(50.0%)	2	NA	NA
WP_010862512.1|1842444_1843437_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	2.3e-15
WP_039044617.1|1843448_1844438_+	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	2.6e-06
>prophage 126
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1851528	1852941	3505422		Streptococcus_phage(100.0%)	1	NA	NA
WP_010862518.1|1851528_1852941_+	phosphoglucomutase/phosphomannomutase family protein	NA	A0A1X9I671	Streptococcus_phage	25.7	6.4e-35
>prophage 127
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1858902	1860071	3505422	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_106910487.1|1858902_1860071_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.8	1.2e-167
>prophage 128
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1863633	1874430	3505422	tRNA	Mycoplasma_phage(25.0%)	9	NA	NA
WP_010862522.1|1863633_1865142_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.5	1.1e-48
WP_036769146.1|1865212_1865683_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_047708791.1|1865696_1868552_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	38.8	1.3e-151
WP_010862525.1|1868782_1869214_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_010862526.1|1869400_1870405_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_010862527.1|1870720_1871659_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	2.2e-52
WP_010862528.1|1871669_1872134_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_010862529.1|1872267_1872657_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_106911356.1|1872810_1874430_+	cache domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.9	1.6e-21
>prophage 129
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1879954	1882430	3505422		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_106911359.1|1879954_1881385_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	28.3	1.5e-36
WP_106911360.1|1881512_1882430_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	44.1	4.7e-63
>prophage 130
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1885716	1887246	3505422		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_106911362.1|1885716_1887246_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.3	2.6e-21
>prophage 131
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1892532	1909307	3505422	tRNA	Ostreococcus_lucimarinus_virus(14.29%)	15	NA	NA
WP_106911365.1|1892532_1893798_+	inorganic phosphate transporter	NA	M4QMY4	Ostreococcus_lucimarinus_virus	36.6	1.8e-60
WP_036769158.1|1893971_1894592_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_106911366.1|1894702_1895809_-	general secretion pathway protein GspB	NA	NA	NA	NA	NA
WP_106911367.1|1895808_1897623_-	AAA family ATPase	NA	Q5ZR05	Pseudomonas_phage	30.6	1.9e-07
WP_106911368.1|1897804_1899040_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.6	1.9e-91
WP_010862548.1|1899135_1899942_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_106911369.1|1900069_1900624_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_010862550.1|1900623_1900980_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_010862551.1|1901104_1901719_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_084977264.1|1902011_1903031_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	62.1	1.3e-114
WP_010862554.1|1903214_1903430_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_106911370.1|1903690_1905448_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	37.6	2.7e-75
WP_010862556.1|1905544_1907392_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	6.4e-35
WP_010862557.1|1907544_1908747_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010862558.1|1908962_1909307_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	2.7e-27
>prophage 132
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1917913	1920373	3505422		Tupanvirus(100.0%)	1	NA	NA
WP_106911376.1|1917913_1920373_-	ATP-dependent helicase HrpB	NA	A0A2K9L0J3	Tupanvirus	27.3	4.5e-36
>prophage 133
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1923720	1936405	3505422		Bacillus_virus(33.33%)	12	NA	NA
WP_036769166.1|1923720_1925172_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	37.9	3.0e-27
WP_106911379.1|1925168_1925657_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	38.6	3.5e-17
WP_010862569.1|1925746_1926541_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_106911380.1|1926632_1927487_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_106911381.1|1927635_1928016_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_159033736.1|1928458_1929865_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.4	2.6e-20
WP_039045939.1|1930025_1930796_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_106911383.1|1930792_1931758_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.5	1.9e-22
WP_010862576.1|1931886_1932561_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_010862577.1|1932643_1933174_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	31.9	4.9e-12
WP_010862578.1|1933485_1934556_-	porin OmpA	NA	NA	NA	NA	NA
WP_010862579.1|1935370_1936405_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	4.4e-25
>prophage 134
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1939438	1941103	3505422		Mamastrovirus(100.0%)	1	NA	NA
WP_106911385.1|1939438_1941103_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	48.9	4.3e-14
>prophage 135
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1944978	1947243	3505422		Faustovirus(100.0%)	1	NA	NA
WP_039046514.1|1944978_1947243_-	patatin-like phospholipase family protein	NA	A0A141ZNL4	Faustovirus	29.8	1.1e-07
>prophage 136
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1951620	1959827	3505422		Bacillus_virus(66.67%)	4	NA	NA
WP_064977174.1|1951620_1953510_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.5	2.2e-91
WP_106911391.1|1953532_1955833_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	37.2	4.0e-87
WP_106911392.1|1956121_1958050_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_010862594.1|1958402_1959827_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.9	1.6e-38
>prophage 137
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1974087	1975128	3505422		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_010862605.1|1974087_1975128_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.6	5.3e-103
>prophage 138
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	1978567	1979002	3505422		Rhizoctonia_fumigata_mycovirus(100.0%)	1	NA	NA
WP_106911403.1|1978567_1979002_-	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	43.9	6.2e-05
>prophage 139
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2001628	2006750	3505422	protease	Streptococcus_phage(33.33%)	6	NA	NA
WP_039046495.1|2001628_2002495_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	42.6	3.7e-49
WP_159033737.1|2002559_2004497_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_039046494.1|2004493_2004859_+	YraN family protein	NA	NA	NA	NA	NA
WP_010862634.1|2004867_2005458_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	34.0	5.4e-12
WP_106911412.1|2005485_2006061_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_010862636.1|2006255_2006750_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	45.3	1.5e-28
>prophage 140
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2013117	2015622	3505422		uncultured_Mediterranean_phage(100.0%)	2	NA	NA
WP_039046489.1|2013117_2014482_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.4	4.8e-11
WP_106911416.1|2014557_2015622_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	3.2e-23
>prophage 141
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2019585	2027203	3505422		Bacillus_virus(16.67%)	10	NA	NA
WP_010862653.1|2019585_2020389_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.5	2.5e-20
WP_106911418.1|2020670_2021654_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	32.9	3.3e-38
WP_106911419.1|2021653_2022205_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.9	6.3e-55
WP_106911420.1|2022201_2022759_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_084977216.1|2022739_2023264_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_010862658.1|2023264_2023990_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	1.6e-21
WP_064977151.1|2024055_2025555_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_039046483.1|2025580_2025868_+	ribosome hibernation promoting factor	NA	A0A0U2DF53	Escherichia_phage	41.1	1.3e-06
WP_010862661.1|2025870_2026317_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_010862662.1|2026330_2027203_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.2	4.3e-05
>prophage 142
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2040777	2041821	3505422		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_010862674.1|2040777_2041821_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.2	1.0e-05
>prophage 143
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2065905	2071242	3505422	tRNA	Pandoravirus(20.0%)	7	NA	NA
WP_106911440.1|2065905_2066460_-	Sua5/YciO/YrdC/YwlC family protein	NA	A0A291ATS8	Pandoravirus	28.3	8.7e-12
WP_047709157.1|2066476_2067019_-	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_010862698.1|2067021_2067498_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_106911441.1|2067469_2068600_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	36.5	1.0e-27
WP_159033740.1|2068583_2069561_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	58.5	4.6e-08
WP_010862701.1|2069769_2070282_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-16
WP_106911443.1|2070294_2071242_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	29.6	4.9e-07
>prophage 144
