The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020093	Lactiplantibacillus plantarum strain K25 chromosome, complete genome	3175846	37638	54825	3175846	head,capsid,portal,tail,terminase,integrase	Staphylococcus_phage(27.27%)	20	37079:37093	44061:44075
37079:37093	attL	ACAACCAACTAAATA	NA	NA	NA	NA
WP_003643617.1|37638_38793_-|integrase	site-specific integrase	integrase	A0A172LN96	Lactococcus_phage	36.7	8.0e-60
WP_106904619.1|38850_39537_-	helix-turn-helix transcriptional regulator	NA	Q20DG0	Lactobacillus_phage	56.5	3.5e-10
WP_142262895.1|39668_39851_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_106904622.1|40131_40350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106904623.1|40346_41147_+	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_106904624.1|41146_42541_+	virulence protein	NA	A0A0A7RTG3	Clostridium_phage	34.1	1.9e-68
WP_106904625.1|42683_43163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062690059.1|43177_43369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106904626.1|43355_43694_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	34.7	7.9e-08
WP_027822995.1|43686_44076_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	45.2	3.0e-19
44061:44075	attR	ACAACCAACTAAATA	NA	NA	NA	NA
WP_106904627.1|45075_45549_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_106904628.1|45545_47249_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.3	1.2e-120
WP_033611503.1|47202_47403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106904629.1|47403_48510_+|portal	phage portal protein	portal	H9A113	Staphylococcus_phage	34.3	3.6e-49
WP_106904630.1|48499_50074_+|capsid	phage major capsid protein	capsid	A0A1J0MFW8	Staphylococcus_phage	35.0	1.9e-40
WP_106904631.1|50188_50458_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_187346305.1|50616_50985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643340.1|51108_51309_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	1.4e-20
WP_003637294.1|52229_52937_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.1	2.9e-44
WP_003641656.1|52950_54825_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.8	5.5e-34
>prophage 2
NZ_CP020093	Lactiplantibacillus plantarum strain K25 chromosome, complete genome	3175846	348708	445733	3175846	bacteriocin,protease,tRNA,transposase	Bacillus_virus(15.38%)	87	NA	NA
WP_063724637.1|348708_349272_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_024002428.1|349465_350134_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_069137177.1|350291_351797_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003643763.1|352060_352429_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|352540_353050_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_106904652.1|353080_354277_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003646440.1|354386_354857_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_063724644.1|354875_355331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063724645.1|355434_355992_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_063724646.1|356145_357066_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_069137175.1|357202_358114_+	oxidoreductase	NA	NA	NA	NA	NA
WP_063724647.1|358849_359296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069137174.1|359533_361060_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_054397376.1|361060_362032_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_063731276.1|362109_363441_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_063731274.1|363904_365422_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003643774.1|365436_367266_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_074029678.1|367280_368003_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	5.4e-30
WP_097558290.1|368083_368882_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_015379760.1|369078_369696_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003646460.1|369699_370854_-	MFS transporter	NA	NA	NA	NA	NA
WP_069137171.1|370857_371649_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_069137170.1|371719_372592_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_106904653.1|374093_375470_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_011100995.1|375514_376699_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_027821506.1|377262_377442_+|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_069137167.1|378383_379052_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_046947768.1|380312_380459_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_069137166.1|380649_381978_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_106904654.1|381978_382722_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_069137165.1|382840_383584_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_021356666.1|383888_384662_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003643811.1|384760_384919_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_003641985.1|384943_385114_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_015825125.1|385380_387531_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	6.1e-45
WP_069137164.1|387546_388923_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_069137163.1|389012_389702_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_069137162.1|389768_390437_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_065080250.1|390523_391204_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_069137161.1|391297_391984_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_060684281.1|392121_392325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106904655.1|392419_394729_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_069137158.1|394983_395760_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_003643815.1|396199_397216_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_069137157.1|397563_399525_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_069137156.1|399597_401088_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_106904656.1|401089_402028_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_069137155.1|401999_403133_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.4	1.2e-15
