The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027506	Enterococcus faecium strain AUSMDU00004055 chromosome, complete genome	2731844	111611	151885	2731844	tRNA,transposase	Lysinibacillus_phage(20.0%)	39	NA	NA
WP_002287909.1|111611_111908_-|tRNA	phenylalanyl-tRNA synthetase subunit alpha	tRNA	NA	NA	NA	NA
WP_002287910.1|112262_112619_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002287911.1|112628_113528_+	phosphohydrolase	NA	NA	NA	NA	NA
WP_002297218.1|113652_114948_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_106914053.1|115418_116597_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002296745.1|116912_117644_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_002287913.1|117788_119816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311353.1|119923_121021_+	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_106914054.1|121327_121774_+	M protein trans-acting positive regulator	NA	NA	NA	NA	NA
WP_002297185.1|121928_123224_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_000997695.1|123404_124583_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002326835.1|124707_125664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000222572.1|125717_126671_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002290500.1|126823_127558_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.4	1.4e-25
WP_002297153.1|127884_128295_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002294273.1|128287_128989_+	LrgB family protein	NA	NA	NA	NA	NA
WP_002321200.1|128988_130575_+	M protein trans-acting positive regulator	NA	NA	NA	NA	NA
WP_002290506.1|130593_130815_+	DUF2829 domain-containing protein	NA	A0A0S2MV93	Bacillus_phage	33.3	1.1e-05
WP_002297149.1|130811_131573_+	3-oxoacyl-ACP reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.7	5.5e-17
WP_002297147.1|131952_132462_+	QueT transporter family protein	NA	NA	NA	NA	NA
WP_002297145.1|132536_133076_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_002294265.1|133215_133827_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_002304049.1|134142_134940_+	formate/nitrite transporter	NA	NA	NA	NA	NA
WP_002297142.1|134967_135603_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_002294261.1|135622_136396_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002297139.1|136803_137601_+	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_002297137.1|137578_137992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297135.1|137975_140621_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	26.1	3.6e-39
WP_002297134.1|140638_142747_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.1	1.8e-57
WP_002294256.1|142768_143329_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002297133.1|143413_145402_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_002294254.1|145624_146338_+	trehalose operon repressor	NA	A0A291LID1	Streptomyces_phage	39.7	1.2e-05
WP_002294252.1|146414_146861_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002290528.1|147030_147633_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002289812.1|147645_148647_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.8	2.3e-07
WP_002289813.1|148675_149254_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289814.1|149305_149788_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_002289815.1|149904_150279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302440.1|150583_151885_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
>prophage 2
NZ_CP027506	Enterococcus faecium strain AUSMDU00004055 chromosome, complete genome	2731844	628003	689349	2731844	tRNA,transposase,integrase	Streptococcus_phage(14.29%)	60	651220:651279	691949:693463
WP_002296127.1|628003_629551_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002287659.1|629652_630006_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002285758.1|629995_630190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312143.1|631360_632134_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002316458.1|632130_633036_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.4	4.0e-38
WP_002314616.1|633196_633517_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_002287225.1|634049_635009_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	7.5e-11
WP_002287083.1|635054_635741_+	DUF969 domain-containing protein	NA	NA	NA	NA	NA
WP_002287082.1|635742_636687_+	DUF979 domain-containing protein	NA	NA	NA	NA	NA
WP_002287081.1|636885_637530_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_049052109.1|637608_638703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154080538.1|638718_638886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106914060.1|639069_639819_-	nicotinamide mononucleotide transporter	NA	A0A2H4PB74	Lactobacillus_phage	70.3	5.7e-91
WP_002287076.1|640148_640529_+	VOC family protein	NA	NA	NA	NA	NA
WP_002287075.1|640624_641134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291570.1|641210_641390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002293816.1|641444_642008_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002287073.1|642054_642570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287072.1|642595_643465_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002287070.1|643590_644271_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	43.3	7.3e-45
WP_002287068.1|644423_645404_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_002287066.1|645526_646000_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_002287063.1|645992_646517_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002291442.1|647006_647540_-	exonuclease	NA	A0A1S5SFA9	Streptococcus_phage	43.4	5.9e-26
WP_002297274.1|648403_649156_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	47.1	2.9e-58
WP_002287059.1|649268_650189_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002287058.1|650261_651197_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
651220:651279	attL	GGGCTCTTTGTCAATAAGGACTGATGAGTTGTGCAAAATCAAATCTGAGTCAGAATGAAC	NA	NA	NA	NA
WP_002297218.1|651302_652598_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002287057.1|653016_654495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287056.1|654771_656832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287055.1|656914_657484_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002287053.1|657658_658465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287048.1|660518_661502_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_002296930.1|661506_662154_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002287046.1|662238_662871_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_002287045.1|662886_663438_-	phosphopantothenoylcysteine decarboxylase	NA	A0A1V0S7W6	Shearwaterpox_virus	41.2	3.2e-30
WP_002287044.1|663434_664172_-	phosphopantothenate--cysteine ligase	NA	NA	NA	NA	NA
WP_002287041.1|664168_665158_-	oxidoreductase	NA	NA	NA	NA	NA
WP_002287040.1|665415_665958_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002287039.1|665974_667060_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	45.0	4.0e-37
WP_002287038.1|667071_667878_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	27.6	7.9e-14
WP_002287036.1|667878_668706_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287033.1|668702_669776_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002304269.1|670203_672900_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002287029.1|672976_673465_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287026.1|673476_673971_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002287024.1|673991_674801_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002287022.1|674797_675619_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002287021.1|675669_677769_+	glycoside hydrolase	NA	NA	NA	NA	NA
WP_002287020.1|677765_678884_+	DUF2961 domain-containing protein	NA	NA	NA	NA	NA
WP_002304270.1|678922_679801_+	ROK family protein	NA	NA	NA	NA	NA