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2088701	2094508	3505422		Tupanvirus(33.33%)	7	NA	NA
WP_064977134.1|2088701_2089886_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	25.7	2.0e-13
WP_010862735.1|2089967_2092082_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.6	4.0e-57
WP_010862736.1|2092166_2092637_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_010862737.1|2092728_2093103_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_106911445.1|2093301_2093592_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_064977132.1|2093703_2094063_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_052181245.1|2094085_2094508_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.4	1.2e-13
>prophage 145
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2100196	2102128	3505422		Tupanvirus(100.0%)	1	NA	NA
WP_106911447.1|2100196_2102128_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	31.5	1.1e-69
>prophage 146
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2105593	2107648	3505422		environmental_Halophage(100.0%)	1	NA	NA
WP_106911449.1|2105593_2107648_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	43.0	1.8e-22
>prophage 147
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2111107	2117483	3505422		Klosneuvirus(33.33%)	6	NA	NA
WP_106911452.1|2111107_2112418_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	5.8e-22
WP_047707105.1|2112678_2113254_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.5	8.9e-68
WP_010862760.1|2113603_2113930_-	YmgD family protein	NA	NA	NA	NA	NA
WP_081632834.1|2113963_2114293_-	glycine zipper family protein	NA	NA	NA	NA	NA
WP_036768678.1|2114626_2115805_+	MFS transporter TsgA	NA	NA	NA	NA	NA
WP_106911453.1|2115908_2117483_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	50.9	4.5e-37
>prophage 148
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2120709	2122344	3505422		Aphanizomenon_phage(100.0%)	1	NA	NA
WP_159033742.1|2120709_2122344_-	AAA family ATPase	NA	A0A2H4PB07	Aphanizomenon_phage	29.0	6.7e-28
>prophage 149
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2125638	2126472	3505422		Vibrio_phage(100.0%)	1	NA	NA
WP_010862771.1|2125638_2126472_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	51.4	3.5e-73
>prophage 150
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2154100	2155729	3505422		Staphylococcus_phage(100.0%)	1	NA	NA
WP_010862801.1|2154100_2155729_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.4	1.2e-141
>prophage 151
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2159429	2161525	3505422		Bacillus_phage(100.0%)	2	NA	NA
WP_139800019.1|2159429_2160155_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.1	1.9e-30
WP_010862806.1|2160154_2161525_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	21.9	6.9e-10
>prophage 152
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2165992	2166619	3505422		Enterobacteria_phage(100.0%)	1	NA	NA
WP_010862812.1|2165992_2166619_-	repressor LexA	NA	A5LH73	Enterobacteria_phage	42.4	8.3e-11
>prophage 153
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2177360	2178941	3505422		Planktothrix_phage(50.0%)	2	NA	NA
WP_039045960.1|2177360_2178062_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	27.6	1.1e-14
WP_064977093.1|2178176_2178941_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	G3M9Y6	Bacillus_virus	22.6	5.9e-11
>prophage 154
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2183540	2186337	3505422		Salicola_phage(50.0%)	3	NA	NA
WP_039045956.1|2183540_2184392_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.4	6.3e-46
WP_047707174.1|2184713_2185664_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_010862831.1|2185671_2186337_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	1.4e-11
>prophage 155
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2195348	2196977	3505422		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_010862842.1|2195348_2195747_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.5	3.8e-25
WP_036768686.1|2195891_2196977_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	49.1	1.3e-08
>prophage 156
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2204113	2221143	3505422		uncultured_Caudovirales_phage(57.14%)	12	NA	NA
WP_010862849.1|2204113_2204773_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	62.5	5.8e-63
WP_106911487.1|2204905_2205181_-	DUF3630 family protein	NA	NA	NA	NA	NA
WP_106911488.1|2205410_2207057_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.5	1.5e-22
WP_106911489.1|2207430_2209080_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.2	1.8e-25
WP_106911490.1|2209582_2211229_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.6	7.7e-24
WP_159033743.1|2211247_2211520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106911492.1|2211738_2213388_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.0	1.0e-15
WP_106911493.1|2213697_2214387_+	pirin family protein	NA	NA	NA	NA	NA
WP_010862856.1|2214536_2216357_-	ATP-dependent DNA helicase RecQ	NA	A0A0G2Y8K9	Acanthamoeba_polyphaga_mimivirus	35.5	2.1e-83
WP_106912111.1|2216525_2217473_-	phospholipase A	NA	NA	NA	NA	NA
WP_010862858.1|2217775_2218246_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_106911494.1|2218311_2221143_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	25.8	8.4e-10
>prophage 157
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2229612	2241778	3505422		Bacillus_phage(40.0%)	9	NA	NA
WP_159033746.1|2229612_2230905_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.9	3.9e-15
WP_106911500.1|2230994_2231243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159033747.1|2231554_2232160_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_106911502.1|2232420_2233413_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	39.0	2.6e-51
WP_010862870.1|2233594_2234056_+	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_106911503.1|2234071_2235412_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.7	8.8e-18
WP_159033748.1|2236294_2240110_-	ATP-dependent helicase	NA	A0A160DDK8	Gordonia_phage	27.3	2.2e-37
WP_106911505.1|2240282_2241242_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_106911506.1|2241226_2241778_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.7	2.9e-44
>prophage 158
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2246269	2266424	3505422		Tupanvirus(22.22%)	18	NA	NA
WP_106911508.1|2246269_2248189_-	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	26.3	4.8e-17
WP_106911509.1|2248277_2249453_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	48.1	1.9e-101
WP_106911510.1|2249458_2250118_-	acetyltransferase	NA	NA	NA	NA	NA
WP_106911511.1|2250107_2250725_-	sugar transferase	NA	NA	NA	NA	NA
WP_106911512.1|2250721_2251831_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_106911513.1|2251855_2252878_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	A0A2K9L0I7	Tupanvirus	44.1	1.5e-70
WP_106911514.1|2252918_2254187_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	NA	NA	NA	NA
WP_106911515.1|2254232_2255402_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_106911516.1|2255359_2257237_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A0N9QYX6	Chrysochromulina_ericina_virus	28.5	3.1e-29
WP_106911517.1|2258350_2259637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106911518.1|2259624_2260176_-	acyltransferase	NA	NA	NA	NA	NA
WP_106911519.1|2260181_2261084_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	26.4	5.7e-13
WP_106911520.1|2261070_2262345_-	O-antigen translocase	NA	NA	NA	NA	NA
WP_106911521.1|2262348_2263470_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	31.1	2.7e-28
WP_106911522.1|2263466_2264654_-	ankyrin repeat domain-containing protein	NA	A0A220T679	Eptesipox_virus	57.8	6.9e-06
WP_106911523.1|2264625_2265048_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_106911524.1|2265059_2265971_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	66.6	8.1e-108
WP_106912113.1|2266082_2266424_-	four helix bundle protein	NA	I7HTA3	Enterobacteria_phage	43.7	3.8e-10
>prophage 159
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2270566	2272597	3505422		Bacillus_phage(100.0%)	1	NA	NA
WP_039046404.1|2270566_2272597_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	4.0e-115
>prophage 160
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2282711	2283362	3505422		Staphylococcus_phage(100.0%)	1	NA	NA
WP_010862908.1|2282711_2283362_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	42.1	3.6e-41
>prophage 161
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2291683	2293360	3505422		Micromonas_pusilla_virus(100.0%)	1	NA	NA
WP_106911535.1|2291683_2293360_-	acetolactate synthase 2 catalytic subunit	NA	G8DDL3	Micromonas_pusilla_virus	28.9	1.2e-59
>prophage 162
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2326977	2333792	3505422		Enterobacteria_phage(33.33%)	6	NA	NA
WP_106911553.1|2326977_2327865_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	26.5	2.7e-07
WP_106911554.1|2327910_2328891_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_106912116.1|2328887_2330393_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	3.2e-16
WP_010862947.1|2330412_2330832_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_010862948.1|2331132_2331876_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_010862949.1|2331923_2333792_-	low affinity potassium transporter Kup	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	31.6	9.9e-76
>prophage 163
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2349166	2350153	3505422		Clostridium_phage(100.0%)	1	NA	NA
