The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027517	Enterococcus faecium strain AUSMDU00004024 chromosome, complete genome	2863087	534012	600975	2863087	integrase,tRNA,transposase,protease	Streptococcus_phage(15.38%)	54	529565:529584	607824:607843
529565:529584	attL	GACAAGACTTTTGTCACAGC	NA	NA	NA	NA
WP_002286726.1|534012_535134_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_002286721.1|535379_536801_+	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_002286711.1|536814_537933_+	aminotransferase	NA	NA	NA	NA	NA
WP_002286708.1|537992_539285_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_002326790.1|539434_539995_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002286704.1|540123_540501_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_002304230.1|540433_542506_+	DNA topoisomerase III	NA	NA	NA	NA	NA
WP_002289773.1|542716_543664_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	51.0	5.0e-84
WP_002289775.1|543909_544374_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	38.7	8.8e-18
WP_002289776.1|544435_545479_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_002291188.1|545855_546821_-	TDT family transporter	NA	NA	NA	NA	NA
WP_002297022.1|547054_547900_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002291183.1|548090_549278_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_002295166.1|549283_549640_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	42.3	2.7e-22
WP_002291179.1|549641_549980_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
WP_002304234.1|550374_551409_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.1	4.2e-28
WP_002287674.1|551401_552088_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287678.1|552111_552960_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002287679.1|553156_553930_+	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FG22	Brazilian_cedratvirus	28.8	2.1e-08
WP_002287681.1|553942_555229_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_002287683.1|555225_556461_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	47.7	3.9e-113
WP_002287684.1|556447_556918_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_002287686.1|556922_558314_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_002297218.1|558429_559725_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002287705.1|559930_561073_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	34.8	3.3e-58
WP_002287709.1|561111_561846_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002287723.1|562077_562353_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048946547.1|562450_564448_+	hypothetical protein	NA	A0A1Z1LZK7	Bacillus_phage	24.4	5.5e-24
WP_002301912.1|564523_564859_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048946548.1|565237_565600_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_048946549.1|565645_565972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002298390.1|566814_568638_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002298389.1|568651_570061_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	27.6	3.2e-42
WP_002298387.1|570078_570915_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002317770.1|570979_571762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094850654.1|572165_573291_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	54.1	2.3e-75
WP_002297848.1|574643_574844_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002297850.1|574919_575117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297851.1|575413_576961_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	S4VPC4	Pandoravirus	25.7	4.6e-10
WP_002297853.1|577044_577848_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_002297855.1|577850_578633_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002297856.1|578629_579409_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002297857.1|579380_580172_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.3e-21
WP_002297858.1|580232_581162_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002297859.1|581356_582040_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002340328.1|582200_583244_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002340332.1|585183_586362_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002295743.1|586582_587491_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002321318.1|587619_588219_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_002321317.1|588218_588794_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_002344971.1|588818_592490_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_002340336.1|592553_596186_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_002321314.1|596301_598824_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_002321313.1|598941_600975_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
607824:607843	attR	GACAAGACTTTTGTCACAGC	NA	NA	NA	NA
>prophage 2
NZ_CP027517	Enterococcus faecium strain AUSMDU00004024 chromosome, complete genome	2863087	804919	906363	2863087	tRNA,transposase,terminase,portal,capsid,head,plate,holin,protease,integrase,tail	uncultured_Caudovirales_phage(14.29%)	110	855874:855892	891839:891857
WP_002286621.1|804919_807718_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.6e-74
WP_002286618.1|807766_809293_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
WP_002286616.1|809307_809955_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286678.1|810138_810468_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002286614.1|810644_811373_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002286612.1|811388_812402_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286608.1|812401_813679_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
WP_074400891.1|813741_816444_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286606.1|816595_816913_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002286604.1|816942_817263_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002371581.1|817370_818831_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002286598.1|818898_819120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286596.1|819150_819333_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_002286592.1|819332_819746_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002286589.1|819868_821050_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002286587.1|821580_822720_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
WP_002296617.1|823018_823654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296616.1|823766_824402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000202380.1|824790_826110_-|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
WP_106913968.1|826260_826581_-	DUF4429 domain-containing protein	NA	NA	NA	NA	NA
WP_002296613.1|826710_827142_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002296612.1|827159_827480_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
WP_002290310.1|827778_828555_+	phage antirepressor protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296611.1|828569_828773_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002286573.1|828788_829127_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296610.1|829113_829293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|829335_829806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|829892_830591_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|830768_831110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|831102_831774_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_058825536.1|831779_832472_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	3.2e-88
WP_002286552.1|832468_833218_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_002304429.1|833229_833499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303016.1|833661_833961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303017.1|833960_834263_+	hypothetical protein	NA	D2IZY1	Enterococcus_phage	70.7	2.8e-33
WP_002303018.1|834302_834668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002369144.1|835294_835477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347162.1|835489_835684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303022.1|835716_835929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304431.1|836053_836257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303024.1|836253_836526_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	61.6	5.5e-20
WP_002303025.1|836526_836712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123838300.1|836698_837046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303026.1|837005_837482_+	DUF1492 domain-containing protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	50.8	2.2e-27