WP_157734026.1|679991_680144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106914061.1|681085_682360_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002287017.1|682688_683501_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002305412.1|683663_683771_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002320736.1|683828_684896_+	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	28.9	3.6e-38
WP_002296936.1|685037_685241_+	DUF3173 family protein	NA	NA	NA	NA	NA
WP_002287015.1|685300_686503_+|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	28.5	1.1e-32
WP_002287014.1|687151_688282_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	45.3	6.0e-84
WP_000222572.1|688395_689349_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
691949:693463	attR	GGGCTCTTTGTCAATAAGGACTGATGAGTTGTGCAAAATCAAATCTGAGTCAGAATGAACCACATTCTGGCTCAGATTTTTTGTTATCTTACATTGATTAATTGATTGATCAAAAAGATTCTAATTCTCATGTTCTCAAATGATTTAAATCCGTAGGATACTCGTTTCATTGTCTTTATGTGGGTATTCTTCGCTTCTATTTTTCCATTGGAATAAGGATAGATCATTGCGTTGGTGATGCCTTCTTCATAGGTCAGAAGGTTTTGAAGCTTTTCCCGAAAGCTGTCATCTAACGTTTCGGGAAGTTCTGCCAATAAGGAGAAAAATAAGTCAGGGTCTTTGTCTCGAAAGGCTTCAACTAATTCATGAAAAAAGGGATACGCCTCCTTTAGGGGCGGAGAAAACTCAAGCAATCGATCAATCATCATTGCTTCAGTAAGAAATGGGTATTTTGGTGCTCGGAAACTTTTCCATGTTTTGTATTCATAATGGTTGATGTTTGCACGATTTTTTAGCAAAAAGCGCCAGTTCTTTTTCAGTTTTTCTGCCTGGCTTTTCTGTCCGGCTTTACGAAGTTCATTCATTTCACGGATACGCAACTCATTGAACGCTTGATTCATGTGTTTGACAATATGAAACCGATCAATCACGACTTTCGCATTTGGCAGAACACGTTTGGTGAGCTGGAAGTAGGCGGCGTTCATGTCTGTCACCAAGAATTCTACTTCTTCTGGATTGGTACAACCTAAGAAATAGCTTGTTAATCGAGGTAATTTACGCGTAGGCAAAACATCTATTAATTTTCCTGTTTCGCCATCCGCGCAAATAAAGCTCATCTTATCTTCTATGGAAGCATGCGAACGAAATTCGTCAACCATCAATACTCTGGGGAGGATCTTCTTAGATTGCTTTGGTAAATAGCTTTTAAACTCTTTCAATGTACGAATAACGGTGGTCAAAGATACCTGACAGCTTTTCGCAATAAAAGATAAAGATACTTTTTCAGTCAGTAAAGAAGCAATTTTATATCTAACATGATTTGCGATTGAATGTCTGGGTTGGACAAAATAACTTTGAGCCGTCCAATGGGTGCGACAGTTTTTACAGGTATAGCGTTGCTTTTTTAGGCGCATAACCAAAGGCATATGATTGTATTGTTCAAAACGGACAATCGTTTCCTTTTTTCCATTTTTCACTATAATTGCTTTCCCGTTTCCATCTACCACAGTAGAACCACAACTTCTACAAGCACGAGGAGTAGGCGAGAGAACAGCATCGACGACCAACGTCTTTTTCTTCTGAAGGGTCTCGTAAGAGACCTCTGTAATCATCAAATCTTTCTCTGTTATTCTCAGCATTTTTTTGATAGAATCATTCATATAGCGTATCGTCCTCTCAGTTGTTTATTTTGTGGTGATTTAATCATACTAGAGAACGATATGTTTTTTAATACCTAAAATGAAAATGGGGCTGAAGAATCAATTCTGATTCATCAGTCCCATAAATTATAGAGCC	NA	NA	NA	NA
>prophage 3
NZ_CP027506	Enterococcus faecium strain AUSMDU00004055 chromosome, complete genome	2731844	713853	722325	2731844		Streptococcus_phage(66.67%)	9	NA	NA
WP_002294039.1|713853_714498_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002292340.1|714512_714842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288071.1|714855_715794_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002288073.1|715829_716654_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288076.1|716646_716994_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288078.1|717062_717935_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002294035.1|718043_719165_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288081.1|719218_719821_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002288083.1|720135_722325_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
>prophage 4
NZ_CP027506	Enterococcus faecium strain AUSMDU00004055 chromosome, complete genome	2731844	778373	838500	2731844	tRNA,tail,head,terminase,capsid,protease,integrase,holin,transposase,portal	Enterococcus_phage(30.3%)	76	833956:833971	838640:838655
WP_002296621.1|778373_781172_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	2.1e-74
WP_002286618.1|781220_782747_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
WP_002286616.1|782761_783409_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286678.1|783592_783922_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002286614.1|784098_784827_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002286612.1|784842_785856_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286608.1|785855_787133_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
WP_002286607.1|787195_789898_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286606.1|790049_790367_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002286604.1|790396_790717_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002286601.1|790824_792285_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002286598.1|792352_792574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286596.1|792604_792787_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_002286592.1|792786_793200_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002286589.1|793322_794504_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002286587.1|795034_796174_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
WP_002296617.1|796472_797108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296616.1|797220_797856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303013.1|797889_798351_-	DUF4429 domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
WP_002296613.1|798480_798912_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_060799283.1|798929_799250_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
WP_002290310.1|799548_800325_+	phage antirepressor protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296611.1|800339_800543_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002286573.1|800558_800897_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296610.1|800883_801063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|801105_801576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|801662_802361_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|802538_802880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|802872_803544_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286553.1|803549_804236_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	3.2e-88
WP_002286552.1|804238_804988_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_002286696.1|804999_805269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286695.1|805430_805733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296606.1|805729_805891_+	antitoxin	NA	NA	NA	NA	NA
WP_002286694.1|805887_806193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286550.1|806192_806549_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	3.1e-10
WP_002296604.1|806508_806754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286547.1|806750_807170_+	hypothetical protein	NA	D2IZL0	Enterococcus_phage	54.3	4.1e-30
WP_002286545.1|807166_807724_+	DUF1642 domain-containing protein	NA	A0A0C5KKV2	Enterococcus_phage	36.2	2.8e-10
WP_002286693.1|807720_808017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286542.1|808093_808507_+	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.5e-56
WP_002300143.1|808964_809240_-	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	45.7	9.9e-17
WP_002311723.1|809693_809900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296600.1|810095_810263_+	thymidylate synthase	NA	NA	NA	NA	NA
WP_002286540.1|810288_810633_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	57.1	3.8e-26
WP_002296599.1|810637_810919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|811021_811336_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002286533.1|811313_813008_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286530.1|813027_814206_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286527.1|814168_814855_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286525.1|814854_816015_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286524.1|816024_816900_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286523.1|816896_817208_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286522.1|817197_817551_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002296598.1|817540_817942_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286516.1|817934_818339_+	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002286512.1|818350_818959_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.1	3.0e-34
WP_002286510.1|818978_819341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305377.1|819343_819526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286502.1|819542_822974_+|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	44.4	3.1e-67