WP_106911567.1|2349166_2350153_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A0A7RUS8	Clostridium_phage	38.9	7.2e-17
>prophage 164
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2372746	2390077	3505422		Synechococcus_phage(14.29%)	15	NA	NA
WP_039046363.1|2372746_2373217_+	adenylyltransferase/cytidyltransferase family protein	NA	E3SJ88	Synechococcus_phage	32.0	1.8e-05
WP_106911576.1|2373217_2374222_+	putative 2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_106911577.1|2374229_2375228_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.2	1.1e-28
WP_159033753.1|2375215_2376940_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_106911579.1|2376914_2377634_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047707417.1|2377837_2379670_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.5	1.1e-132
WP_039046361.1|2379737_2380508_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010862995.1|2381041_2382409_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	30.3	6.0e-22
WP_106911580.1|2382672_2385081_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.9	1.1e-119
WP_106911581.1|2385110_2386187_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_106911582.1|2386206_2387307_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	33.9	7.7e-52
WP_071596447.1|2387323_2388721_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_010863001.1|2389341_2389476_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_010863002.1|2389496_2389853_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_010863003.1|2389819_2390077_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	57.1	1.2e-16
>prophage 165
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2419980	2421952	3505422		Bacillus_virus(50.0%)	4	NA	NA
WP_010863027.1|2419980_2420646_+	OmpA family lipoprotein	NA	G3M9Z0	Bacillus_virus	32.2	7.0e-08
WP_010863028.1|2420778_2421126_-	RidA family protein	NA	NA	NA	NA	NA
WP_047707427.1|2421405_2421675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010863030.1|2421712_2421952_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	75.0	6.6e-09
>prophage 166
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2428252	2428867	3505422		Streptococcus_phage(100.0%)	1	NA	NA
WP_106911594.1|2428252_2428867_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	37.0	3.2e-23
>prophage 167
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2448181	2451537	3505422		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_106911601.1|2448181_2449813_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.8	7.9e-37
WP_010863051.1|2449894_2450176_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_106911602.1|2450179_2450776_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_039045231.1|2450772_2451537_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.7	2.0e-27
>prophage 168
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2455215	2456947	3505422		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
WP_039045235.1|2455215_2456502_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	5.4e-41
WP_010863059.1|2456620_2456947_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	44.3	1.9e-19
>prophage 169
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2460897	2467062	3505422		Enterobacteria_phage(40.0%)	6	NA	NA
WP_010863063.1|2460897_2462031_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.2	3.3e-26
WP_106911605.1|2462027_2463290_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HZW8	Acanthocystis_turfacea_Chlorella_virus	26.3	1.8e-20
WP_039045249.1|2463286_2464354_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.3	9.6e-100
WP_106911606.1|2464356_2465238_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.7	1.1e-109
WP_106911607.1|2465215_2465926_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_010863068.1|2465931_2467062_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	34.1	2.0e-18
>prophage 170
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2479560	2491605	3505422		uncultured_Caudovirales_phage(20.0%)	6	NA	NA
WP_106911611.1|2479560_2480877_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	35.2	3.0e-34
WP_106911612.1|2481079_2484772_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	77.8	1.6e-21
WP_106912119.1|2484868_2486218_-	lysine-sensitive aspartokinase 3	NA	A0A1X9I5D0	Streptococcus_phage	36.3	1.7e-05
WP_106912120.1|2486711_2487830_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_106911613.1|2487929_2490785_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	4.9e-308
WP_039046679.1|2491044_2491605_+	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	69.8	1.5e-43
>prophage 171
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2524041	2528027	3505422		Gordonia_phage(50.0%)	3	NA	NA
WP_106911625.1|2524041_2525013_+	tyrosine recombinase XerC	NA	A0A166YH27	Gordonia_phage	31.9	8.1e-13
WP_106911626.1|2525102_2525819_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_106911627.1|2525855_2528027_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.8	1.9e-115
>prophage 172
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2542134	2542866	3505422		Mollivirus(100.0%)	1	NA	NA
WP_106911633.1|2542134_2542866_+	3-oxoacyl-ACP reductase FabG	NA	A0A0M4JSW6	Mollivirus	25.7	3.1e-09
>prophage 173
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2549013	2551815	3505422		uncultured_virus(100.0%)	1	NA	NA
WP_106911635.1|2549013_2551815_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.1	5.1e-68
>prophage 174
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2560241	2561294	3505422		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_039046099.1|2560241_2561294_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.9	1.0e-08
>prophage 175
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2572876	2574271	3505422		environmental_Halophage(100.0%)	1	NA	NA
WP_106911645.1|2572876_2574271_-	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	68.9	9.4e-47
>prophage 176
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2577519	2586536	3505422		Bordetella_phage(25.0%)	7	NA	NA
WP_106911648.1|2577519_2579640_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	35.8	1.1e-11
WP_010864937.1|2579666_2579942_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_010864936.1|2580005_2580629_-	guanylate kinase	NA	A0A223FN12	Murmansk_poxvirus	34.5	8.8e-21
WP_106911649.1|2581039_2581399_-	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_106911650.1|2581958_2583842_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	77.6	1.5e-10
WP_106911651.1|2584086_2584953_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106911652.1|2585084_2586536_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.8	8.8e-48
>prophage 177
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2595336	2600451	3505422		Xanthomonas_phage(25.0%)	7	NA	NA
WP_010864921.1|2595336_2595792_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	61.5	1.2e-51
WP_106911660.1|2595788_2597012_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.1	1.1e-38
WP_106911661.1|2597294_2597978_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_010864917.1|2598298_2598535_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_010864916.1|2598546_2598714_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_106911662.1|2598904_2599792_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	28.3	1.5e-18
WP_106911663.1|2599968_2600451_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.4	2.4e-26
>prophage 178
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2610347	2611295	3505422		Synechococcus_phage(100.0%)	1	NA	NA
WP_010864901.1|2610347_2611295_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	36.0	7.6e-32
>prophage 179
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2617504	2617759	3505422		Rhizobium_phage(100.0%)	1	NA	NA
WP_039046067.1|2617504_2617759_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	47.9	7.2e-14
>prophage 180
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2621093	2623186	3505422		Bacillus_phage(100.0%)	2	NA	NA
WP_106912123.1|2621093_2622467_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	28.4	1.5e-17
WP_010864887.1|2622499_2623186_-	envelope stress response regulator transcription factor CpxR	NA	W8CYM9	Bacillus_phage	38.1	5.1e-30
>prophage 181
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2634829	2639652	3505422		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_039046059.1|2634829_2635672_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.3	1.1e-13
WP_010864873.1|2636201_2636441_+	cell division protein ZapB	NA	NA	NA	NA	NA
WP_010864872.1|2636598_2637084_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_039046057.1|2637207_2638110_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_010864870.1|2638317_2639652_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	28.7	1.3e-42
>prophage 182
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2652639	2653230	3505422		Vibrio_phage(100.0%)	1	NA	NA
WP_106911688.1|2652639_2653230_-	PadR family transcriptional regulator	NA	H9EB19	Vibrio_phage	43.0	7.8e-11
>prophage 183
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2665351	2666083	3505422		Synechococcus_phage(100.0%)	1	NA	NA
WP_106911695.1|2665351_2666083_-	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	55.9	1.2e-45
>prophage 184
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2681707	2684809	3505422		Leptospira_phage(100.0%)	1	NA	NA
WP_106911700.1|2681707_2684809_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.5	3.9e-53
>prophage 185
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2692487	2694449	3505422		Staphylococcus_phage(100.0%)	1	NA	NA