WP_069137154.1|403113_404055_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	4.6e-21
WP_003641997.1|404551_405262_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641998.1|405334_406696_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641999.1|406702_406891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642000.1|406880_407303_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003643816.1|407525_408881_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_106904658.1|408898_410335_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	1.3e-30
WP_106904659.1|410455_411352_+	ROK family protein	NA	NA	NA	NA	NA
WP_003642004.1|411501_412248_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027822753.1|412360_413374_+|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_011101010.1|413816_414734_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_003642009.1|414779_416054_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003642010.1|416046_417006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106904660.1|417027_417732_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_003642012.1|417731_418574_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_003646492.1|419170_419560_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003643823.1|419881_421933_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
WP_063723567.1|422165_423350_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_069137150.1|423472_424249_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_063723569.1|424235_424799_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_069137149.1|424795_425686_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003642020.1|425790_426042_+	Veg family protein	NA	NA	NA	NA	NA
WP_045352037.1|426174_427041_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_021356652.1|427350_428295_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003642023.1|428561_429260_+	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.8	1.2e-15
WP_063723574.1|429252_430050_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_069137148.1|430405_431242_+	pur operon repressor	NA	NA	NA	NA	NA
WP_054397557.1|431310_432693_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	32.8	1.3e-27
WP_069137383.1|432919_433744_+	serine hydrolase	NA	NA	NA	NA	NA
WP_003643830.1|434097_435078_+	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.3	4.9e-42
WP_054397559.1|435365_436388_+	YdcF family protein	NA	NA	NA	NA	NA
WP_054397561.1|436470_437457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063731239.1|437622_438432_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_187346309.1|438451_439810_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.9	2.3e-26
WP_069137146.1|439818_440751_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_069137145.1|441115_441556_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003642041.1|441600_442209_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003642042.1|442381_443995_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	1.2e-143
WP_054397570.1|444461_445733_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.7	3.4e-96
>prophage 3
NZ_CP020093	Lactiplantibacillus plantarum strain K25 chromosome, complete genome	3175846	553973	616018	3175846	holin,protease,capsid,portal,tail,tRNA,plate,integrase	Lactobacillus_phage(44.44%)	65	568661:568677	594916:594932
WP_003640924.1|553973_554666_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003643927.1|554855_556187_-	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.3	5.4e-68
WP_003640926.1|556261_556945_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_027821468.1|556953_557250_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003640928.1|557388_557925_+	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	45.8	2.4e-35
WP_003643928.1|559050_560430_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003640931.1|560445_561621_+	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_003640932.1|561946_563437_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013355229.1|563714_565127_+|tRNA	cysteine--tRNA ligase	tRNA	F1C979	Terra1_virus	27.7	1.5e-44
WP_003640934.1|565128_565539_+	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_050482337.1|565510_566296_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_003640936.1|566297_566843_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_003640938.1|567349_567952_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003637768.1|568013_568163_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003640939.1|568174_568360_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003643932.1|568464_569013_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
568661:568677	attL	CTGGTTACGTTTTGGTT	NA	NA	NA	NA
WP_003640941.1|569040_569928_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003640942.1|570029_570455_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_003640943.1|570555_571245_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_003643933.1|571443_571947_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003637775.1|572008_572377_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_106904664.1|572528_573731_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A126GGK4	Streptococcus_phage	29.2	9.9e-37
WP_106904665.1|573829_574627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106904666.1|574644_574887_+	2-hydroxymuconic semialdehyde hydrolase	NA	U5U783	Lactobacillus_phage	40.0	4.5e-05