WP_002286500.1|823024_823762_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002296595.1|823771_826063_+	hypothetical protein	NA	A0A1D3SNL1	Enterococcus_phage	30.0	1.6e-88
WP_002286495.1|826086_828213_+	hypothetical protein	NA	A0A060AI60	Enterococcus_phage	40.1	1.4e-62
WP_002286491.1|828375_828822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|828823_828961_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002286686.1|828998_829292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|829288_829513_+|holin	holin	holin	NA	NA	NA	NA
WP_002286484.1|829509_830535_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
WP_087046766.1|831473_832635_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002286474.1|833558_833966_+	hypothetical protein	NA	NA	NA	NA	NA
833956:833971	attL	AAAAAAATTAAGGAGA	NA	NA	NA	NA
WP_002296902.1|833979_834381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|834382_834754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286680.1|834789_835092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286470.1|835340_835541_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002286469.1|835845_837078_-	aminopeptidase	NA	NA	NA	NA	NA
WP_010729801.1|837321_838500_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
838640:838655	attR	AAAAAAATTAAGGAGA	NA	NA	NA	NA
>prophage 5
NZ_CP027506	Enterococcus faecium strain AUSMDU00004055 chromosome, complete genome	2731844	1064484	1126671	2731844	tRNA,protease,transposase	Lysinibacillus_phage(16.67%)	58	NA	NA
WP_002294414.1|1064484_1065693_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	51.7	1.5e-45
WP_002290187.1|1065846_1066302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|1066495_1067791_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002297218.1|1067917_1069213_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002290188.1|1069707_1069983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288388.1|1069995_1072074_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_002288390.1|1072233_1074120_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.6e-52
WP_002294416.1|1074131_1075079_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.6	7.1e-123
WP_002288392.1|1075098_1075626_+	dihydrofolate reductase	NA	A0A1D6X864	Bacillus_phage	37.1	6.7e-22
WP_002288393.1|1075688_1076342_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_002288394.1|1076473_1077316_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.2	6.5e-19
WP_002288395.1|1077473_1078370_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002288396.1|1078372_1079086_+	YpmS family protein	NA	NA	NA	NA	NA
WP_010729356.1|1079105_1079624_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002288398.1|1079620_1079848_+	YozE family protein	NA	NA	NA	NA	NA
WP_002294418.1|1079999_1080551_+	signal peptidase I	NA	NA	NA	NA	NA
WP_002288403.1|1080633_1081176_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_002288405.1|1081412_1081811_-	glyoxalase	NA	NA	NA	NA	NA
WP_002296988.1|1082070_1082931_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_002296990.1|1082923_1083691_+	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	39.5	2.7e-27
WP_002303743.1|1083746_1084604_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002288411.1|1084725_1086804_+	type I DNA topoisomerase	NA	A0A167R9A0	Powai_lake_megavirus	38.5	1.2e-101
WP_002320953.1|1086772_1088149_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_002288415.1|1088346_1089252_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	29.4	9.4e-32
WP_002288419.1|1089288_1089837_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_002288421.1|1089850_1091251_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	28.8	1.7e-43
WP_002290223.1|1091268_1092060_+	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_002296994.1|1092141_1093017_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_002296995.1|1093148_1093787_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_002296996.1|1093913_1094348_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_002303746.1|1094513_1096559_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.3	2.4e-115
WP_002303213.1|1096570_1099021_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.6	9.2e-98
WP_002297185.1|1099145_1100441_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002289265.1|1100819_1103051_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.5	2.4e-169
WP_002289264.1|1103294_1104056_+	pyruvate formate lyase-activating protein	NA	NA	NA	NA	NA
WP_002289263.1|1104140_1105067_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_002289262.1|1105248_1106142_+	DUF1803 domain-containing protein	NA	NA	NA	NA	NA
WP_002296999.1|1106275_1106401_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002289266.1|1106534_1107167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289260.1|1107314_1107857_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_002297001.1|1107991_1108381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289259.1|1108384_1109149_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002289258.1|1109277_1110225_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289257.1|1110354_1111095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297002.1|1111385_1112054_-	membrane protein	NA	NA	NA	NA	NA
WP_002289767.1|1112187_1112475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289765.1|1112890_1114429_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_002289763.1|1114425_1115391_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.9	2.0e-27
WP_002289757.1|1115377_1116700_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002297003.1|1116940_1117684_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002297008.1|1117698_1118691_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002297010.1|1118702_1119440_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_002297012.1|1119429_1120152_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_002326685.1|1120235_1120859_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	56.4	3.9e-37
WP_002295437.1|1122152_1122443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1123566_1124745_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002347134.1|1124904_1125387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296623.1|1125375_1126671_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
>prophage 6
NZ_CP027506	Enterococcus faecium strain AUSMDU00004055 chromosome, complete genome	2731844	1154541	1163602	2731844		Gordonia_phage(16.67%)	9	NA	NA
WP_002288023.1|1154541_1155837_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
WP_002297115.1|1156016_1156394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288021.1|1156649_1157378_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002295474.1|1157377_1157632_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288017.1|1157633_1158305_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002288015.1|1158305_1160528_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288013.1|1160512_1161952_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002321731.1|1161983_1163027_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288010.1|1163023_1163602_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
>prophage 7
NZ_CP027506	Enterococcus faecium strain AUSMDU00004055 chromosome, complete genome	2731844	1433260	1475102	2731844	protease,transposase	Lysinibacillus_phage(16.67%)	51	NA	NA