WP_002349221.1|837627_838356_-	DUF4145 domain-containing protein	NA	A0A1X9I5M7	Streptococcus_phage	52.4	1.2e-58
WP_002303029.1|838403_838682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303030.1|838683_839070_+	hypothetical protein	NA	A0A1B1P7N8	Bacillus_phage	36.7	1.9e-10
WP_002304435.1|839066_839447_+	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	64.0	4.7e-41
WP_002303032.1|839558_840011_+	hypothetical protein	NA	A0A2H4JFK0	uncultured_Caudovirales_phage	66.2	6.8e-47
WP_002303033.1|840007_841735_+|terminase	terminase large subunit	terminase	A0A2H4JDG5	uncultured_Caudovirales_phage	73.3	6.9e-265
WP_002303034.1|841756_842986_+|portal	phage portal protein	portal	A0A2H4J9C7	uncultured_Caudovirales_phage	65.0	1.7e-145
WP_002349220.1|842951_843527_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	71.7	3.6e-69
WP_002303037.1|843539_844904_+|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	69.1	2.2e-125
WP_002303039.1|844905_845187_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	62.7	4.7e-22
WP_002303041.1|845164_845491_+|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	53.4	2.9e-23
WP_002303043.1|845480_845819_+	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	45.9	9.6e-22
WP_002303045.1|845808_846174_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_002303047.1|846180_846807_+|tail	tail protein	tail	A0A2H4JGN2	uncultured_Caudovirales_phage	34.5	5.7e-28
WP_002303049.1|846806_847271_+	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	38.9	1.4e-15
WP_002303051.1|847465_849775_+|tail	phage tail tape measure protein	tail	Q8W5Z7	Listeria_phage	50.1	5.5e-84
WP_002349218.1|849786_850491_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002347164.1|850487_853247_+	CHAP domain-containing protein	NA	D7RWE0	Brochothrix_phage	55.7	1.6e-50
WP_002332773.1|853259_854168_+|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_002303523.1|854167_854785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002301867.1|854788_855238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305897.1|855237_855732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347165.1|855745_856177_+	hypothetical protein	NA	NA	NA	NA	NA
855874:855892	attL	TTTTGATAAAAAACAGTGG	NA	NA	NA	NA
WP_002303475.1|856178_856316_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002303476.1|856352_856646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|856642_856867_+|holin	holin	holin	NA	NA	NA	NA
WP_002303477.1|856863_857883_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
WP_002302747.1|858659_858959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302745.1|858964_859195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286470.1|859444_859645_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002296840.1|859961_861149_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002286469.1|861423_862656_-	aminopeptidase	NA	NA	NA	NA	NA
WP_002286467.1|862910_863480_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002286465.1|863657_864098_-	flavodoxin	NA	NA	NA	NA	NA
WP_002294533.1|864255_865020_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286461.1|865051_865975_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002286457.1|866050_867190_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002286455.1|867182_867983_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286453.1|867982_868810_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002321540.1|868787_869522_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286449.1|869621_870488_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002286442.1|870501_871074_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002294532.1|871095_872124_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	6.4e-69
WP_002286428.1|872221_873073_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.7e-38
WP_002302719.1|873106_875140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042957143.1|875183_876464_+	EpaQ family protein	NA	NA	NA	NA	NA
WP_002289081.1|876673_877480_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002289079.1|877491_878712_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.1e-11
WP_002289078.1|878701_880288_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002289076.1|880326_882465_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002289074.1|882832_883816_-	serine hydrolase	NA	NA	NA	NA	NA
WP_002289073.1|884193_885585_+	sugar transferase	NA	NA	NA	NA	NA
WP_002289071.1|885600_886641_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	35.3	2.4e-07
WP_002289069.1|886659_887745_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_002302730.1|890158_891229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289359.1|892648_893656_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.9	1.2e-40
891839:891857	attR	TTTTGATAAAAAACAGTGG	NA	NA	NA	NA
WP_002292874.1|893667_894672_+	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_002289362.1|894668_895817_+	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_002289363.1|895789_896467_+	acetyltransferase	NA	NA	NA	NA	NA
WP_002326811.1|896456_897599_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	27.9	2.4e-24
WP_002289366.1|897611_898589_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002289368.1|898588_899497_+	dehydrogenase	NA	NA	NA	NA	NA
WP_002289370.1|899497_900250_+	acylneuraminate cytidylyltransferase family protein	NA	NA	NA	NA	NA
WP_002289372.1|900254_901202_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	37.7	2.8e-50
WP_000222572.1|903158_904112_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_000997695.1|905184_906363_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP027517	Enterococcus faecium strain AUSMDU00004024 chromosome, complete genome	2863087	1176258	1185319	2863087		Gordonia_phage(16.67%)	9	NA	NA
WP_002288023.1|1176258_1177554_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
WP_002297115.1|1177733_1178111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288021.1|1178366_1179095_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002295474.1|1179094_1179349_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288017.1|1179350_1180022_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002288015.1|1180022_1182245_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288013.1|1182229_1183669_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002321731.1|1183700_1184744_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288010.1|1184740_1185319_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
>prophage 4
NZ_CP027517	Enterococcus faecium strain AUSMDU00004024 chromosome, complete genome	2863087	1453331	1506231	2863087	transposase,protease	Streptococcus_phage(28.57%)	58	NA	NA
WP_002296623.1|1453331_1454627_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002303262.1|1455077_1455320_-	DUF3781 domain-containing protein	NA	NA	NA	NA	NA
WP_002303421.1|1455865_1456396_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002303420.1|1456577_1457234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303419.1|1457360_1457834_-	trimethoprim-resistant dihydrofolate reductase DfrF	NA	F8SJN4	Pseudomonas_phage	45.1	3.0e-21
WP_002296683.1|1458501_1459716_-	ammonium transporter	NA	NA	NA	NA	NA
WP_002290686.1|1460056_1460299_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002295944.1|1460330_1460888_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002295945.1|1460900_1461089_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002295947.1|1461101_1461668_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002295138.1|1462897_1463371_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_002295139.1|1463379_1463607_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002295142.1|1465798_1466170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291278.1|1466425_1466668_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002296679.1|1466699_1467602_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002291274.1|1467614_1467803_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002296677.1|1467816_1468380_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002300977.1|1468417_1469311_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.0	5.2e-59
WP_002296674.1|1469388_1470327_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002296672.1|1470360_1470711_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002296671.1|1470743_1471646_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_002296670.1|1471638_1472496_-	glycosyltransferase family 8 protein	NA	A0ZYL4	Archaeal_BJ1_virus	27.1	1.3e-19