WP_106904667.1|575256_575448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106904668.1|575430_576360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106904669.1|576380_577223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106904670.1|577327_577750_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_064971993.1|577764_578268_-	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	41.4	3.8e-22
WP_060417532.1|578413_578668_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061468338.1|578664_578865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106904671.1|578861_579083_-	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	66.2	5.0e-19
WP_063488540.1|579161_579344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106904672.1|579404_579959_+	hypothetical protein	NA	O03909	Lactobacillus_phage	96.2	6.9e-94
WP_164971152.1|580361_580508_+	hypothetical protein	NA	E9LUT9	Lactobacillus_phage	89.4	3.4e-16
WP_106904674.1|580761_581148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106904675.1|581144_582044_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	48.0	9.3e-64
WP_056953070.1|586215_586527_+	hypothetical protein	NA	A0A2P0ZLB4	Lactobacillus_phage	90.3	7.2e-48
WP_106904678.1|588536_588845_+	DUF2829 domain-containing protein	NA	A0A0K2FLC4	Brevibacillus_phage	43.2	2.4e-11
WP_157949625.1|590701_592297_+|portal	phage portal protein	portal	B5LPR1	Bacillus_virus	37.5	4.5e-85
WP_157949626.1|592289_593375_+	hypothetical protein	NA	A0A059T7W2	Listeria_phage	31.3	2.8e-38
WP_106904681.1|593438_594041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106904682.1|594054_595002_+|capsid	N4-gp56 family major capsid protein	capsid	A8ASJ6	Listeria_phage	59.5	3.0e-89
594916:594932	attR	AACCAAAACGTAACCAG	NA	NA	NA	NA
WP_187346306.1|595090_595351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106904683.1|595361_595766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106904684.1|595766_596156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064522761.1|596152_596554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157949627.1|596553_596979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106904686.1|596996_597614_+	hypothetical protein	NA	A0A2I7QIP9	Bacillus_phage	31.8	1.0e-05
WP_106904687.1|597732_598251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106904688.1|598247_598889_+	hypothetical protein	NA	U3PFU8	Lactobacillus_phage	28.9	7.4e-07
WP_106904689.1|598904_604544_+|tail	phage tail tape measure protein	tail	A0A1S5SFC1	Streptococcus_phage	26.1	5.3e-24
WP_106904690.1|604544_605192_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_106904691.1|605373_606501_+|tail	phage tail protein	tail	O03938	Lactobacillus_phage	42.3	3.1e-72
WP_047673688.1|606493_606715_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_106904850.1|607074_607776_+	SGNH/GDSL hydrolase family protein	NA	Q8LTH0	Staphylococcus_virus	53.5	5.9e-58
WP_106904692.1|607787_608447_+|plate	phage baseplate upper protein	plate	Q4ZE15	Staphylococcus_virus	53.8	1.1e-40
WP_106904693.1|608464_609229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106904694.1|609233_609545_+	DUF2977 domain-containing protein	NA	NA	NA	NA	NA
WP_106904695.1|609544_609691_+	XkdX family protein	NA	U5U4L4	Lactobacillus_phage	56.8	6.0e-05
WP_106904696.1|609705_612471_+	SGNH/GDSL hydrolase family protein	NA	A0A1I9KKB6	Lactobacillus_phage	53.1	1.6e-34
WP_106904697.1|612748_613912_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	86.2	1.2e-191
WP_106904698.1|613912_614209_+	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	75.5	3.8e-38
WP_106904699.1|614195_614558_+|holin	holin	holin	A0A2P0ZLG6	Lactobacillus_phage	80.9	7.9e-14
WP_106904700.1|614683_616018_-	Fic family protein	NA	Q9AZ49	Lactococcus_phage	29.5	3.8e-45
>prophage 4
NZ_CP020093	Lactiplantibacillus plantarum strain K25 chromosome, complete genome	3175846	627696	636321	3175846		Streptococcus_phage(66.67%)	11	NA	NA
WP_106904701.1|627696_629394_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
WP_003640956.1|629415_629724_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003637790.1|629739_630339_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640957.1|630353_630605_+	YaaL family protein	NA	NA	NA	NA	NA
WP_003644908.1|631003_631669_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640965.1|631665_631995_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_106904702.1|632011_633031_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.9	9.6e-33
WP_003640967.1|633055_633403_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_053338711.1|633501_634398_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	1.7e-81
WP_069137131.1|634401_635187_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_053338713.1|635325_636321_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.9	1.0e-50
>prophage 5
NZ_CP020093	Lactiplantibacillus plantarum strain K25 chromosome, complete genome	3175846	1752233	1837935	3175846	head,holin,protease,tail,portal,integrase,tRNA,terminase,transposase	Lactobacillus_phage(73.47%)	94	1777816:1777833	1844869:1844886
WP_027821256.1|1752233_1753157_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_027821257.1|1753641_1754163_-	shikimate kinase	NA	NA	NA	NA	NA
WP_015825650.1|1754165_1755263_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_015825651.1|1755265_1756564_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027821258.1|1756577_1757105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355607.1|1757113_1758283_-	chorismate synthase	NA	NA	NA	NA	NA
WP_003645963.1|1758275_1759730_-	MFS transporter	NA	NA	NA	NA	NA
WP_003640723.1|1760378_1760732_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_003645962.1|1760754_1763331_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.3	9.6e-21