WP_002297218.1|1433260_1434556_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002290686.1|1434774_1435017_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002295944.1|1435048_1435606_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002295945.1|1435618_1435807_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002295947.1|1435819_1436386_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002287525.1|1436820_1437969_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002287522.1|1437985_1438390_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002295138.1|1439506_1439980_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_002295139.1|1439988_1440216_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002295142.1|1440851_1441223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291278.1|1441478_1441721_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002296679.1|1441752_1442655_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002291274.1|1442667_1442856_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002296677.1|1442869_1443433_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002296675.1|1443470_1444364_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.0	8.9e-59
WP_002296674.1|1444441_1445380_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002296672.1|1445413_1445764_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002296671.1|1445796_1446699_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_002296670.1|1446691_1447549_-	glycosyltransferase family 8 protein	NA	A0ZYL4	Archaeal_BJ1_virus	27.1	1.3e-19
WP_002296669.1|1447882_1448692_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002296667.1|1448731_1449229_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002321681.1|1449873_1450197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296665.1|1450360_1450615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296663.1|1450684_1450930_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296662.1|1451005_1451371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303842.1|1451431_1451995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|1452646_1453942_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002302440.1|1454180_1455482_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002293303.1|1455585_1455786_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	77.3	3.9e-23
WP_002296656.1|1456537_1457251_-	HAD family phosphatase	NA	A0A1D8KPI1	Synechococcus_phage	23.0	5.4e-06
WP_002296654.1|1457243_1458329_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002296653.1|1458345_1458789_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002321678.1|1458822_1459176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296650.1|1459287_1459689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296648.1|1459725_1460235_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002303107.1|1460256_1461114_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002296646.1|1461131_1461965_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002303106.1|1461978_1462776_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002321677.1|1462808_1463093_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002296641.1|1463089_1464091_-	2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	29.0	2.8e-24
WP_102993993.1|1464092_1464995_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A1D8KGX1	Synechococcus_phage	35.0	1.8e-51
WP_002296639.1|1465158_1466007_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296638.1|1466651_1466858_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_002296637.1|1467059_1468061_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	31.8	2.5e-09
WP_002311095.1|1468065_1469979_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_002296634.1|1470146_1470653_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002296633.1|1470812_1471253_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002296632.1|1471278_1472436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296631.1|1472438_1472795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296629.1|1473092_1474067_-	LPXTG-anchored fibrinogen/nidogen-binding adhesin SgrA	NA	NA	NA	NA	NA
WP_102993991.1|1474262_1475102_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 8
NZ_CP027506	Enterococcus faecium strain AUSMDU00004055 chromosome, complete genome	2731844	1478253	1511044	2731844	transposase,integrase	Streptococcus_phage(22.22%)	31	1482544:1482559	1492265:1492280
WP_002287107.1|1478253_1479504_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002296760.1|1479645_1480641_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289423.1|1480658_1481213_-	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289422.1|1481200_1481692_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289421.1|1481684_1483553_-	HTH domain-containing protein	NA	NA	NA	NA	NA
1482544:1482559	attL	AAAGGATACTTTTTTT	NA	NA	NA	NA
WP_002289420.1|1483571_1484372_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.2	2.6e-09
WP_002289418.1|1484595_1484811_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002303864.1|1484949_1485435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289415.1|1485890_1486304_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_002322258.1|1486440_1486701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321532.1|1486818_1487109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1487354_1488533_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_060804964.1|1488688_1489642_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002288357.1|1489698_1490826_+|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	55.5	1.8e-109
WP_010729348.1|1491043_1492186_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	32.4	4.5e-39
WP_010729347.1|1492190_1492376_-	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
1492265:1492280	attR	AAAAAAAGTATCCTTT	NA	NA	NA	NA
WP_002353648.1|1492729_1492975_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010729346.1|1492968_1493370_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010729345.1|1493556_1495365_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	48.4	2.3e-154
WP_010729344.1|1495387_1497154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729343.1|1497166_1497961_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_010729700.1|1497970_1499347_-	MFS transporter	NA	NA	NA	NA	NA
WP_010729341.1|1499466_1500114_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_010729340.1|1500197_1501625_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_010729339.1|1501698_1502778_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_010729338.1|1502780_1504412_-	mannitol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010729337.1|1504715_1505387_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287525.1|1505703_1506852_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_000122610.1|1508066_1509359_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_159037556.1|1509501_1509699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000195429.1|1509871_1511044_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
>prophage 9
NZ_CP027506	Enterococcus faecium strain AUSMDU00004055 chromosome, complete genome	2731844	1688101	1740663	2731844	tRNA,protease,transposase	unidentified_phage(14.29%)	52	NA	NA
WP_002347409.1|1688101_1689811_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002294136.1|1689878_1691147_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_106914070.1|1691307_1692108_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002294134.1|1692104_1692917_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_002293875.1|1693111_1693669_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002293877.1|1693671_1694394_-	UMP kinase	NA	NA	NA	NA	NA
WP_002293878.1|1694529_1695411_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293880.1|1695509_1696292_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293881.1|1696650_1697130_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326249.1|1697346_1698438_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002293884.1|1698430_1699216_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_002293885.1|1699561_1701253_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.8	9.9e-75
WP_002288434.1|1701674_1702622_-	carbamate kinase	NA	NA	NA	NA	NA
WP_002288437.1|1702736_1703756_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288439.1|1703846_1705076_-	arginine deiminase	NA	NA	NA	NA	NA