WP_002296669.1|1472829_1473639_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002296667.1|1473678_1474176_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002321681.1|1474820_1475144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296665.1|1475307_1475562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296663.1|1475631_1475877_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296662.1|1475952_1476318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|1477592_1478888_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002302440.1|1479126_1480428_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002293303.1|1480531_1480732_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	77.3	3.9e-23
WP_002296656.1|1481483_1482197_-	HAD family phosphatase	NA	A0A1D8KPI1	Synechococcus_phage	23.0	5.4e-06
WP_002296654.1|1482189_1483275_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002296653.1|1483291_1483735_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002321678.1|1483768_1484122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296650.1|1484233_1484635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296648.1|1484671_1485181_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002303107.1|1485202_1486060_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002330536.1|1486469_1487720_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	3.0e-113
WP_002296646.1|1487860_1488694_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002303106.1|1488707_1489505_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002321677.1|1489537_1489822_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002296641.1|1489818_1490820_-	2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	29.0	2.8e-24
WP_002296640.1|1490821_1491724_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A1D8KGX1	Synechococcus_phage	35.3	3.3e-53
WP_002296639.1|1491886_1492735_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296638.1|1493379_1493586_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_002296637.1|1493787_1494789_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	31.8	2.5e-09
WP_002311095.1|1494793_1496707_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_002296634.1|1496874_1497381_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002296633.1|1497540_1497981_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002296632.1|1498006_1499164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296631.1|1499166_1499523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296629.1|1499820_1500795_-	LPXTG-anchored fibrinogen/nidogen-binding adhesin SgrA	NA	NA	NA	NA	NA
WP_002296628.1|1500990_1501830_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002296627.1|1502014_1502902_+	rotamase	NA	NA	NA	NA	NA
WP_002311093.1|1503494_1504190_-	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.5	1.0e-22
WP_002296624.1|1504173_1504572_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287107.1|1504980_1506231_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
>prophage 5
NZ_CP027517	Enterococcus faecium strain AUSMDU00004024 chromosome, complete genome	2863087	1514081	1537531	2863087	integrase,transposase	Streptococcus_phage(40.0%)	20	1509271:1509286	1518992:1519007
1509271:1509286	attL	AAAGGATACTTTTTTT	NA	NA	NA	NA
WP_000997695.1|1514081_1515260_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_000222572.1|1515415_1516369_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002288357.1|1516425_1517553_+|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	55.5	1.8e-109
WP_010729348.1|1517770_1518913_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	32.4	4.5e-39
WP_010729347.1|1518917_1519103_-	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
1518992:1519007	attR	AAAAAAAGTATCCTTT	NA	NA	NA	NA
WP_002353648.1|1519456_1519702_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010729346.1|1519695_1520097_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_106913972.1|1520242_1522090_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	48.4	2.4e-154
WP_010729344.1|1522112_1523879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729343.1|1523891_1524686_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_010729341.1|1526190_1526838_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_010729340.1|1526921_1528349_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_010729339.1|1528422_1529502_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_010729338.1|1529504_1531136_-	mannitol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010729337.1|1531438_1532110_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010729336.1|1532828_1532999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000202380.1|1533122_1534442_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
WP_010729334.1|1534950_1535403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729333.1|1535409_1535958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000202380.1|1536211_1537531_-|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
>prophage 6
NZ_CP027517	Enterococcus faecium strain AUSMDU00004024 chromosome, complete genome	2863087	1680517	1689677	2863087		Streptococcus_phage(83.33%)	13	NA	NA
WP_002341493.1|1680517_1680724_-	excisionase	NA	A0A1S5SF07	Streptococcus_phage	87.3	1.1e-25
WP_010729705.1|1680716_1681859_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	35.4	1.5e-63
WP_153274509.1|1682075_1682228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008788621.1|1682370_1683006_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012386611.1|1683511_1683598_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_000691736.1|1683613_1685533_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	99.5	0.0e+00
WP_011058338.1|1685633_1685819_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	67.9	3.9e-17
WP_001227347.1|1685878_1686232_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
WP_013670292.1|1686436_1686508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022278534.1|1686735_1687155_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_025481129.1|1687180_1687387_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158003447.1|1687763_1688429_+	sugar diacid utilization regulator	NA	NA	NA	NA	NA
WP_002289374.1|1688510_1689677_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.7	1.9e-24
>prophage 7
NZ_CP027517	Enterococcus faecium strain AUSMDU00004024 chromosome, complete genome	2863087	1720433	1773250	2863087	tRNA,transposase,protease	Streptococcus_phage(14.29%)	52	NA	NA
WP_002294137.1|1720433_1722143_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002294136.1|1722210_1723479_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002294135.1|1723639_1724440_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002294134.1|1724436_1725249_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_002297404.1|1725657_1726908_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002293875.1|1727224_1727782_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002293877.1|1727784_1728507_-	UMP kinase	NA	NA	NA	NA	NA
WP_002293878.1|1728642_1729524_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293880.1|1729622_1730405_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293881.1|1730763_1731243_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326698.1|1731459_1732551_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002326699.1|1732543_1732672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288430.1|1732675_1733221_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_002288432.1|1733674_1735366_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	2.9e-74
WP_002288434.1|1735785_1736733_-	carbamate kinase	NA	NA	NA	NA	NA
WP_002288437.1|1736847_1737867_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288439.1|1737957_1739187_-	arginine deiminase	NA	NA	NA	NA	NA
WP_002288442.1|1739647_1740349_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002301319.1|1740957_1741974_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	5.4e-60