WP_106911702.1|2692487_2694449_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.8	1.5e-82
>prophage 186
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2709904	2712725	3505422		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_010864829.1|2709904_2710852_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.5	5.4e-30
WP_106911709.1|2711540_2712725_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	25.4	1.3e-12
>prophage 187
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2716608	2724958	3505422		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_010864821.1|2716608_2720637_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.4	1.6e-22
WP_106911710.1|2720734_2724958_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	25.9	3.6e-65
>prophage 188
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2729751	2730024	3505422		Bacillus_phage(100.0%)	1	NA	NA
WP_010864814.1|2729751_2730024_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	1.9e-20
>prophage 189
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2734320	2735910	3505422		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_106911716.1|2734320_2735910_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	4.2e-67
>prophage 190
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2744088	2746082	3505422		uncultured_virus(50.0%)	2	NA	NA
WP_010864801.1|2744088_2744382_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	36.8	6.6e-11
WP_010864800.1|2744435_2746082_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.0	2.9e-188
>prophage 191
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2751303	2755415	3505422		Morganella_phage(50.0%)	5	NA	NA
WP_106911722.1|2751303_2751876_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	51.0	6.4e-42
WP_010864790.1|2752108_2752468_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_010864789.1|2752480_2752879_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_106911723.1|2752887_2753622_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_106911724.1|2753621_2755415_-	fumarate reductase (quinol) flavoprotein subunit	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	26.8	2.8e-19
>prophage 192
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2762890	2763436	3505422		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_106911726.1|2762890_2763436_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.7	5.3e-30
>prophage 193
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2767485	2771732	3505422		Vibrio_phage(50.0%)	2	NA	NA
WP_106911729.1|2767485_2769648_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.9	3.6e-13
WP_106911730.1|2769650_2771732_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	43.2	3.0e-65
>prophage 194
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2776958	2787645	3505422		Pithovirus(33.33%)	11	NA	NA
WP_010864767.1|2776958_2778257_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	2.1e-69
WP_039045740.1|2778453_2779083_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_106911732.1|2779216_2780404_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_010864764.1|2780580_2781009_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_106911733.1|2781048_2783457_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.6	8.3e-67
WP_010864762.1|2783463_2784204_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_010864761.1|2784634_2785021_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_071849706.1|2785029_2785377_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_010864759.1|2785351_2785579_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_010864758.1|2785622_2786075_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_010864757.1|2786244_2787645_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	76.4	3.3e-193
>prophage 195
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2800239	2800449	3505422		Lactococcus_phage(100.0%)	1	NA	NA
WP_010864745.1|2800239_2800449_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	60.0	1.0e-13
>prophage 196
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2807097	2809285	3505422		Hokovirus(50.0%)	2	NA	NA
WP_106911745.1|2807097_2808519_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	25.8	4.6e-33
WP_106911746.1|2808631_2809285_+	adenylyl-sulfate kinase	NA	A0A2P1ELS9	Moumouvirus	37.6	1.3e-22
>prophage 197
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2821319	2823027	3505422		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_010864729.1|2821319_2821847_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.6	1.2e-58
WP_010864728.1|2822010_2823027_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	45.1	1.5e-73
>prophage 198
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2829621	2830590	3505422		Indivirus(100.0%)	1	NA	NA
WP_106911754.1|2829621_2830590_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.5	1.9e-06
>prophage 199
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2835165	2835657	3505422		Bacillus_phage(100.0%)	1	NA	NA
WP_106911756.1|2835165_2835657_+	type 3 dihydrofolate reductase	NA	A0A1I9S5V6	Bacillus_phage	44.4	1.5e-28
>prophage 200
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2843843	2846054	3505422		Bordetella_phage(100.0%)	1	NA	NA
WP_106911761.1|2843843_2846054_-	GGDEF domain-containing protein	NA	A0A2D0W9J3	Bordetella_phage	38.8	1.4e-07
>prophage 201
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2850267	2856648	3505422		Planktothrix_phage(33.33%)	4	NA	NA
WP_106911764.1|2850267_2850972_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	39.3	2.1e-26
WP_106911765.1|2851114_2851882_-	DedA family protein	NA	NA	NA	NA	NA
WP_106911766.1|2852121_2853501_-	PhoH family protein	NA	A0A2I7SAD7	Vibrio_phage	45.8	1.3e-109
WP_106911767.1|2853735_2856648_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.4	9.8e-22
>prophage 202
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2868901	2872822	3505422		Catovirus(50.0%)	2	NA	NA
WP_172534898.1|2868901_2870698_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	24.2	1.1e-39
WP_106911776.1|2871097_2872822_+	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	28.2	3.7e-53
>prophage 203
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2887913	2890295	3505422		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_106911779.1|2887913_2890295_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	29.4	8.0e-38
>prophage 204
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2903926	2907919	3505422		Escherichia_phage(33.33%)	7	NA	NA
WP_010864655.1|2903926_2904310_-	autonomous glycyl radical cofactor GrcA	NA	A0A2K9VG12	Escherichia_phage	68.0	5.8e-31
WP_010864654.1|2904499_2904814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036770009.1|2905001_2905679_+	uracil-DNA glycosylase	NA	A0A0A7D9F8	Equid_alphaherpesvirus	48.6	1.1e-53
WP_159033763.1|2905795_2905984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010864652.1|2905958_2906504_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_010864651.1|2906595_2906775_-	DUF3545 family protein	NA	NA	NA	NA	NA
WP_106911786.1|2906965_2907919_-	transaldolase	NA	A0A127KNC6	Cyanophage	29.0	3.9e-12
>prophage 205
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2910939	2912352	3505422		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_081995565.1|2910939_2912352_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	31.9	1.2e-49
>prophage 206
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2915614	2923444	3505422	integrase,tRNA	Brevibacillus_phage(25.0%)	6	2918650:2918663	2925725:2925738
WP_106912133.1|2915614_2916463_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.6	1.3e-27
WP_039045836.1|2916518_2917217_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_010864641.1|2917330_2919058_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.0	1.6e-59
2918650:2918663	attL	CGACGATTTTCAGC	NA	NA	NA	NA
WP_106911789.1|2919144_2920242_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_010864639.1|2920252_2921767_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SFI4	Hokovirus	38.8	2.0e-87
WP_106911790.1|2922268_2923444_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.4	3.8e-142
2925725:2925738	attR	CGACGATTTTCAGC	NA	NA	NA	NA
>prophage 207
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2929420	2933498	3505422	transposase	Bacillus_virus(50.0%)	4	NA	NA
WP_106911795.1|2929420_2930530_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	31.7	3.5e-12
WP_106911796.1|2930662_2931319_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_159033764.1|2931591_2932260_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_001339197.1|2932289_2933498_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 208
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2938492	2939701	3505422	transposase	Bluetongue_virus(100.0%)	1	NA	NA
WP_001339197.1|2938492_2939701_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 209
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2942855	2946652	3505422		Wolbachia_phage(33.33%)	3	NA	NA
WP_106911801.1|2942855_2943899_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	48.6	6.5e-85
WP_106911802.1|2943911_2945084_-	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	50.6	8.5e-41
WP_106911803.1|2945080_2946652_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	7.0e-107
>prophage 210
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2950277	2952516	3505422		Stenotrophomonas_phage(50.0%)	3	NA	NA
WP_106911807.1|2950277_2951231_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	41.5	8.4e-55
WP_072033036.1|2951261_2951810_+	lecithin retinol acyltransferase family protein	NA	NA	NA	NA	NA