WP_002288442.1|1705536_1706238_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002297185.1|1706409_1707705_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002301319.1|1708368_1709385_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	5.4e-60
WP_002288445.1|1709381_1709846_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288446.1|1709852_1710395_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288447.1|1710378_1711203_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002288449.1|1711291_1712272_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002288451.1|1712295_1713780_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002288452.1|1713791_1714781_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_002288457.1|1715028_1715196_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_002288458.1|1715257_1717069_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288459.1|1717065_1717431_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_002288461.1|1717593_1717989_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288462.1|1718006_1718969_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002293902.1|1718968_1719181_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_002289885.1|1719201_1719900_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002289886.1|1719919_1720462_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002301321.1|1720593_1721598_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293904.1|1721594_1722584_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293905.1|1722580_1723387_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_002293906.1|1723552_1724509_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002296121.1|1724585_1725104_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002296119.1|1725191_1725341_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002288531.1|1725568_1726015_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002288533.1|1726209_1728105_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002303934.1|1728429_1729404_-	choloylglycine hydrolase family protein	NA	M1H001	Paramecium_bursaria_Chlorella_virus	29.7	3.0e-23
WP_002296332.1|1729969_1730536_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296334.1|1730791_1732123_+	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_002296335.1|1732088_1732439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297629.1|1732530_1732950_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002296337.1|1732950_1733295_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002301399.1|1733560_1734520_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002287776.1|1734709_1735306_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002287775.1|1735429_1737229_+	glycerophosphoryl diester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002297633.1|1737506_1737719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311774.1|1738582_1739542_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002326704.1|1739754_1740663_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP027506	Enterococcus faecium strain AUSMDU00004055 chromosome, complete genome	2731844	1745653	1803814	2731844	tRNA,transposase	Streptococcus_phage(33.33%)	55	NA	NA
WP_002288577.1|1745653_1746139_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002288579.1|1746161_1746920_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288581.1|1746935_1748114_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
WP_002303943.1|1748343_1750464_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.0	8.2e-220
WP_002297218.1|1750644_1751940_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002296838.1|1752208_1752934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288586.1|1752923_1753433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288588.1|1753502_1754951_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288590.1|1754950_1755667_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288595.1|1755647_1755998_-	SdpI family protein	NA	NA	NA	NA	NA
WP_106914072.1|1756141_1756915_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002302293.1|1757671_1757974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1758255_1759434_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321266.1|1759770_1760010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289617.1|1760371_1760632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289618.1|1760816_1761314_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289619.1|1761443_1762154_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289620.1|1762166_1763831_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002300930.1|1764035_1764698_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002303949.1|1764707_1765523_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288989.1|1765784_1766228_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002321036.1|1766361_1766700_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002302962.1|1766687_1767065_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002322902.1|1767288_1768482_+	MFS transporter	NA	NA	NA	NA	NA
WP_002288984.1|1768647_1769070_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002303955.1|1769659_1770115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288982.1|1770276_1771449_-	class C sortase	NA	NA	NA	NA	NA
WP_002303963.1|1774579_1776907_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002288970.1|1777749_1778043_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002286913.1|1778300_1778648_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002293717.1|1778783_1779545_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002293716.1|1779534_1780056_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002297190.1|1780225_1781017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290277.1|1781141_1781393_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002290274.1|1781404_1781680_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002293714.1|1781932_1782487_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002297192.1|1782565_1783087_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002293710.1|1783090_1783669_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002293709.1|1783780_1785199_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002293708.1|1785219_1785558_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002297194.1|1785517_1786021_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_002293705.1|1786151_1786856_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
WP_002303966.1|1786852_1788589_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002297196.1|1788691_1791163_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	28.8	7.0e-45
WP_002326707.1|1791435_1792710_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	35.9	9.5e-54
WP_002289807.1|1792996_1793887_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_002300070.1|1794083_1794566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289810.1|1794773_1795139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002326708.1|1795229_1795547_-	SdpI family protein	NA	NA	NA	NA	NA
WP_002301399.1|1796288_1797248_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002301623.1|1797370_1798345_-	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	7.1e-25
WP_002297404.1|1798754_1800005_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295273.1|1800290_1800548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295743.1|1801441_1802350_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_099098442.1|1802651_1803814_-|transposase	IS3-like element ISEfa8 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	1.8e-80
>prophage 11
NZ_CP027506	Enterococcus faecium strain AUSMDU00004055 chromosome, complete genome	2731844	2598564	2615460	2731844		Streptococcus_phage(92.86%)	18	NA	NA
WP_002297366.1|2598564_2598879_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.0e-25
WP_002297365.1|2598891_2599266_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