WP_002288445.1|1741970_1742435_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288446.1|1742441_1742984_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288447.1|1742967_1743792_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002288449.1|1743880_1744861_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002288451.1|1744884_1746369_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002288452.1|1746380_1747370_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_002288457.1|1747617_1747785_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_010729586.1|1747846_1749658_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288459.1|1749654_1750020_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_002288461.1|1750182_1750578_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288462.1|1750595_1751558_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002293902.1|1751557_1751770_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_106913973.1|1751790_1752489_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002289886.1|1752508_1753051_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002301321.1|1753182_1754187_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293904.1|1754183_1755173_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293905.1|1755169_1755976_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_002293906.1|1756141_1757098_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002296121.1|1757174_1757693_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002296119.1|1757780_1757930_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002288531.1|1758157_1758604_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002305724.1|1758798_1760694_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002303934.1|1761018_1761993_-	choloylglycine hydrolase family protein	NA	M1H001	Paramecium_bursaria_Chlorella_virus	29.7	3.0e-23
WP_002296332.1|1762558_1763125_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296334.1|1763379_1764711_+	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_002296335.1|1764676_1765027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296337.1|1765538_1765883_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002301399.1|1766148_1767108_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002287776.1|1767297_1767894_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002287775.1|1768017_1769817_+	glycerophosphoryl diester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002297633.1|1770094_1770307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311774.1|1771169_1772129_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002295743.1|1772341_1773250_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP027517	Enterococcus faecium strain AUSMDU00004024 chromosome, complete genome	2863087	1778240	1974693	2863087	tRNA,transposase,terminase,portal,capsid,plate,head,holin,protease,integrase,tail	Streptococcus_phage(23.68%)	192	1772231:1772290	1908747:1908787
1772231:1772290	attL	ACCCGTGGTGCTAGTTAATTTTTTCCTAGAGGAAAATGTCTAAACATGTTGGTAAATCAA	NA	NA	NA	NA
WP_002288577.1|1778240_1778726_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
1772231:1772290	attL	ACCCGTGGTGCTAGTTAATTTTTTCCTAGAGGAAAATGTCTAAACATGTTGGTAAATCAA	NA	NA	NA	NA
WP_002305727.1|1778748_1779507_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288581.1|1779522_1780701_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
WP_002303943.1|1780930_1783051_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.0	8.2e-220
WP_002297185.1|1783167_1784463_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002296838.1|1784795_1785521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288586.1|1785510_1786020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288588.1|1786089_1787538_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288590.1|1787537_1788254_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288595.1|1788234_1788585_-	SdpI family protein	NA	NA	NA	NA	NA
WP_002288592.1|1788728_1789502_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002302293.1|1791779_1792082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002323892.1|1793225_1793540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1793656_1794835_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321266.1|1795171_1795411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289617.1|1795772_1796033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289618.1|1796216_1796714_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289619.1|1796843_1797554_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289620.1|1797566_1799231_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002300930.1|1799435_1800098_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002303949.1|1800107_1800923_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288989.1|1801184_1801628_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002321036.1|1801761_1802100_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288986.1|1802087_1802465_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288985.1|1802688_1803882_+	MFS transporter	NA	NA	NA	NA	NA
WP_002288984.1|1804047_1804470_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002321037.1|1804864_1805059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288983.1|1805055_1805550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288982.1|1805711_1806884_-	class C sortase	NA	NA	NA	NA	NA
WP_002288981.1|1807089_1807905_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002288979.1|1808054_1808501_-	cell wall anchor	NA	NA	NA	NA	NA
WP_158003446.1|1808497_1809502_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002352916.1|1809541_1809871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305732.1|1809996_1812324_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002288970.1|1813165_1813459_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002288969.1|1813861_1815040_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	31.1	1.4e-30
WP_002300928.1|1815143_1815458_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288966.1|1815564_1815780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288964.1|1816079_1816322_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288962.1|1816308_1816737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002299190.1|1816888_1818436_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002287659.1|1818537_1818891_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002285758.1|1818880_1819075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956687.1|1819205_1820368_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002289210.1|1820932_1821307_-	VOC family protein	NA	NA	NA	NA	NA
WP_002296814.1|1821329_1822730_-	beta-fructofuranosidase	NA	NA	NA	NA	NA
WP_002289214.1|1822733_1823144_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002289215.1|1823161_1823653_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289216.1|1823662_1824454_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002289217.1|1824446_1825220_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289218.1|1825375_1827910_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002289219.1|1827991_1828864_-	ROK family protein	NA	NA	NA	NA	NA
WP_002289220.1|1828899_1829367_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002289221.1|1829376_1830846_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002296810.1|1830916_1832335_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_002296809.1|1832456_1833437_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_002295743.1|1833569_1834478_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_086956705.1|1834764_1835927_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.5	1.6e-79
1834530:1835569	attR	TTGATTTACCAACATGTTTAGACATTTTCCTCTAGGAAAAAATTAACTAGCACCACGGGTATAATATCATTTATTTTTATCTGGCAATAGCTGTTTAAAGATATATGTGGAATGGCAACACTTTTTTTGACAAAAATTATAAGGTATTGCGTAAGCTTGCTGCTGGTGTTCCGACTGCCCTTGACAACGAGCCTCCTCGAATCTGATTCTCTAAGGCAGAAGCTCATTCAAATAATTAAGGTGCCTCGCCACCGGTATCACATCCGAGCTCATTATCAAGGATTCGCTGCGCCAATCTCTGCTGTCGAAAACTGATCGGTGTCTCATAGCCTAACGTGCCGTGCAGCCGGATGGTATTCCACCAATGGACGTAATCAAATAGCTCTAATCGCAAATTAGCCAATGTCTCAAAGCGGTATTGATGAACGAATTCTACTTTGACAGATTTATAGGTGGATTCTGCAACGGCGTTATCATAGGGGCAGCCTTTTTTGCTTAAGGAACGCGTGATATTAAAGGCCCATAAAATTTCGTCAATCGTCTGGTTATCGAATTCTTTTCCACGATCCGTGTGAAAAAGTTGTACATTATTCAACGAGTACGGAATCTTTGCAAAAGCTTCTTTGACTAACGTCGCATCTTTCTTCTCCCCGCATGAATAGCCGATGATTTCTCGATTAAACAAATCAAGAATCAGGCAGATATACTGCCATTTCTTCCCAACACGAACATAGGTAAGGTCGGTTACAATCGCTTCTAATGACTTTTCCTGTAGGAAGGTTCCGTCTAGAATATTGGCGGTCTTGGCTTCGTTACAAGTAGAAGAATGGAATTTGAAATGAGCCAATGTGTATGTTGAACGCAAGCCACGCTGTTTCATCATACGGCCGATTCTGCGTTGACTCACTTGAAGACCTAGATTGGCCAAGCACTGCTTCAGCTTCCTGGTACCATAAGCTTTTCGATTGCGAATAAATTCTTCTTGAACGAGTTCTTCCAGTTCTGATTCATCTTCAACTGGTTTGGCTTGATAATAATAG	NA	NA	NA	NA
WP_002305710.1|1836019_1836529_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