WP_003640725.1|1763345_1763651_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_003640726.1|1763640_1763940_-	YlxR family protein	NA	NA	NA	NA	NA
WP_003640727.1|1763984_1765202_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003640728.1|1765222_1765699_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003640729.1|1765994_1770308_-	DNA polymerase III subunit alpha	NA	A0A1X9SH08	Bradyrhizobium_phage	34.0	1.0e-14
WP_069137039.1|1770801_1772511_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003640733.1|1772550_1773828_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003640734.1|1773865_1774651_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003640735.1|1774666_1775446_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.1	1.1e-23
WP_003640736.1|1775565_1776129_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003640737.1|1776130_1776853_-	UMP kinase	NA	NA	NA	NA	NA
WP_003644498.1|1777053_1777932_-	elongation factor Ts	NA	NA	NA	NA	NA
1777816:1777833	attL	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
WP_003640739.1|1778034_1778838_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003640740.1|1779062_1779785_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_069137038.1|1780179_1781859_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	4.7e-93
WP_003640741.1|1781845_1782844_-	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
WP_003640742.1|1782928_1783234_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003644499.1|1783217_1783976_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003645630.1|1784087_1784723_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003640745.1|1784779_1785016_-	YneF family protein	NA	NA	NA	NA	NA
WP_003644501.1|1785113_1785353_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003640747.1|1785504_1786137_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	56.2	2.3e-16
WP_089178220.1|1786226_1786457_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_069137037.1|1786760_1787390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053338919.1|1787439_1788609_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_106904759.1|1788644_1789037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644503.1|1789200_1789593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053338920.1|1790038_1790980_+	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	49.0	5.3e-78
WP_003645636.1|1791731_1792304_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003644505.1|1792455_1793640_-	LCP family protein	NA	NA	NA	NA	NA
WP_053338923.1|1793620_1794412_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	4.5e-30
WP_003644508.1|1796650_1797862_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_069137036.1|1799105_1799483_-|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	70.0	2.1e-17
WP_069137035.1|1799469_1799766_-	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	76.5	7.6e-39
WP_069137375.1|1799766_1800882_-	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	65.7	1.9e-45
WP_106904760.1|1800944_1801190_-	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	67.9	3.9e-17
WP_106904761.1|1801179_1802214_-	hypothetical protein	NA	A0A2P0ZLF6	Lactobacillus_phage	87.8	9.1e-63
WP_187337693.1|1802197_1802359_-	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	96.2	8.0e-19
WP_069137033.1|1802362_1802614_-	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	95.8	9.3e-30
WP_069137032.1|1802606_1805372_-	hypothetical protein	NA	A0A2P0ZL34	Lactobacillus_phage	50.1	3.5e-194
WP_069137031.1|1805364_1807743_-|tail	phage tail protein	tail	E9LUR3	Lactobacillus_phage	89.8	0.0e+00
WP_106904762.1|1807809_1809579_-|tail	phage tail family protein	tail	E9LUR2	Lactobacillus_phage	91.7	0.0e+00
WP_106904763.1|1809652_1814131_-	C40 family peptidase	NA	A0A2P0ZLG0	Lactobacillus_phage	74.5	0.0e+00
WP_069137028.1|1814162_1814348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063488422.1|1814392_1814767_-|tail	phage tail assembly chaperone	tail	A0A2P0ZLH4	Lactobacillus_phage	94.4	4.6e-57
WP_106904764.1|1814842_1815484_-|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	88.0	2.7e-105
WP_069137026.1|1815499_1815880_-	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	88.9	3.2e-58
WP_069137025.1|1815879_1816287_-	HK97 gp10 family phage protein	NA	A0A2P0ZLE6	Lactobacillus_phage	87.1	3.3e-61
WP_069137024.1|1816289_1816637_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	93.0	4.0e-55
WP_069137021.1|1818394_1819000_-|head,protease	HK97 family phage prohead protease	head,protease	B8R651	Lactobacillus_phage	49.1	1.1e-39
WP_069137373.1|1818971_1820090_-|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	40.6	5.0e-67
WP_187346303.1|1820125_1820299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106904766.1|1820328_1822245_-|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	41.1	1.4e-133
WP_080475539.1|1822231_1822666_-|terminase	phage terminase small subunit P27 family	terminase	B8R648	Lactobacillus_phage	37.7	1.8e-17
WP_069137019.1|1822856_1823525_-	HNH endonuclease	NA	B8R694	Lactobacillus_phage	39.0	1.7e-22
WP_080475538.1|1824138_1824309_-	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	91.1	2.9e-19
WP_106904852.1|1824305_1824773_-	DUF1642 domain-containing protein	NA	A0A2P0ZLB8	Lactobacillus_phage	55.2	8.6e-37
WP_069137018.1|1824772_1825138_-	hypothetical protein	NA	A0A291I9N7	Lactobacillus_phage	69.3	4.0e-42
WP_080475537.1|1825134_1825548_-	hypothetical protein	NA	O03921	Lactobacillus_phage	61.9	1.7e-36
WP_187337692.1|1825563_1825722_-	hypothetical protein	NA	O03920	Lactobacillus_phage	96.2	8.4e-21
WP_106904767.1|1825724_1825883_-	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	92.3	3.3e-17
WP_063722553.1|1825875_1826184_-	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	93.1	1.2e-47
WP_069137017.1|1826319_1827105_-	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	90.8	7.0e-132