WP_002311649.1|2599266_2599611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729284.1|2599693_2601034_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	65.2	1.5e-163
WP_002297358.1|2601111_2601786_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002321810.1|2602018_2602453_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SDW2	Streptococcus_phage	77.1	6.5e-63
WP_002297356.1|2602453_2603161_+	DNA methylase	NA	A0A1S5SEK0	Streptococcus_phage	50.4	5.8e-53
WP_002297354.1|2603150_2603441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297353.1|2603699_2604884_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
WP_002317225.1|2604880_2605018_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|2605763_2607674_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033658092.1|2607777_2608002_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002297350.1|2608014_2608518_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_002297349.1|2608577_2608967_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
WP_010729283.1|2608953_2611401_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	75.9	0.0e+00
WP_002297347.1|2611405_2613529_+	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	59.7	1.2e-181
WP_002297346.1|2613525_2614530_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	63.5	5.6e-118
WP_002297345.1|2614548_2615460_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	44.0	2.2e-65
>prophage 1
NZ_CP027507	Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence	231024	3393	65524	231024	integrase,holin,transposase	Streptococcus_phage(25.0%)	56	NA	NA
WP_002287107.1|3393_4644_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_010729212.1|7804_9265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106913788.1|9275_11480_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	51.1	2.7e-117
WP_002296244.1|11719_12313_+	abortive infection protein	NA	NA	NA	NA	NA
WP_010706442.1|12325_13225_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002303313.1|13227_13713_+	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	59.3	5.8e-44
WP_002316074.1|13853_14057_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002321813.1|14131_14392_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	3.4e-11
WP_002296239.1|14831_15038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296238.1|15037_15289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300851.1|15303_15741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300852.1|15733_16441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120991.1|16821_17001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000388479.1|17131_17401_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000588503.1|17393_17651_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_000455809.1|18109_19114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261742.1|19278_19893_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.9	3.8e-16
WP_002288787.1|20206_20629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299573.1|20638_20842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299575.1|21052_21637_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	5.9e-43
WP_086322086.1|21825_22512_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	2.9e-126
WP_002305879.1|24110_24983_-	ROK family protein	NA	NA	NA	NA	NA
WP_002352509.1|25246_27193_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002302078.1|27377_28817_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002302077.1|28818_29781_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_086953894.1|29950_31377_-|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002301718.1|31619_32075_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
WP_002289255.1|32660_32891_-	resolvase	NA	NA	NA	NA	NA
WP_002289254.1|33120_33939_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289253.1|34099_34789_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289252.1|34802_36305_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002300328.1|36317_36794_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_158514107.1|36890_37001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956687.1|37291_38454_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002287870.1|39571_40090_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_002329899.1|41226_41634_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A0N9SKD8	Staphylococcus_phage	38.9	4.0e-14
WP_002290351.1|41630_41864_-	addiction module antitoxin	NA	NA	NA	NA	NA
WP_002290352.1|42197_43283_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_002290356.1|44385_44535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290357.1|44527_44737_-	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_002335326.1|46241_47702_-	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_002342361.1|47698_48919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290367.1|48979_51163_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_002290368.1|51202_52033_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002290370.1|52044_52917_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002290371.1|52926_54186_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002329911.1|54333_55644_-	alpha-glucosidase/alpha-galactosidase	NA	NA	NA	NA	NA
WP_002350071.1|55675_56500_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002350067.1|57494_58604_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002338088.1|58897_59923_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_002290379.1|60167_61439_-	substrate-binding domain-containing protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	45.0	4.1e-17
WP_002290380.1|61722_62094_-	glyoxalase	NA	NA	NA	NA	NA
WP_002342357.1|62133_62670_-	glyoxalase	NA	NA	NA	NA	NA
WP_002290382.1|62681_63155_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	44.2	2.3e-13
WP_002290383.1|63327_63882_-|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	46.1	8.6e-36
WP_002300314.1|64354_65524_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP027507	Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence	231024	71913	192579	231024	integrase,holin,bacteriocin,transposase	Streptococcus_phage(30.0%)	110	138016:138075	185698:185997
WP_094868189.1|71913_72600_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.9e-127
WP_044383143.1|72811_75961_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.1	1.1e-21
WP_016922464.1|75974_77192_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	33.7	9.2e-14
WP_044383147.1|77181_78777_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	51.1	1.8e-126
WP_002326540.1|78901_79687_+	SinI family restriction endonuclease	NA	NA	NA	NA	NA
WP_010731484.1|81049_82183_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_002350430.1|82173_82842_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.4	8.8e-27
WP_002350432.1|83297_84284_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002350433.1|84296_85223_-	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_010731482.1|85235_85751_-	galactose-6-phosphate isomerase subunit LacB	NA	A0A222YX14	Synechococcus_phage	29.0	9.5e-05
WP_010731481.1|85769_86198_-	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_010731480.1|86217_86991_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.1	1.3e-18
WP_002350438.1|87155_87635_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002350439.1|87691_87994_+	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_002350440.1|88015_89473_+	PTS glucitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002350442.1|90065_90818_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.9e-17
WP_016922316.1|92448_94131_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002350447.1|94141_94465_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_016922317.1|94487_95894_-	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	30.2	3.4e-44
WP_002350449.1|96360_97368_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_044383156.1|98132_98813_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	3.2e-109