1834530:1835569	attR	TTGATTTACCAACATGTTTAGACATTTTCCTCTAGGAAAAAATTAACTAGCACCACGGGTATAATATCATTTATTTTTATCTGGCAATAGCTGTTTAAAGATATATGTGGAATGGCAACACTTTTTTTGACAAAAATTATAAGGTATTGCGTAAGCTTGCTGCTGGTGTTCCGACTGCCCTTGACAACGAGCCTCCTCGAATCTGATTCTCTAAGGCAGAAGCTCATTCAAATAATTAAGGTGCCTCGCCACCGGTATCACATCCGAGCTCATTATCAAGGATTCGCTGCGCCAATCTCTGCTGTCGAAAACTGATCGGTGTCTCATAGCCTAACGTGCCGTGCAGCCGGATGGTATTCCACCAATGGACGTAATCAAATAGCTCTAATCGCAAATTAGCCAATGTCTCAAAGCGGTATTGATGAACGAATTCTACTTTGACAGATTTATAGGTGGATTCTGCAACGGCGTTATCATAGGGGCAGCCTTTTTTGCTTAAGGAACGCGTGATATTAAAGGCCCATAAAATTTCGTCAATCGTCTGGTTATCGAATTCTTTTCCACGATCCGTGTGAAAAAGTTGTACATTATTCAACGAGTACGGAATCTTTGCAAAAGCTTCTTTGACTAACGTCGCATCTTTCTTCTCCCCGCATGAATAGCCGATGATTTCTCGATTAAACAAATCAAGAATCAGGCAGATATACTGCCATTTCTTCCCAACACGAACATAGGTAAGGTCGGTTACAATCGCTTCTAATGACTTTTCCTGTAGGAAGGTTCCGTCTAGAATATTGGCGGTCTTGGCTTCGTTACAAGTAGAAGAATGGAATTTGAAATGAGCCAATGTGTATGTTGAACGCAAGCCACGCTGTTTCATCATACGGCCGATTCTGCGTTGACTCACTTGAAGACCTAGATTGGCCAAGCACTGCTTCAGCTTCCTGGTACCATAAGCTTTTCGATTGCGAATAAATTCTTCTTGAACGAGTTCTTCCAGTTCTGATTCATCTTCAACTGGTTTGGCTTGATAATAATAG	NA	NA	NA	NA
WP_002302055.1|1836867_1837821_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_077828749.1|1837773_1838010_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002305709.1|1838429_1839551_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_002321361.1|1839878_1841288_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_002289053.1|1841284_1842013_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	5.1e-36
WP_002289055.1|1842140_1843052_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	42.2	1.1e-59
WP_002289057.1|1843068_1844076_-	lipoprotein	NA	A0A1S5SEZ8	Streptococcus_phage	63.9	4.8e-117
WP_002305708.1|1844072_1846202_-	FUSC family protein	NA	A0A1S5SF30	Streptococcus_phage	60.3	1.8e-182
WP_002296840.1|1846502_1847690_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002298631.1|1848734_1850561_-	group II intron reverse transcriptase/maturase	NA	H7BVW2	unidentified_phage	26.8	3.7e-11
WP_002288938.1|1852794_1853184_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	65.9	1.4e-40
WP_002305705.1|1853233_1854130_-	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	29.7	1.1e-16
WP_002288935.1|1854132_1855980_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_002288934.1|1856076_1856577_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.6	7.0e-53
WP_002298822.1|1856589_1856811_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	87.7	4.5e-28
WP_002305703.1|1856815_1856953_-	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286934.1|1856949_1858134_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	60.8	1.9e-141
WP_002286933.1|1858389_1858644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286932.1|1858668_1859811_-	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	62.1	1.7e-126
WP_002349191.1|1859870_1861223_-	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	64.4	3.8e-162
WP_002305701.1|1861293_1861647_-	DNA-damage-inducible protein J	NA	NA	NA	NA	NA
WP_002286926.1|1861647_1862022_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	62.9	1.1e-34
WP_002286925.1|1862034_1862349_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.7e-25
WP_002305699.1|1862462_1865690_-	fibrinogen-binding MSCRAMM adhesin Fss3	NA	NA	NA	NA	NA
WP_002286921.1|1865768_1866431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002353637.1|1867047_1867278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002318491.1|1867283_1867583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302755.1|1868576_1869785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020944989.1|1869899_1870916_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.7	9.8e-62
WP_002302122.1|1870926_1871124_-|holin	holin	holin	A0A0S2MYF6	Enterococcus_phage	85.9	7.8e-24
WP_002332427.1|1871139_1871382_-|holin	holin	holin	D2J075	Enterococcus_phage	63.3	1.2e-21
WP_002332428.1|1871416_1871554_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002332429.1|1871555_1872002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729422.1|1872164_1874225_-|plate	BppU family phage baseplate upper protein	plate	A0A249XZH9	Enterococcus_phage	44.9	1.7e-65
WP_002290629.1|1874242_1875067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002332431.1|1875070_1876120_-	hypothetical protein	NA	Q5K5I4	Oenococcus_phage	27.9	1.9e-31
WP_002350711.1|1876116_1876989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350712.1|1876989_1880838_-	tape measure protein	NA	A0A0M5M3L4	Enterococcus_phage	76.0	0.0e+00
WP_002290636.1|1880837_1881029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002329391.1|1881052_1881364_-	hypothetical protein	NA	A0A0S2MY76	Enterococcus_phage	44.8	4.0e-14
WP_002332434.1|1881488_1882049_-|tail	phi13 family phage major tail protein	tail	V5UQL2	Enterococcus_phage	46.2	3.4e-40
WP_002329393.1|1882064_1882436_-	hypothetical protein	NA	A0A060ANH4	Enterococcus_phage	46.2	2.5e-23
WP_002350714.1|1882432_1882828_-	hypothetical protein	NA	C0LZZ2	Enterococcus_phage	44.5	4.3e-21
WP_002342516.1|1882824_1883160_-|head	phage head closure protein	head	A0A249XUC8	Enterococcus_phage	44.1	2.2e-18
WP_002350715.1|1883163_1883490_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_002350716.1|1883504_1884698_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	55.4	1.5e-114
WP_002350717.1|1884694_1885372_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	51.0	4.9e-49
WP_002350718.1|1885406_1886627_-|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	38.5	1.2e-61
WP_010729418.1|1888181_1888943_-	GIY-YIG nuclease family protein	NA	A0A220BXN1	Staphylococcus_phage	45.9	7.9e-40
WP_010729417.1|1889035_1889194_+	ribbon-helix-helix domain-containing protein	NA	A0A0A7RUX5	Clostridium_phage	65.9	5.3e-07
WP_002290653.1|1889660_1890182_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	34.2	1.1e-16
WP_002350721.1|1890283_1890448_+	YjzC family protein	NA	A0A0A7RTS6	Clostridium_phage	69.8	3.6e-14
WP_016922443.1|1890604_1890922_-	HNH endonuclease	NA	A0A1B1P8D2	Bacillus_phage	39.8	2.0e-13
WP_016922444.1|1890922_1891468_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002304479.1|1892663_1893077_-	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.1e-56
WP_012197617.1|1893563_1893851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020944994.1|1893980_1894250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012197625.1|1894246_1894777_-	DUF1642 domain-containing protein	NA	A0A059T7S4	Listeria_phage	37.2	1.8e-11
WP_012197627.1|1894769_1895084_-	hypothetical protein	NA	D2IZY1	Enterococcus_phage	72.7	4.6e-34
WP_074394665.1|1895083_1895389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296606.1|1895385_1895547_-	antitoxin	NA	NA	NA	NA	NA
WP_002350665.1|1895543_1895861_-	VRR-NUC domain-containing protein	NA	A0A1B0YA93	Lactobacillus_phage	61.5	3.6e-31
WP_012197635.1|1896107_1898420_-	phage/plasmid primase P4 family domain-containing protein	NA	R4IBW2	Listeria_phage	55.9	1.3e-250
WP_012197636.1|1898434_1898935_-	DUF669 domain-containing protein	NA	A8ATF2	Listeria_phage	52.9	1.1e-34
WP_002350668.1|1898936_1899410_-	transcriptional regulator	NA	A8ATW6	Listeria_phage	43.9	7.7e-09
WP_002350669.1|1899400_1900750_-	DEAD/DEAH box helicase	NA	A0A0P0ID30	Lactobacillus_phage	53.4	4.1e-132
WP_012197638.1|1900724_1901411_-	AAA family ATPase	NA	A0A1P8VVS4	Streptococcus_phage	52.7	1.1e-61
WP_002350671.1|1901529_1901856_-	DUF5406 family protein	NA	F0PIH7	Enterococcus_phage	57.8	1.6e-26
WP_044384563.1|1901852_1902284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002329420.1|1902733_1903213_-	siphovirus Gp157 family protein	NA	E5DV79	Deep-sea_thermophilic_phage	49.0	5.3e-34
WP_002350675.1|1903145_1903463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002332465.1|1903630_1904089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002325021.1|1904391_1904640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002315391.1|1904652_1904838_-	helix-turn-helix transcriptional regulator	NA	Q5YAA3	Bacillus_phage	56.7	8.4e-12
WP_002315392.1|1905141_1905516_+	helix-turn-helix transcriptional regulator	NA	O03970	Lactobacillus_phage	38.7	3.2e-18
WP_002350678.1|1905520_1905949_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_012197642.1|1905998_1906652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002350679.1|1906787_1907354_+	hypothetical protein	NA	A0A0P0IXE0	Lactobacillus_phage	92.3	1.9e-06
WP_012197643.1|1907469_1908606_+|integrase	site-specific integrase	integrase	A0A1P8BMN3	Lactococcus_phage	36.8	8.4e-54