WP_106911808.1|2952054_2952516_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	35.3	5.3e-15
>prophage 211
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2956135	2975215	3505422		Streptococcus_phage(14.29%)	17	NA	NA
WP_106911813.1|2956135_2956768_+	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	36.8	2.4e-34
WP_106911814.1|2957373_2957865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106911815.1|2958049_2958523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010864638.1|2959403_2959616_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	67.1	2.8e-19
WP_106911816.1|2960472_2960811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106911817.1|2961073_2962333_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_010864632.1|2962463_2962937_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	4.8e-19
WP_106911818.1|2963547_2964582_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_010864630.1|2964669_2965413_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.7	8.3e-42
WP_039045840.1|2965547_2966237_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_064978190.1|2967018_2967549_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_106911819.1|2967556_2969821_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.0	1.7e-08
WP_106911820.1|2969892_2970681_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_106911821.1|2970688_2971498_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_010864624.1|2971499_2972294_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	4.1e-116
WP_010864623.1|2972586_2973738_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_106911822.1|2974045_2975215_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	52.6	1.3e-89
>prophage 212
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2980241	2983052	3505422	tRNA	Megavirus(100.0%)	1	NA	NA
WP_106911826.1|2980241_2983052_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	25.7	1.7e-79
>prophage 213
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2986567	2987728	3505422		Halovirus(100.0%)	1	NA	NA
WP_106912136.1|2986567_2987728_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.9	1.0e-46
>prophage 214
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	2993999	2997639	3505422	protease	Beihai_barnacle_virus(33.33%)	3	NA	NA
WP_010864605.1|2993999_2994629_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	A0A1L3KJH0	Beihai_barnacle_virus	28.6	6.2e-06
WP_106911830.1|2994684_2996718_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0BXI2	Ostreococcus_lucimarinus_virus	43.7	7.9e-119
WP_106911831.1|2996808_2997639_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	30.4	1.3e-22
>prophage 215
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3002038	3004753	3505422		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_010864598.1|3002038_3004753_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.6	1.4e-25
>prophage 216
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3010322	3022086	3505422		Chrysochromulina_ericina_virus(33.33%)	8	NA	NA
WP_010864592.1|3010322_3012251_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	32.1	4.2e-53
WP_010864591.1|3012400_3013279_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_106911833.1|3013293_3014289_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_106911834.1|3014395_3016429_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	33.3	9.0e-14
WP_039045858.1|3016735_3017257_+	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_106911835.1|3017250_3017757_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_052181335.1|3017863_3018967_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_106911836.1|3018963_3022086_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.7	3.0e-77
>prophage 217
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3028962	3030967	3505422	tRNA	Spodoptera_frugiperda_granulovirus(50.0%)	2	NA	NA
WP_106912137.1|3028962_3029244_+	GIY-YIG nuclease family protein	NA	A0A0C5AS36	Spodoptera_frugiperda_granulovirus	54.8	1.5e-12
WP_106911840.1|3029713_3030967_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	26.3	1.3e-18
>prophage 218
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3042928	3043342	3505422		Streptococcus_phage(100.0%)	1	NA	NA
WP_159033766.1|3042928_3043342_-	C40 family peptidase	NA	A0A1S5SEZ8	Streptococcus_phage	42.6	6.0e-18
>prophage 219
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3051972	3055030	3505422		Euphorbia_ringspot_virus(50.0%)	5	NA	NA
WP_106911844.1|3051972_3052578_-	XTP/dITP diphosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	26.0	8.3e-08
WP_106911845.1|3052757_3053261_-	DUF4426 domain-containing protein	NA	NA	NA	NA	NA
WP_010864558.1|3053329_3053617_-	YggU family protein	NA	NA	NA	NA	NA
WP_010864557.1|3053628_3054183_-	YggT family protein	NA	NA	NA	NA	NA
WP_106911846.1|3054211_3055030_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	30.9	1.4e-18
>prophage 220
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3066847	3068002	3505422		Staphylococcus_phage(100.0%)	1	NA	NA
WP_010864540.1|3066847_3068002_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.7	1.7e-126
>prophage 221
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3082341	3083088	3505422		Flavobacterium_phage(100.0%)	1	NA	NA
WP_039045874.1|3082341_3083088_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	45.9	1.3e-26
>prophage 222
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3092039	3096220	3505422		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_106911854.1|3092039_3092633_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	41.0	2.1e-27
WP_106911855.1|3092740_3096220_+	DNA polymerase III subunit alpha	NA	R4TPF1	Streptomyces_phage	38.9	1.4e-200
>prophage 223
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3112973	3114017	3505422		Planktothrix_phage(100.0%)	1	NA	NA
WP_064978147.1|3112973_3114017_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	37.7	1.2e-35
>prophage 224
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3124580	3127274	3505422		Leptospira_phage(100.0%)	1	NA	NA
WP_106911864.1|3124580_3127274_+	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	38.7	6.9e-163
>prophage 225
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3134471	3144091	3505422	integrase	Vibrio_phage(33.33%)	9	3122578:3122593	3143161:3143176
3122578:3122593	attL	TTGGTGGAGCTGGCGG	NA	NA	NA	NA
WP_106911870.1|3134471_3135743_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	51.7	3.2e-118
WP_106911871.1|3135746_3136169_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.8	1.8e-33
WP_106911872.1|3136583_3136970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159033770.1|3137455_3137632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_178080933.1|3138106_3139336_-	ATPase	NA	A0A2I5ARF5	Synechococcus_phage	28.4	1.1e-11
WP_159033771.1|3139404_3140457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106911874.1|3140664_3140916_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.0	1.1e-09
WP_106911875.1|3141788_3142988_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	46.8	1.3e-105
WP_010864458.1|3143605_3144091_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.7	3.0e-24
3143161:3143176	attR	TTGGTGGAGCTGGCGG	NA	NA	NA	NA
>prophage 226
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3150139	3153284	3505422		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_010864450.1|3150139_3152059_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	3.8e-147
WP_010864449.1|3152150_3153284_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.3	2.2e-22
>prophage 227
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3160426	3162037	3505422		Staphylococcus_phage(100.0%)	1	NA	NA
WP_106911884.1|3160426_3162037_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	1.3e-18
>prophage 228
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3167994	3176870	3505422		Klosneuvirus(33.33%)	3	NA	NA
WP_106912148.1|3167994_3170871_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.4	1.7e-66
WP_106911888.1|3171063_3174921_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	19.5	5.9e-06
WP_106911889.1|3174932_3176870_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	27.4	1.0e-27
>prophage 229
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3183981	3197504	3505422	tRNA	Bacillus_phage(40.0%)	12	NA	NA
WP_106911890.1|3183981_3184806_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	A0A291ATS8	Pandoravirus	32.5	4.0e-21
WP_010864427.1|3184875_3185073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047708974.1|3185213_3185654_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_106911891.1|3185675_3186893_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	35.5	7.6e-69
WP_010864424.1|3187270_3188185_+	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_106911892.1|3188243_3188633_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_106911893.1|3188625_3189747_+	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_039045193.1|3189824_3190619_-	flap endonuclease Xni	NA	S5M4P0	Bacillus_phage	28.2	3.6e-11
WP_106911895.1|3191087_3192452_-	LOG family protein	NA	NA	NA	NA	NA
WP_106911896.1|3192582_3194130_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.2	5.2e-22
WP_106911897.1|3194181_3196521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106911898.1|3196640_3197504_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	38.3	1.5e-42
>prophage 230
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3213242	3214472	3505422		Catovirus(100.0%)	1	NA	NA
WP_010864402.1|3213242_3214472_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	49.9	3.0e-105