WP_002292681.1|99442_99991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292680.1|99991_100849_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
WP_002300557.1|101132_101420_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002292678.1|101409_101739_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_010729757.1|105002_105875_-	ROK family protein	NA	NA	NA	NA	NA
WP_002322556.1|105891_107364_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_002313079.1|107377_108226_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002322555.1|108222_109089_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002322554.1|109131_110490_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010729506.1|110584_111556_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	22.4	1.2e-05
WP_002313084.1|112590_113196_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	32.6	3.6e-19
WP_002336308.1|114584_115544_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	6.5e-31
WP_010729754.1|116093_117002_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_010729753.1|117060_118863_-	exonuclease DNA polymerase III epsilon subunit	NA	A0A0A7RWA3	Clostridium_phage	30.4	7.6e-33
WP_002342384.1|118925_119768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002331328.1|119783_120005_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085910366.1|120494_121181_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.9e-127
WP_002339142.1|121238_122459_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	58.5	3.9e-57
WP_002339141.1|122478_123090_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	53.2	1.7e-56
WP_002350224.1|123132_124065_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_002350223.1|124485_125346_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002322961.1|126211_126379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298077.1|126411_127812_-	putative basic amino acid antiporter YfcC	NA	NA	NA	NA	NA
WP_002296840.1|128346_129534_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002288620.1|129591_130833_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_010729750.1|130868_131579_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288615.1|131646_132462_-	fructoselysine 6-kinase	NA	NA	NA	NA	NA
WP_002336724.1|132472_133441_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_010729749.1|134203_135496_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002285758.1|135574_135769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|135758_136112_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002354485.1|137560_138247_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
138016:138075	attL	CCATTTTCCATGAATAAAAGGATTTTTTATTTTTCTTTTTCCAAATTTGATAGAGTAGTT	NA	NA	NA	NA
WP_063610281.1|138707_139583_-	aminoglycoside O-phosphotransferase APH(2'')-Ia	NA	A0A0N9SKF6	Staphylococcus_phage	100.0	2.2e-166
WP_002319817.1|140314_140995_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_001224538.1|141117_141735_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
WP_002304891.1|142059_142455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086968564.1|143610_144752_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.7	3.8e-78
WP_001015311.1|144862_145543_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002301839.1|145753_146353_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.1	1.3e-29
WP_002300846.1|147306_147489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300845.1|147478_147658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300843.1|147900_149421_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.6	1.1e-48
WP_002300842.1|149607_150180_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002300841.1|150186_150849_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002300840.1|150864_151380_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_002300838.1|151381_151666_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002300836.1|151699_153028_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002300835.1|153041_153497_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002300833.1|153499_155446_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_000997695.1|155833_157012_-|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002300807.1|157383_157647_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_000222572.1|157767_158721_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002311569.1|159689_160046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300804.1|160104_160284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300801.1|160728_161001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300797.1|161181_161433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305810.1|161432_161639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305809.1|162081_162306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002295624.1|162495_162618_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002303482.1|162776_163010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002354485.1|163129_163816_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002300493.1|164369_165539_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_002354485.1|165878_166565_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002302440.1|167124_168426_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002389879.1|168604_168874_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SCV8	Streptococcus_phage	48.8	8.7e-18
WP_086322080.1|168863_169202_-	antitoxin	NA	NA	NA	NA	NA
WP_077974475.1|169198_169426_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_010729807.1|169630_170263_-	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	27.9	3.0e-08
WP_010729806.1|170275_172999_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002322451.1|173135_174101_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002298371.1|174154_174967_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_010729805.1|174980_175754_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298375.1|175767_176238_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002298377.1|176234_176651_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002311511.1|176975_177818_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010729802.1|179276_180185_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002299197.1|180400_181012_+	VanZ family protein	NA	NA	NA	NA	NA
WP_002299198.1|181084_182014_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	23.3	1.1e-06
WP_074394709.1|182171_182909_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_010729801.1|182956_184135_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	27.1	2.7e-23
WP_080114943.1|184361_184763_+	hypothetical protein	NA	A0A0N9S006	Staphylococcus_phage	49.2	2.5e-24
WP_002301682.1|186725_187535_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
185698:185997	attR	AACTACTCTATCAAATTTGGAAAAAGAAAAATAAAAAATCCTTTTATTCATGGAAAATGGCATTATTTGTATCGAGCCATCGATGCAGATGGTTTAACCTTGGATATTTGGTTACGTAAAAAACGGGACACACAAGCAGCGTATGCTTTTCTTAAGCGGTTAGTGAAGCAGTTTGATGAACCGAAGGTTGTAGTCACAGATAAAGCCCCCTCTATTACAAGTGCCTTTAAGAAACTAAAAGAATACGGCTTTTATCAAGGGACAGAACATCGTACCATTAAATACCTGAATAATTTGATT	NA	NA	NA	NA
WP_002301683.1|187534_188281_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002301684.1|188298_188766_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002301685.1|188765_189176_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002301686.1|189186_190200_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_010729798.1|190416_191151_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010729797.1|191134_191845_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086322086.1|191892_192579_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	2.9e-126
>prophage 1
NZ_CP027509	Enterococcus faecium strain AUSMDU00004055 plasmid unnamed3, complete sequence	36341	13543	36262	36341	transposase	Streptococcus_phage(60.0%)	30	NA	NA
WP_002287225.1|13543_14503_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	3.4e-32