WP_002286913.1|1908737_1909085_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002293716.1|1909970_1910492_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002297190.1|1910661_1911453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290277.1|1911577_1911829_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002290274.1|1911840_1912116_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002293714.1|1912368_1912923_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002297192.1|1913001_1913523_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002293710.1|1913526_1914105_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002293709.1|1914216_1915635_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002293708.1|1915655_1915994_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002297194.1|1915953_1916457_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_002293705.1|1916587_1917292_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
WP_002297195.1|1917288_1919025_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002305697.1|1919127_1921599_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	29.2	3.1e-45
WP_002289807.1|1921923_1922814_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_002305696.1|1923010_1923493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289810.1|1923700_1924066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322761.1|1924266_1924584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287105.1|1925311_1926286_-	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	5.4e-25
WP_002297404.1|1926695_1927946_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002305694.1|1928231_1928489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042959742.1|1930816_1931392_-	hypothetical protein	NA	Q9MCC6	Lactobacillus_phage	35.9	4.8e-13
WP_094932120.1|1931472_1932634_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	2.7e-79
WP_002294835.1|1933008_1933578_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_002323057.1|1933651_1934941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010721082.1|1935294_1936143_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_002323055.1|1936156_1937230_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_002305688.1|1937219_1939391_+	transglutaminase	NA	NA	NA	NA	NA
WP_059355943.1|1939502_1941659_-	copper/silver-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	32.3	2.9e-71
WP_002349136.1|1941801_1943988_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.7	1.4e-121
WP_002289040.1|1943987_1944197_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_002294855.1|1944209_1944650_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002349135.1|1944723_1945197_-	hypothetical protein	NA	A0A097BYE2	Leuconostoc_phage	28.8	1.1e-10
WP_002297185.1|1945423_1946719_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002288779.1|1947028_1948495_-	amino acid permease	NA	NA	NA	NA	NA
WP_002305684.1|1948805_1950890_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.7	9.9e-117
WP_002288776.1|1951413_1951773_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002323072.1|1951802_1952144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305683.1|1952140_1952815_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002305681.1|1953608_1954907_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002305679.1|1954946_1956137_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002348809.1|1956157_1956685_-	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_002304681.1|1956731_1959521_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.1e-89
WP_002288762.1|1959667_1959868_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002323868.1|1960319_1960640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|1960917_1962213_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002288760.1|1962664_1963783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304680.1|1964253_1965561_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_002340453.1|1965679_1966879_+	YdcF family protein	NA	NA	NA	NA	NA
WP_002291751.1|1969389_1969893_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_059355914.1|1970015_1970780_-	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	26.1	1.7e-05
WP_002289551.1|1970887_1971163_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002312284.1|1972728_1972929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010782560.1|1973733_1974693_+|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP027517	Enterococcus faecium strain AUSMDU00004024 chromosome, complete genome	2863087	2006636	2071825	2863087	transposase,holin	Streptococcus_phage(31.25%)	60	NA	NA
WP_074398935.1|2006636_2007977_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.0	1.9e-65
WP_002296623.1|2008133_2009429_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002291695.1|2009563_2010010_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.8	1.6e-19
WP_002287321.1|2010036_2010213_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002287322.1|2010374_2010803_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_002348657.1|2010894_2011755_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_002291691.1|2011848_2012142_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002313517.1|2012214_2013942_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	62.9	2.4e-209
WP_002291688.1|2014154_2015081_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.8	2.3e-89
WP_010782557.1|2015225_2016659_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002305593.1|2016658_2018062_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002294948.1|2018291_2019194_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010782556.1|2019234_2021121_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002348652.1|2022404_2024189_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	7.1e-47
WP_002314690.1|2024188_2025940_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.4	1.6e-56
WP_002291670.1|2026081_2026306_-	YneF family protein	NA	NA	NA	NA	NA
WP_002348650.1|2026556_2028143_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_002348649.1|2028208_2029984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002308625.1|2030194_2031097_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	30.7	1.5e-21
WP_025480886.1|2031375_2033721_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_000997695.1|2033961_2035140_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002348961.1|2035229_2035496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305582.1|2035488_2035812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059355912.1|2035823_2037080_-	lipase	NA	NA	NA	NA	NA
WP_010782554.1|2037076_2037472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348958.1|2037514_2037766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348957.1|2037765_2038161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002291653.1|2038514_2039516_-	catabolite control protein A	NA	NA	NA	NA	NA
WP_002313499.1|2039725_2040829_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_002348956.1|2040891_2041494_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_002308608.1|2041496_2041937_-	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_002308607.1|2042061_2043000_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.2	5.5e-75
WP_002296128.1|2043014_2044040_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002289570.1|2044083_2044914_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002289568.1|2044928_2045867_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_002289566.1|2046033_2046384_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002322015.1|2046383_2046701_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_002303617.1|2047000_2048569_-	daptomycin-sensing surface protein LiaX	NA	NA	NA	NA	NA
WP_002299434.1|2048668_2049436_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_074398943.1|2049432_2050473_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_002297218.1|2050594_2051890_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002289490.1|2052208_2052886_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_002289489.1|2052898_2053657_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	1.2e-19
WP_002303220.1|2053672_2054479_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.4	1.0e-13
WP_002294978.1|2054493_2055378_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_002292761.1|2055377_2056298_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_002292763.1|2056412_2057270_-	phosphate ABC transporter substrate-binding protein PstS	NA	NA	NA	NA	NA