>prophage 231
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3228603	3239665	3505422		Prochlorococcus_phage(33.33%)	6	NA	NA
WP_106912150.1|3228603_3231528_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.4e-262
WP_106911914.1|3232104_3233457_+	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_106911915.1|3233639_3234848_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.2	1.7e-15
WP_159033772.1|3235151_3235664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047708995.1|3235973_3236627_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_106911917.1|3236950_3239665_+	hypothetical protein	NA	A0A097P8Z3	Sucra_jujuba_nucleopolyhedrovirus	50.8	4.8e-164
>prophage 232
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3243990	3257753	3505422		Streptococcus_phage(40.0%)	13	NA	NA
WP_010864380.1|3243990_3244566_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.7	8.2e-05
WP_010864379.1|3244714_3245323_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_106911920.1|3245322_3246429_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_106911921.1|3246575_3247079_+	SoxR reducing system RseC family protein	NA	NA	NA	NA	NA
WP_010864376.1|3247162_3248956_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.3	4.6e-22
WP_039045167.1|3248969_3249866_+	signal peptidase I	NA	NA	NA	NA	NA
WP_010864374.1|3249881_3250559_+	ribonuclease III	NA	A0A0P0BX11	Ostreococcus_lucimarinus_virus	32.6	2.1e-23
WP_010864373.1|3250555_3251464_+	GTPase Era	NA	NA	NA	NA	NA
WP_106911922.1|3251485_3252202_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_106911923.1|3252194_3252926_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_106911924.1|3252925_3253306_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_106911925.1|3253480_3256318_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.2	1.3e-50
WP_106911926.1|3256382_3257753_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	29.3	2.4e-39
>prophage 233
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3261344	3279906	3505422	tRNA	uncultured_Mediterranean_phage(18.18%)	17	NA	NA
WP_010864365.1|3261344_3262982_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.6	2.2e-159
WP_010864364.1|3263077_3264379_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	59.4	2.7e-133
WP_010864363.1|3264739_3265033_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_106912152.1|3265032_3265770_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_010864361.1|3265848_3266331_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_106911929.1|3266230_3267370_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_106911930.1|3267350_3268100_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.2	4.0e-68
WP_047709004.1|3268102_3268732_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.5	3.4e-36
WP_010864357.1|3268728_3269304_+	DedA family protein	NA	NA	NA	NA	NA
WP_010864356.1|3269319_3270255_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	36.4	1.7e-07
WP_010864355.1|3270309_3271293_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	1.4e-33
WP_106911931.1|3271537_3274111_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	22.4	3.1e-27
WP_039045159.1|3274414_3274903_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.4	1.8e-24
WP_039045158.1|3274981_3276046_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	62.2	2.0e-113
WP_106911932.1|3276045_3276597_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_106911933.1|3276824_3279452_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.9	6.7e-78
WP_010864349.1|3279720_3279906_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 234
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3298449	3301486	3505422		Enterobacteria_phage(50.0%)	2	NA	NA
WP_106911937.1|3298449_3300162_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	64.7	1.3e-191
WP_039045505.1|3300409_3301486_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.3	2.0e-89
>prophage 235
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3309779	3312353	3505422		Enterobacteria_phage(100.0%)	1	NA	NA
WP_010864321.1|3309779_3312353_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.4	2.4e-125
>prophage 236
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3315821	3320060	3505422		Staphylococcus_phage(50.0%)	5	NA	NA
WP_010864319.1|3315821_3317318_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	34.3	2.7e-60
WP_159033775.1|3317367_3317529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039045511.1|3317591_3318701_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.1	1.6e-49
WP_106911943.1|3318789_3319458_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	32.5	8.3e-25
WP_106911944.1|3319595_3320060_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.7	4.1e-31
>prophage 237
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3351435	3358514	3505422		Streptococcus_phage(66.67%)	4	NA	NA
WP_106911958.1|3351435_3352539_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.7	2.5e-58
WP_106911959.1|3352549_3353815_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.3	4.3e-99
WP_106911960.1|3353981_3355274_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_106911961.1|3355289_3358514_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	19.7	1.3e-38
>prophage 238
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3362359	3363538	3505422		Stx2-converting_phage(100.0%)	1	NA	NA
WP_010864274.1|3362359_3363538_-	serine hydrolase	NA	B6DZZ7	Stx2-converting_phage	48.3	2.1e-95
>prophage 239
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3370590	3373176	3505422	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_039045529.1|3370590_3373176_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.4	2.6e-191
>prophage 240
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3376956	3378063	3505422		Pseudomonas_phage(100.0%)	1	NA	NA
WP_010864260.1|3376956_3378063_-	PhoH family protein	NA	A0A1L2C8V4	Pseudomonas_phage	46.6	1.1e-47
>prophage 241
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3382784	3384455	3505422		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_106911968.1|3382784_3384455_-	asparagine synthase B	NA	H8ZJK1	Ostreococcus_tauri_virus	40.5	6.1e-85
>prophage 242
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3395346	3400550	3505422	tRNA	Escherichia_phage(50.0%)	7	NA	NA
WP_106911970.1|3395346_3397008_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	84.0	2.5e-280
WP_010864248.1|3397288_3397738_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_178018038.1|3397971_3398526_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_010864246.1|3398611_3399139_-	flavodoxin FldA	NA	NA	NA	NA	NA
WP_010864245.1|3399157_3399472_-	LexA regulated protein	NA	NA	NA	NA	NA
WP_010864244.1|3399502_3399724_-	DUF2788 domain-containing protein	NA	NA	NA	NA	NA
WP_106911972.1|3399785_3400550_-	alpha/beta fold hydrolase	NA	A0A2P1CHW5	Mycobacterium_phage	33.3	2.6e-06
>prophage 243
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3404397	3405870	3505422		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_106911976.1|3404397_3405870_+	deoxyribodipyrimidine photo-lyase	NA	F2Y1K1	Organic_Lake_phycodnavirus	29.8	4.6e-52
>prophage 244
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3420307	3423441	3505422		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
WP_010864225.1|3420307_3421069_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.4	1.2e-16
WP_106911982.1|3421191_3422103_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_106911983.1|3422121_3423441_+	murein DD-endopeptidase MepM	NA	A0A1B0XUH3	Freshwater_phage	42.2	1.5e-14
>prophage 245
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3436982	3438452	3505422		Cyanophage(100.0%)	1	NA	NA
WP_010864212.1|3436982_3438452_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.8	2.1e-81
>prophage 246
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3442565	3443906	3505422		Clostridium_phage(100.0%)	1	NA	NA
WP_159033777.1|3442565_3443906_-	diguanylate cyclase	NA	A0A1L6BY33	Clostridium_phage	27.6	5.0e-05
>prophage 247
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3451141	3468397	3505422		Bodo_saltans_virus(25.0%)	21	NA	NA
WP_010864201.1|3451141_3451408_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	71.8	1.0e-26
WP_039045554.1|3451827_3452013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010864199.1|3452562_3452958_+	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_010864198.1|3452975_3453278_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_106911995.1|3453261_3453984_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_106911996.1|3453984_3454881_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	33.2	2.5e-37
WP_010864195.1|3454958_3455153_-	DUF4250 domain-containing protein	NA	NA	NA	NA	NA
WP_039045557.1|3455487_3455961_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_010864193.1|3456305_3457427_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_039045558.1|3457649_3458783_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	35.4	1.7e-30
WP_106911998.1|3458805_3459702_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_010864190.1|3459701_3460544_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_106911999.1|3460678_3461821_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	6.3e-25
WP_106912000.1|3462035_3462536_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	51.8	2.6e-23
WP_106912001.1|3462786_3463458_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_106912002.1|3463454_3464129_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_010864185.1|3464135_3464879_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_106912003.1|3464909_3465638_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.2	2.4e-30