WP_069137016.1|1827104_1827848_-	replisome organizer	NA	E9LUM6	Lactobacillus_phage	57.3	2.7e-40
WP_069137015.1|1827949_1828207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187337691.1|1828206_1828377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187337690.1|1828379_1828544_-	hypothetical protein	NA	E9LUT8	Lactobacillus_phage	78.8	4.2e-15
WP_003641371.1|1828555_1828756_-	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	89.4	1.0e-26
WP_003641370.1|1828758_1829007_-	hypothetical protein	NA	E9LUT6	Lactobacillus_phage	76.1	2.7e-29
WP_003641369.1|1829019_1829223_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003641368.1|1829388_1829679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641367.1|1830272_1830533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025015699.1|1830590_1830812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069137014.1|1830827_1831055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069137013.1|1831067_1831277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069137012.1|1831288_1831996_-	Rha family transcriptional regulator	NA	D2IYT0	Enterococcus_phage	58.6	3.6e-63
WP_069137011.1|1832011_1832215_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069137010.1|1832471_1832891_+	helix-turn-helix transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	47.9	7.0e-30
WP_069137009.1|1832902_1833340_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1C8E988	Bacillus_phage	30.6	4.9e-10
WP_069137008.1|1833397_1834147_+	potassium channel family protein	NA	A0A1B0Y2S3	Lactobacillus_phage	53.9	9.2e-41
WP_069137007.1|1834149_1834392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069137006.1|1834518_1834701_+	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	66.7	6.7e-14
WP_003641358.1|1834892_1835093_+	hypothetical protein	NA	E9LUS6	Lactobacillus_phage	100.0	4.9e-26
WP_069137005.1|1835485_1836472_+	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	52.0	9.5e-86
WP_069137004.1|1836771_1837935_+|integrase	site-specific integrase	integrase	O64373	Lactobacillus_phage	34.3	3.9e-54
1844869:1844886	attR	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
>prophage 6
NZ_CP020093	Lactiplantibacillus plantarum strain K25 chromosome, complete genome	3175846	2132571	2145514	3175846	head,capsid,portal,tail,terminase,integrase	Lactobacillus_phage(25.0%)	16	2131545:2131566	2145691:2145712
2131545:2131566	attL	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
WP_027823052.1|2132571_2132841_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_106904777.1|2133250_2134792_-|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	26.2	8.8e-46
WP_057705764.1|2134788_2135889_-|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	34.0	8.8e-48
WP_072535853.1|2135889_2136090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069137355.1|2136043_2137747_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.3	1.4e-121
WP_106904778.1|2137743_2138217_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_069137353.1|2139183_2139573_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	45.2	1.0e-19
WP_069137352.1|2139565_2139904_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	34.7	1.3e-07
WP_064578496.1|2139913_2140099_-	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_069137351.1|2140122_2140542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069137350.1|2140686_2142081_-	virulence protein	NA	Q4ZD27	Staphylococcus_phage	36.1	1.6e-70
WP_069137349.1|2142080_2142881_-	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_069137348.1|2142894_2143125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016511388.1|2143393_2143573_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069137347.1|2143731_2144298_+	helix-turn-helix transcriptional regulator	NA	A0A1P8BMN9	Lactococcus_phage	50.0	5.9e-08
WP_069137346.1|2144356_2145514_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	35.1	1.0e-54
2145691:2145712	attR	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
>prophage 7
NZ_CP020093	Lactiplantibacillus plantarum strain K25 chromosome, complete genome	3175846	2341325	2349836	3175846		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645867.1|2341325_2341904_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
WP_069137327.1|2341896_2342922_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.3	2.1e-59
WP_003642591.1|2342918_2344373_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_069137326.1|2344357_2346577_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.1	2.7e-144
WP_011101895.1|2346569_2347250_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642588.1|2347249_2347504_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_021356104.1|2347505_2348237_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	2.1e-37
WP_053339078.1|2348239_2349370_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003645861.1|2349353_2349836_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
>prophage 1
NZ_CP020096	Lactiplantibacillus plantarum strain K25 plasmid unnamed3, complete sequence	47145	23649	30557	47145	transposase	Escherichia_phage(28.57%)	7	NA	NA
WP_106904898.1|23649_24579_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	28.3	2.2e-23
WP_060678065.1|24645_25515_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	60.5	1.0e-99
WP_060416961.1|25518_26100_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	45.3	1.6e-37
WP_027822971.1|26109_27138_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	45.1	4.0e-71
WP_106904899.1|27170_28007_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.4	6.0e-33
WP_106904900.1|28338_29268_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	29.1	5.7e-24
WP_060463334.1|29750_30557_+	ParA family protein	NA	A0A1V0DZZ0	Clostridioides_phage	30.5	6.0e-22