WP_002300487.1|2057606_2059055_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_002305568.1|2059206_2060100_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002292768.1|2060083_2060770_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.7	2.5e-29
WP_096157771.1|2060874_2061976_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_002294984.1|2062101_2064636_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002294985.1|2064857_2065409_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_002294986.1|2065536_2066256_-	ComF family protein	NA	NA	NA	NA	NA
WP_002303218.1|2066252_2067566_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5S6	Streptococcus_phage	37.9	1.8e-63
WP_002292778.1|2067646_2067967_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002294988.1|2068074_2068362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303217.1|2068488_2069133_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	50.2	6.0e-49
WP_002292782.1|2069191_2069899_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002297218.1|2070529_2071825_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 10
NZ_CP027517	Enterococcus faecium strain AUSMDU00004024 chromosome, complete genome	2863087	2730075	2736589	2863087		Streptococcus_phage(83.33%)	8	NA	NA
WP_002297356.1|2730075_2730783_+	DNA methylase	NA	A0A1S5SEK0	Streptococcus_phage	50.4	5.8e-53
WP_002297354.1|2730772_2731063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297353.1|2731321_2732506_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
WP_002317225.1|2732502_2732640_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|2733385_2735296_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033658092.1|2735399_2735624_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002297350.1|2735636_2736140_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_002297349.1|2736199_2736589_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
>prophage 11
NZ_CP027517	Enterococcus faecium strain AUSMDU00004024 chromosome, complete genome	2863087	2752053	2789146	2863087	integrase,transposase	Bacillus_phage(40.0%)	31	2738829:2738844	2793767:2793782
2738829:2738844	attL	AAGAAAAACAAGCTCC	NA	NA	NA	NA
WP_002303350.1|2752053_2753013_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_010729817.1|2752999_2754331_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_059355941.1|2754464_2760392_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_002332818.1|2761009_2761444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|2762584_2763763_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002303350.1|2764072_2765032_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002297333.1|2765771_2766158_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_002311665.1|2766955_2767288_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077828743.1|2767583_2767739_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002297326.1|2769595_2771212_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_002317220.1|2771329_2771548_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297325.1|2771742_2772204_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	1.5e-12
WP_002304820.1|2772396_2772636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297324.1|2772659_2774183_-	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_002322279.1|2774200_2774323_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_002304819.1|2774352_2775336_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_002297320.1|2775359_2775509_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002297319.1|2775529_2775907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297318.1|2775938_2776118_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002297316.1|2776132_2776402_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_010729277.1|2776924_2778667_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-30
WP_010729813.1|2778650_2780405_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	1.3e-24
WP_002302405.1|2780514_2781084_-	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_002305512.1|2781101_2782526_-	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	26.4	5.9e-20
WP_074394433.1|2783324_2783909_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002297302.1|2784239_2784473_-	iron-dependent repressor	NA	NA	NA	NA	NA
WP_010729812.1|2784487_2785438_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010729271.1|2785434_2786277_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_010729270.1|2786278_2786998_-	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.7	1.6e-18
WP_074394656.1|2787689_2787848_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010729268.1|2787919_2789146_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2793767:2793782	attR	GGAGCTTGTTTTTCTT	NA	NA	NA	NA
>prophage 1
NZ_CP027518	Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence	259384	50773	80012	259384	transposase	Streptococcus_phage(40.0%)	29	NA	NA
WP_086322086.1|50773_51460_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	2.9e-126
WP_010729797.1|51507_52218_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010729798.1|52201_52936_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002301686.1|53152_54166_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301685.1|54176_54587_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002301684.1|54586_55054_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002301683.1|55071_55818_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002301682.1|55817_56627_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_080114943.1|58589_58991_-	hypothetical protein	NA	A0A0N9S006	Staphylococcus_phage	49.2	2.5e-24
WP_010729801.1|59217_60396_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	27.1	2.7e-23
WP_074394709.1|60443_61181_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_002299198.1|61338_62268_-	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	23.3	1.1e-06
WP_002299197.1|62340_62952_-	VanZ family protein	NA	NA	NA	NA	NA
WP_010729802.1|63167_64076_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002298377.1|66700_67117_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002298375.1|67113_67584_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_010729805.1|67597_68371_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298371.1|68384_69197_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002322451.1|69250_70216_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_010729806.1|70351_73075_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_010729807.1|73087_73720_+	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	27.9	3.0e-08
WP_077974475.1|73924_74152_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_086322080.1|74148_74487_+	antitoxin	NA	NA	NA	NA	NA
WP_002389879.1|74476_74746_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SCV8	Streptococcus_phage	48.8	8.7e-18
WP_002302440.1|74924_76226_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002296127.1|76454_78002_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002287659.1|78103_78457_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002285758.1|78446_78641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729749.1|78719_80012_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
>prophage 2
NZ_CP027518	Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence	259384	84681	126452	259384	integrase,transposase	Streptococcus_phage(23.08%)	36	80223:80240	127796:127813
80223:80240	attL	GTATCAAAAACAATCGAT	NA	NA	NA	NA
WP_002296840.1|84681_85869_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002298077.1|86403_87804_+	putative basic amino acid antiporter YfcC	NA	NA	NA	NA	NA
WP_002322961.1|87836_88004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002350223.1|88869_89730_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002350224.1|90149_91082_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_002339141.1|91124_91736_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	53.2	1.7e-56
WP_002339142.1|91755_92976_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	58.5	3.9e-57
WP_085910366.1|93033_93720_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.9e-127
WP_002331328.1|94209_94431_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002342384.1|94446_95289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729753.1|95351_97154_+	exonuclease DNA polymerase III epsilon subunit	NA	A0A0A7RWA3	Clostridium_phage	30.4	7.6e-33
WP_010729754.1|97212_98121_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_002336308.1|98670_99630_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	6.5e-31