WP_000053907.1|14526_14823_-	replication control protein PrgN	NA	NA	NA	NA	NA
WP_000947691.1|14957_16451_-	replication protein RepR	NA	NA	NA	NA	NA
WP_000429439.1|17062_18016_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	26.1	7.7e-16
WP_001196543.1|17987_18263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199136.1|18455_18710_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.6	2.1e-13
WP_002322130.1|18820_19075_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	50.0	4.1e-09
WP_086953888.1|19115_20277_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_073120187.1|20378_20951_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.1	5.0e-55
WP_002303206.1|21423_21996_-	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	46.0	6.8e-36
WP_000599739.1|22011_22617_-	cell filamentation protein	NA	NA	NA	NA	NA
WP_002354485.1|22814_23501_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_010729662.1|23548_24097_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	33.8	2.7e-13
WP_000774078.1|24367_24880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000357244.1|24886_25405_-	YfbU family protein	NA	NA	NA	NA	NA
WP_002349227.1|25566_25779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002354485.1|25941_26628_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_001255866.1|27208_28117_+	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	E4ZFP8	Streptococcus_phage	100.0	2.8e-177
WP_002347175.1|28113_28362_+	hypothetical protein	NA	A0A1B0RXL7	Streptococcus_phage	96.1	9.5e-27
WP_002324522.1|28364_29273_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002297218.1|29373_30669_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_001096887.1|31257_32052_+	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_031929417.1|32593_32677_+	23S rRNA methyltransferase attenuator leader peptide ErmL	NA	NA	NA	NA	NA
WP_001038796.1|32801_33539_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	2.4e-134
WP_023843711.1|33483_33624_+	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	93.0	8.0e-15
WP_001284311.1|33801_34665_-	toxin zeta	NA	NA	NA	NA	NA
WP_000301765.1|34666_34939_-	antitoxin	NA	A0A1X9I6E5	Streptococcus_phage	100.0	5.0e-05
WP_001835296.1|34955_35171_-	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	97.1	4.2e-31
WP_002347171.1|35262_35520_-	hypothetical protein	NA	A0A1X9I765	Streptococcus_phage	98.8	9.1e-41
WP_002354485.1|35575_36262_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
>prophage 1
NZ_CP027510	Enterococcus faecium strain AUSMDU00004055 plasmid unnamed4, complete sequence	33328	1656	15773	33328	transposase	Streptococcus_phage(76.92%)	15	NA	NA
WP_002354485.1|1656_2343_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_001814874.1|2482_2566_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001038792.1|2690_3428_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.2	7.0e-134
WP_000085862.1|3432_3564_+	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	100.0	7.9e-17
WP_000567888.1|4721_4967_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000228166.1|5069_5939_+	hypothetical protein	NA	A0A1X9I6C9	Streptococcus_phage	95.8	4.3e-159
WP_000662263.1|5919_6654_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
WP_001255866.1|6686_7595_+	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	E4ZFP8	Streptococcus_phage	100.0	2.8e-177
WP_000627290.1|7591_8134_+	streptothricin N-acetyltransferase Sat4	NA	A0A1B0RXL7	Streptococcus_phage	100.0	8.9e-94
WP_001096887.1|8226_9021_+	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_002354485.1|9868_10555_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_001280781.1|11255_11951_+	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	4.9e-36
WP_002305818.1|11928_13083_+	VanA-type vancomycin resistance histidine kinase VanS	NA	W8CYF6	Bacillus_phage	23.3	1.5e-13
WP_000122610.1|13180_14473_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_001059542.1|14804_15773_+	D-lactate dehydrogenase VanH-A	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	33.1	3.5e-40
>prophage 1
NZ_CP027511	Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence	91057	24663	73793	91057	transposase,protease	Streptococcus_phage(37.5%)	50	NA	NA
WP_010729681.1|24663_26613_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2I7REQ1	Vibrio_phage	24.7	2.3e-30
WP_010729680.1|26615_30257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347431.1|30656_30995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033624104.1|31104_31326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347429.1|31345_33502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320768.1|33513_33747_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002320767.1|33736_34603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320766.1|34617_36588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320765.1|36754_36982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287522.1|37201_37606_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002323589.1|37622_38771_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
WP_002347505.1|39367_39952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347506.1|39962_40208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347507.1|40213_40936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347508.1|41066_41810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347509.1|41815_42181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347720.1|42196_42727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010730982.1|42888_43197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010730980.1|43748_44549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347439.1|44585_44768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347440.1|44878_45196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347443.1|45545_46025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002352866.1|46144_47482_+	CHAP domain-containing protein	NA	Q859L3	Staphylococcus_phage	54.0	6.5e-37
WP_002321012.1|47504_48032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347445.1|48018_48582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347446.1|49003_49741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347447.1|49757_50174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025478707.1|50565_51813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347449.1|52080_54471_+	Cys-Gln thioester bond-forming surface protein	NA	NA	NA	NA	NA
WP_049055867.1|54519_56355_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_010730978.1|56429_57287_+	class C sortase	NA	NA	NA	NA	NA
WP_049055866.1|57276_58386_+	class C sortase	NA	NA	NA	NA	NA
WP_049055865.1|58723_59524_+	hypothetical protein	NA	U5PTP5	Bacillus_phage	36.3	7.1e-07
WP_049055864.1|59611_60418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049055863.1|60439_61867_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.0	4.4e-124
WP_002350580.1|62186_63056_+	endonuclease	NA	NA	NA	NA	NA
WP_002320856.1|63075_63423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320855.1|63435_64698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002353144.1|64777_66154_+	cell division protein FtsK	NA	G1FGP1	Mycobacterium_phage	42.5	1.7e-48
WP_049055862.1|66150_66780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002350578.1|66798_67278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049055861.1|67836_68436_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002347461.1|68451_68928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347462.1|68944_69847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320847.1|69919_70111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347463.1|70274_70862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347464.1|70861_71761_+	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_002347465.1|71760_72675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347466.1|72726_72942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287522.1|73388_73793_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