WP_039045563.1|3466290_3466908_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	30.2	4.9e-16
WP_010864182.1|3466901_3467678_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_106912005.1|3467659_3468397_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	A0A2H4UVM0	Bodo_saltans_virus	27.7	1.2e-08
>prophage 248
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3472635	3480246	3505422	tRNA	Cellulophaga_phage(33.33%)	5	NA	NA
WP_010864176.1|3472635_3473535_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	84.2	1.5e-08
WP_178080928.1|3474375_3476295_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.1	5.7e-87
WP_106912010.1|3476459_3477161_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_159033778.1|3477762_3478056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106912012.1|3478533_3480246_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	3.9e-34
>prophage 249
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3485772	3488241	3505422		Pseudomonas_phage(100.0%)	1	NA	NA
WP_178080929.1|3485772_3488241_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.3	1.1e-101
>prophage 250
NZ_CP027852	Plesiomonas shigelloides strain MS-17-188 chromosome, complete genome	3505422	3495195	3496467	3505422		Bacillus_phage(100.0%)	1	NA	NA
WP_106912018.1|3495195_3496467_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	30.6	4.9e-10
>prophage 1
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	0	7587	395858		Bacillus_virus(100.0%)	7	NA	NA
WP_106912412.1|500_929_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_106912162.1|1012_1633_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_106912163.1|1996_2806_-	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_106912164.1|2895_4077_-	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_010863165.1|4303_5002_+	phosphonate utilization transcriptional regulator PhnR	NA	NA	NA	NA	NA
WP_106912413.1|5245_6238_+	putative 2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_106912165.1|6504_7587_+	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	2.4e-26
>prophage 2
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	18334	19503	395858	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_106910689.1|18334_19503_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.8	1.2e-167
>prophage 3
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	31873	33898	395858		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_106912183.1|31873_33898_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	36.6	3.4e-21
>prophage 4
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	42863	43997	395858		Streptococcus_phage(100.0%)	1	NA	NA
WP_106912187.1|42863_43997_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.5	3.1e-48
>prophage 5
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	51221	53247	395858		Streptomyces_phage(50.0%)	2	NA	NA
WP_106912414.1|51221_51992_-	GntR family transcriptional regulator	NA	A0A291LID1	Streptomyces_phage	39.1	1.3e-05
WP_106912192.1|52188_53247_+	ADP-ribosylglycohydrolase family protein	NA	A0A172WZB4	Catopsilia_pomona_nucleopolyhedrovirus	26.4	1.3e-08
>prophage 6
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	57345	80400	395858	tRNA,integrase,transposase	Escherichia_phage(41.67%)	17	52962:52977	76877:76892
52962:52977	attL	TGGCTCTGGGATGGAT	NA	NA	NA	NA
WP_106912193.1|57345_57777_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.9	4.3e-51
WP_144060917.1|57888_58983_-	serine hydrolase	NA	B6DZZ7	Stx2-converting_phage	58.4	2.7e-118
WP_106912416.1|59496_60033_-	4Fe-4S binding protein	NA	A0A077SLP0	Escherichia_phage	24.6	1.7e-09
WP_106912194.1|60092_60683_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	47.7	2.2e-37
WP_106912195.1|60913_61675_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	47.9	3.7e-45
WP_047708430.1|61677_62298_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	70.4	3.1e-90
WP_106912196.1|62313_64761_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	52.6	8.3e-248
WP_106912197.1|65271_65694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106912198.1|66169_67702_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_106912199.1|67695_69744_+	selenocysteine-specific translation elongation factor	NA	E3T4N3	Cafeteria_roenbergensis_virus	29.5	2.4e-06
WP_106912200.1|70242_71424_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	67.6	7.5e-154
WP_106912201.1|71567_72518_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_106912202.1|72708_74145_-	glycoside hydrolase family 32 protein	NA	S6ATV4	Bacillus_phage	25.9	1.4e-32
WP_106912203.1|74161_75397_-	MFS transporter	NA	NA	NA	NA	NA
WP_106912204.1|75654_76650_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.3	2.3e-15
WP_106912205.1|78349_79195_-	hypothetical protein	NA	NA	NA	NA	NA
76877:76892	attR	ATCCATCCCAGAGCCA	NA	NA	NA	NA
WP_001339197.1|79191_80400_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 7
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	88911	90942	395858		Ralstonia_phage(100.0%)	1	NA	NA
WP_106912212.1|88911_90942_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.5	1.2e-31
>prophage 8
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	97189	99066	395858		Erwinia_phage(33.33%)	4	NA	NA
WP_106912216.1|97189_97525_+	hypothetical protein	NA	A0A223LJT0	Erwinia_phage	31.5	1.0e-07
WP_106912217.1|97621_98119_+	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	27.6	1.8e-08
WP_106912218.1|98141_98447_+	toxin	NA	NA	NA	NA	NA
WP_106912219.1|98568_99066_+	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	32.1	2.0e-15
>prophage 9
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	109951	110950	395858		Enterobacteria_phage(100.0%)	1	NA	NA
WP_010863215.1|109951_110950_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	26.7	6.8e-23
>prophage 10
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	114606	119295	395858		Tupanvirus(50.0%)	2	NA	NA
WP_106912233.1|114606_115638_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	47.1	4.3e-81
WP_106912234.1|116172_119295_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	51.4	1.3e-306
>prophage 11
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	134893	136027	395858		Enterobacteria_phage(100.0%)	1	NA	NA
WP_106912246.1|134893_136027_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	37.9	8.8e-19
>prophage 12
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	139418	140102	395858		Planktothrix_phage(100.0%)	1	NA	NA
WP_106912248.1|139418_140102_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	5.3e-35
>prophage 13
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	156848	159953	395858		Herpes_simplex_virus(100.0%)	1	NA	NA
WP_106912258.1|156848_159953_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	32.8	2.3e-154
>prophage 14
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	168545	175677	395858		Bacillus_phage(50.0%)	2	NA	NA
WP_106912266.1|168545_170282_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	32.1	9.3e-28
WP_106912267.1|170355_175677_-	heme peroxidase	NA	A0A1V0CNP9	Kaumoebavirus	27.0	1.2e-12
>prophage 15
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	178727	242956	395858	transposase,portal,protease,holin,tail,head,capsid,integrase,terminase,plate	Aeromonas_phage(25.0%)	72	181023:181082	234108:235437
WP_106912271.1|178727_179276_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.9	9.8e-16
WP_106912272.1|179878_180157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010863271.1|180410_180836_-	H-NS histone family protein	NA	NA	NA	NA	NA
181023:181082	attL	ACTGATGAATCCCCTAATGATTTTGGTAAAAATCATTAAGTTAAGGTGGATACACATCTT	NA	NA	NA	NA
WP_001339197.1|181130_182339_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_106912273.1|182679_183294_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_159033792.1|184421_185093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106912275.1|185240_187301_-	DUF3346 domain-containing protein	NA	NA	NA	NA	NA
WP_106912277.1|188411_188627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106912278.1|188936_190121_+	ParA family protein	NA	A0A2I6B2X3	Macacine_betaherpesvirus	29.7	9.8e-13
WP_010863280.1|190113_191193_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	32.7	1.1e-21
WP_106912279.1|191560_192829_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	29.2	2.4e-17
WP_106912280.1|193009_193579_-	lipid IV(A) palmitoyltransferase PagP	NA	NA	NA	NA	NA
WP_106912281.1|194512_194983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106912282.1|195159_195810_+	DedA family protein	NA	NA	NA	NA	NA
WP_106912283.1|195828_197127_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_106912284.1|197208_198855_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_010863287.1|199200_199905_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_047707308.1|200256_200886_+	LysE family translocator	NA	NA	NA	NA	NA
WP_106912285.1|201048_201609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106912286.1|201709_202081_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_106912287.1|202220_203249_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	K7PHK0	Enterobacteria_phage	43.3	2.6e-70
WP_039046640.1|203217_203442_-	hypothetical protein	NA	A0A1V0E5M4	Salmonella_phage	49.3	1.5e-07
WP_106912288.1|203528_203957_-	hypothetical protein	NA	A0A2H4J7V6	uncultured_Caudovirales_phage	45.3	5.7e-11
WP_159033793.1|203949_204111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106912427.1|204238_205324_-	recombinase RecT	NA	A0A0F6TJP0	Escherichia_coli_O157_typing_phage	56.7	4.0e-61