WP_002313084.1|101018_101624_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	32.6	3.6e-19
WP_010729506.1|102658_103630_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	22.4	1.2e-05
WP_002322554.1|103724_105083_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002322555.1|105125_105992_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002313079.1|105988_106837_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002322556.1|106850_108323_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_010729757.1|108339_109212_+	ROK family protein	NA	NA	NA	NA	NA
WP_002292678.1|112474_112804_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002300557.1|112793_113081_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002292680.1|113364_114222_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
WP_002292681.1|114222_114771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044383156.1|115400_116081_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	3.2e-109
WP_074394729.1|116136_116322_+	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_094868189.1|116533_117220_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.9e-127
WP_002344897.1|117348_117705_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002344896.1|117694_117961_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002344895.1|118119_119121_+	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_008271463.1|120344_120590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311006.1|120687_120909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002319325.1|121972_122590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300314.1|123609_124779_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_002290383.1|125251_125806_+|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	46.1	8.6e-36
WP_002290382.1|125978_126452_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	44.2	2.3e-13
127796:127813	attR	ATCGATTGTTTTTGATAC	NA	NA	NA	NA
>prophage 3
NZ_CP027518	Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence	259384	164385	211246	259384	integrase,transposase,holin	Streptococcus_phage(31.58%)	44	162866:162883	170952:170969
162866:162883	attL	ACAAAAGCAACTAATTTT	NA	NA	NA	NA
WP_000997695.1|164385_165564_-|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_106913980.1|165863_166598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002328877.1|166594_167092_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002328876.1|167147_168056_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_071870188.1|168602_168770_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010729769.1|168843_170070_+|integrase	site-specific integrase	integrase	A0A097BYJ7	Leuconostoc_phage	24.2	3.2e-14
WP_002323453.1|170227_170845_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	36.7	2.5e-15
WP_002305056.1|171527_172523_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
170952:170969	attR	ACAAAAGCAACTAATTTT	NA	NA	NA	NA
WP_002322785.1|172617_173490_-	ROK family protein	NA	NA	NA	NA	NA
WP_002361237.1|173502_174930_-	glycoside hydrolase family 32 protein	NA	S6ATV4	Bacillus_phage	26.8	3.1e-29
WP_002323715.1|174983_176258_-	MFS transporter	NA	NA	NA	NA	NA
WP_002325884.1|176560_177514_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	1.3e-34
WP_002305052.1|177687_178119_-	antitoxin HicB	NA	F0PIL2	Enterococcus_phage	64.9	4.3e-43
WP_002305050.1|178958_179654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305049.1|179646_180084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287517.1|180099_180351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002324499.1|180350_180557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074399798.1|181004_181229_-	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	56.9	3.6e-09
WP_002295624.1|181418_181541_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002295625.1|181699_181957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301800.1|182466_183366_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002299811.1|183378_183975_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002303486.1|184320_186330_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	52.6	1.6e-111
WP_002313123.1|186340_187810_-	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_002313122.1|187870_189682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002330536.1|190651_191902_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	3.0e-113
WP_002322479.1|192037_192232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086968564.1|192479_193620_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.7	3.8e-78
WP_002296379.1|194122_195715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729773.1|195733_196156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296377.1|196157_196454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305788.1|196688_196958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086322097.1|197001_197667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002354485.1|197723_198410_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_074394719.1|199359_199563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002354485.1|200519_201206_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002285758.1|202694_202889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|202878_203232_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002296127.1|203333_204881_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002354485.1|205594_206281_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_001028141.1|206741_208181_-	bifunctional aminoglycoside N-acetyltransferase AAC(6')-Ie/aminoglycoside O-phosphotransferase APH(2'')-Ia	NA	A0A0N9SKF6	Staphylococcus_phage	100.0	8.5e-285
WP_025189010.1|208181_208574_-	GNAT family N-acetyltransferase	NA	A0A0N7GFH7	Staphylococcus_phage	96.9	1.4e-69
WP_002319817.1|210089_210770_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_010729776.1|210775_211246_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	33.6	1.5e-09
>prophage 1
NZ_CP027519	Enterococcus faecium strain AUSMDU00004024 plasmid unnamed2, complete sequence	48209	0	14419	48209	transposase	Streptococcus_phage(83.33%)	18	NA	NA
WP_002326827.1|0_897_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	97.9	1.1e-152
WP_001835296.1|988_1204_+	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	97.1	4.2e-31
WP_002326825.1|1221_1494_+	antitoxin	NA	A0A1X9I6E5	Streptococcus_phage	96.7	5.4e-07
WP_002332783.1|1495_2359_+	toxin zeta	NA	NA	NA	NA	NA
WP_011799058.1|3130_3817_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.7e-126
WP_000205227.1|4205_4430_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000233000.1|4444_5314_+	hypothetical protein	NA	A0A1X9I6C9	Streptococcus_phage	90.7	6.7e-152
WP_000662263.1|5294_6029_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
WP_001255866.1|6061_6970_+	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	E4ZFP8	Streptococcus_phage	100.0	2.8e-177
WP_002354485.1|7535_8222_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002349227.1|8424_8637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000357244.1|8798_9317_+	YfbU family protein	NA	NA	NA	NA	NA
WP_000774078.1|9323_9836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|9939_11235_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_002288897.1|11628_12252_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.1	1.8e-13
WP_002354485.1|12341_13028_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_000599739.1|13225_13831_+	cell filamentation protein	NA	NA	NA	NA	NA
WP_000170424.1|13846_14419_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	46.0	6.8e-36
>prophage 2
NZ_CP027519	Enterococcus faecium strain AUSMDU00004024 plasmid unnamed2, complete sequence	48209	24472	32518	48209	transposase	Streptococcus_phage(33.33%)	8	NA	NA
WP_002354485.1|24472_25159_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002323245.1|25779_26952_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_001280781.1|27103_27799_+	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	4.9e-36
WP_002305818.1|27776_28931_+	VanA-type vancomycin resistance histidine kinase VanS	NA	W8CYF6	Bacillus_phage	23.3	1.5e-13
WP_001059542.1|29145_30114_+	D-lactate dehydrogenase VanH-A	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	33.1	3.5e-40
WP_001079845.1|30106_31138_+	D-alanine--(R)-lactate ligase VanA	NA	NA	NA	NA	NA
WP_000402347.1|31143_31752_+	D-Ala-D-Ala dipeptidase VanX-A	NA	NA	NA	NA	NA
WP_002354485.1|31831_32518_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