WP_106912289.1|205323_206787_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A193GYP4	Enterobacter_phage	26.4	4.0e-24
WP_106912290.1|206771_207038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156128917.1|207055_207199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106912291.1|207223_207358_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A077KB03	Edwardsiella_phage	65.0	1.7e-06
WP_106912292.1|208097_208814_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	59.2	1.5e-77
WP_010863297.1|208916_209123_+	Cro family transcriptional regulator	NA	A4KWW0	Enterobacteria_phage	65.2	1.1e-15
WP_039046637.1|209236_209533_+	hypothetical protein	NA	E5AGE8	Erwinia_phage	64.3	4.4e-31
WP_052021548.1|210052_210424_+	hypothetical protein	NA	C1JJ53	Enterobacteria_phage	69.0	6.3e-43
WP_106912293.1|210420_211116_+	DNA replication protein	NA	A0A077KCC8	Edwardsiella_phage	62.1	3.4e-66
WP_106912294.1|211135_211336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106912295.1|211819_212092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010863305.1|212287_212743_+	hypothetical protein	NA	C6ZR60	Salmonella_phage	76.8	3.4e-70
WP_106912296.1|212747_213254_+	antiterminator	NA	A0A077KC63	Edwardsiella_phage	77.1	7.5e-71
WP_010863307.1|213427_213634_+	hypothetical protein	NA	A5LH80	Enterobacteria_phage	45.2	6.9e-07
WP_106912297.1|213781_214849_+	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	69.6	1.9e-124
WP_039046631.1|214969_215290_+|holin	phage holin, lambda family	holin	A5X9I3	Aeromonas_virus	51.4	1.1e-24
WP_106912298.1|215289_215703_+	M15 family metallopeptidase	NA	W0LI70	Edwardsiella_phage	75.4	1.5e-53
WP_106912428.1|216540_217623_+	AAA family ATPase	NA	A0A125SJ49	Acidianus_tailed_spindle_virus	28.4	2.0e-12
WP_106912299.1|217619_219824_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_106912300.1|220069_220606_+	DUF2514 family protein	NA	A0A1B1W2B5	Salmonella_phage	36.5	1.3e-12
WP_010863318.1|220894_221404_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	45.5	3.7e-33
WP_106912301.1|221375_223304_+|terminase	phage terminase large subunit family protein	terminase	O64317	Escherichia_phage	77.9	7.3e-308
WP_106912302.1|223308_223512_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	72.1	3.9e-18
WP_106912303.1|223508_225101_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	73.9	9.9e-226
WP_106912304.1|225090_226359_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	62.4	1.8e-137
WP_010863323.1|226368_226695_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	54.6	2.5e-27
WP_106912305.1|226749_227775_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	72.1	2.8e-141
WP_159033794.1|227824_228181_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	36.4	7.5e-09
WP_106912307.1|228182_228575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106912308.1|228571_229132_+	hypothetical protein	NA	A0A1I9KF53	Aeromonas_phage	48.6	2.4e-41
WP_106912309.1|229124_229652_+	hypothetical protein	NA	A0A1I9KFU2	Aeromonas_phage	45.3	5.5e-40
WP_106912310.1|229620_230244_+|plate	phage baseplate assembly protein V	plate	A0A1I9KF33	Aeromonas_phage	51.0	1.6e-46
WP_010863330.1|230251_230584_+	hypothetical protein	NA	A0A1I9KF35	Aeromonas_phage	50.0	2.5e-22
WP_106912311.1|230576_231581_+|plate	baseplate J/gp47 family protein	plate	A0A1I9KG27	Aeromonas_phage	47.5	7.4e-78
WP_106912312.1|231573_232182_+	hypothetical protein	NA	A0A1I9KF84	Aeromonas_phage	42.7	4.9e-24
WP_106912313.1|232178_232841_+|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	39.7	2.6e-31
WP_001339197.1|232850_234059_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_106912314.1|234110_235097_+|tail	tail fiber protein	tail	A0A0E3GML4	Enterobacteria_phage	42.7	3.2e-25
WP_159033795.1|235107_235539_+|tail	tail fiber assembly protein	tail	A5X9J5	Aeromonas_virus	43.3	2.5e-22
234108:235437	attR	AAGATGTGTATCCACCTTAACTTAATGATTTTTACCAAAATCATTAGGGGATTCATCAGTGCTAAGCGTGGTTTGGTTCAATTGTCGAATGCAACGAATAGCGCTAGTGAGTCGACTGCAGCAACCTCAAAAGCCGTAAAAACCGCGTATGATTTGGCCGCAGGGAAATACACGGCAGAGAATGCCACCACAAGTAAGCGTGGTTTGGTTCAGCTGAGTAGTGCGACAGATAGTACGTCAGAGACGCTAGCCGCAACACCGAAGGCGGTGAAGACTGTTCATGATTTGGCGGCAAGCAAAGCGCCAGTGAATAGCCCGGCGTTAACGGGACACCCTACAGCGCCTACTCCCGTAGATTCAGCTGTGGGACAGGAGATTGCTACGGCAGCTTTTGTGGTCGCGAAAATTGCAAAGTTGGTGAATTCATCGCCTGCCGCCTTGGACACGCTACAAGAATTGGCAGCGGCTCTCGGCAATGATCCGAATTTTTCGGCCACCGTGATGAATCTCATTGGGCAGAAATTAAGTAAAGACCAGAATGGTGCAGACATCCCTGACAAACAACGTTTTATCGATAACCTTGGTTTACGAGATGCAGTAAATAAGGCCAACGCCGCGTTACAAAAAAATCAAAATGGTGCGGATATTCCTAATAAACCCCTTTTTATCGACAATCTTGGATTACGAGATACGGTGAATAAAGCCAATGCGGTTTATTCGCATACGCATACTGCGGCTCAGGGGAATCACGATGTTATTTCGGGTGCATGGAATGCTGTGGGCGCTACAGTCTTTGCCCGTGTTGGATCAAGGCGAGGTGAGTCTTTTGCGCCTGGAGTGCGCGTTGATGGAGTTAGATTATATCCAGCTAACGCGGGGCAGGCGCAATGGGGATCTCTGCCGGGAACATGGCAGTGCCAAGGATGCATCCCATCACAAGCAGATCATAGCACTAGTGATGTGTGTACAGCGTGGATTCGAGTGGCATAAGGAGACGTTTGTGGAGATTGAAATCTTATCGGCACATTCCCCTGTTTGGGCTAATAGTGAAAAGACCGCTGTTTCATTGATGGCTCGTTTTAGTCACTTATCGGATAGTGAAGTCCCTTTTACTGCATCCTCTGATGATCCCGCTGAACATGGTCGAGAATTGTATGTGCGTGCTGTGTTCGGTGATTTTGGTGCGATCGGGGAGTTTGTTGCTGAGCCGGTGTGTGAGGCTGATTTATTGGCTGAGTTAGATGGTCGATTGAAGCAGGCCGCGCTTACTATGGCACCTTTAGAGGATGCAGAGAAGCTAGGAGTGATAAATGAGTCAGAGCGGACTTTA	NA	NA	NA	NA
WP_115149361.1|235598_235784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106912316.1|235776_237225_+|tail	phage tail protein	tail	A0A1I9KF34	Aeromonas_phage	60.2	1.5e-156
WP_010863337.1|237224_237716_+|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_106912317.1|237793_238432_+	hypothetical protein	NA	A0A1I9KFV2	Aeromonas_phage	36.0	6.0e-25
WP_106912318.1|238481_241343_+|tail	phage tail tape measure protein	tail	A0A1I9KF40	Aeromonas_phage	42.7	5.9e-128
WP_106912319.1|241342_241774_+|tail	phage tail protein	tail	A0A1I9KF41	Aeromonas_phage	48.1	5.3e-33
WP_010863341.1|241745_241955_+|tail	tail protein X	tail	A0A1I9KG34	Aeromonas_phage	47.0	2.8e-08
WP_106912320.1|241945_242956_+|tail	phage tail protein	tail	A0A1I9KF94	Aeromonas_phage	70.1	5.1e-135
>prophage 16
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	250337	252014	395858		Hokovirus(100.0%)	1	NA	NA
WP_106912326.1|250337_252014_+	LruC domain-containing protein	NA	A0A1V0SGG5	Hokovirus	31.2	2.0e-19
>prophage 17
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	256177	257803	395858		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_106912330.1|256177_257803_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.6	4.1e-25
>prophage 18
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	263347	267980	395858		Rhodococcus_phage(50.0%)	5	NA	NA
WP_106912334.1|263347_264517_-	ADP-ribosylglycohydrolase family protein	NA	A0A2D0ZND4	Rhodococcus_phage	28.1	1.9e-16
WP_159033797.1|264641_264812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106912335.1|264841_265231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106912336.1|265342_266572_-	FUSC family protein	NA	NA	NA	NA	NA
WP_106912337.1|266756_267980_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	5.5e-51
>prophage 19
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	271409	272663	395858		Orpheovirus(100.0%)	1	NA	NA
WP_106912341.1|271409_272663_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	31.4	3.2e-38
>prophage 20
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	288837	295811	395858		Leptospira_phage(50.0%)	4	NA	NA
WP_106912351.1|288837_291951_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	5.7e-52
WP_106912430.1|291950_293057_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_106912352.1|293498_294131_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039044974.1|294332_295811_-	catalase	NA	A0A2K9L0T1	Tupanvirus	45.6	4.7e-97
>prophage 21
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	349021	350677	395858		Enterobacteria_phage(100.0%)	1	NA	NA
WP_047707589.1|349021_350677_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.4	4.4e-51
>prophage 22
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	360962	363461	395858		Diadromus_pulchellus_ascovirus(50.0%)	3	NA	NA
WP_106912385.1|360962_361820_+	MBL fold metallo-hydrolase	NA	F2NZ47	Diadromus_pulchellus_ascovirus	26.6	1.3e-19
WP_106912434.1|361902_362565_+	protein-disulfide isomerase	NA	NA	NA	NA	NA
WP_106912386.1|362702_363461_-	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	30.3	3.2e-17
>prophage 23
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	377281	381249	395858		Brazilian_cedratvirus(50.0%)	2	NA	NA
WP_084976745.1|377281_378538_+	adenylosuccinate synthetase	NA	A0A2R8FF47	Brazilian_cedratvirus	31.9	9.4e-46
WP_159033804.1|379029_381249_-	response regulator	NA	A0A1V0SGX0	Hokovirus	37.5	5.5e-57
>prophage 24
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	384528	385635	395858	integrase	Enterobacteria_phage(100.0%)	1	373575:373588	386566:386579
373575:373588	attL	AAAAGATGAATAAT	NA	NA	NA	NA
WP_106912404.1|384528_385635_-|integrase	tyrosine-type recombinase/integrase	integrase	Q5XLQ5	Enterobacteria_phage	28.2	3.8e-27
WP_106912404.1|384528_385635_-|integrase	tyrosine-type recombinase/integrase	integrase	Q5XLQ5	Enterobacteria_phage	28.2	3.8e-27
386566:386579	attR	AAAAGATGAATAAT	NA	NA	NA	NA
>prophage 25
NZ_CP027853	Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence	395858	389796	394285	395858	transposase	Bluetongue_virus(50.0%)	4	NA	NA
WP_001339197.1|389796_391005_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_159033805.1|391111_392125_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_159033806.1|392512_393007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106912411.1|393112_394285_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	45.9	2.2e-09
