The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025149	Pseudomonas stutzeri strain SGAir0442 chromosome, complete genome	4524660	56982	69123	4524660	transposase	Bacillus_phage(85.71%)	7	NA	NA
WP_108241223.1|56982_59859_-	response regulator	NA	W8CYF6	Bacillus_phage	33.5	2.6e-27
WP_108241224.1|59986_61627_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.8	9.1e-17
WP_003282388.1|61619_62009_-	response regulator	NA	W8CYM9	Bacillus_phage	31.6	2.0e-07
WP_013981223.1|62005_64417_-	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	35.1	2.9e-27
WP_108241225.1|64652_65642_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	53.5	1.8e-97
WP_011911305.1|65708_66095_-	response regulator	NA	W8CYM9	Bacillus_phage	35.0	1.2e-12
WP_108241226.1|66144_69123_-	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	34.3	2.1e-27
>prophage 2
NZ_CP025149	Pseudomonas stutzeri strain SGAir0442 chromosome, complete genome	4524660	257716	343354	4524660	portal,tail,holin,protease,capsid,terminase,head,integrase,plate	uncultured_Caudovirales_phage(54.76%)	86	261351:261398	300814:300861
WP_108241288.1|257716_261205_-	type I restriction-modification system endonuclease	NA	G9FI19	Nocardia_phage	21.6	1.0e-09
261351:261398	attL	TCGTGGTGCCGGCACCAGGAGTCGAACCCGGGACCTACTGATTACAAG	NA	NA	NA	NA
WP_108241289.1|261516_262659_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	39.6	1.3e-70
WP_045158069.1|262655_262865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108241290.1|262943_263141_-	hypothetical protein	NA	A0A2H4J958	uncultured_Caudovirales_phage	69.0	2.3e-15
WP_079391064.1|263160_263715_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	33.6	1.5e-16
WP_033996891.1|263711_263936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033996893.1|263935_264136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033996895.1|264446_264737_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	53.1	5.7e-23
WP_033996897.1|264737_265031_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	47.1	3.2e-13
WP_033996900.1|265145_265538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108242490.1|265534_265705_-	antitoxin	NA	NA	NA	NA	NA
WP_052157654.1|265896_266472_-	hypothetical protein	NA	A0A2I7QN58	Vibrio_phage	28.0	7.9e-16
WP_108241291.1|266710_269437_-	bifunctional DNA primase/helicase	NA	A0A2H4J936	uncultured_Caudovirales_phage	54.2	3.2e-285
WP_033996905.1|269450_269684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108241292.1|269766_270120_-	hypothetical protein	NA	A0A2H4J947	uncultured_Caudovirales_phage	57.4	4.3e-25
WP_033996997.1|270116_270416_-	transcriptional regulator	NA	A0A2H4JAW0	uncultured_Caudovirales_phage	71.8	8.5e-30
WP_108241293.1|270517_271099_-	phage antirepressor protein	NA	A0A1U9AJ93	Stx1_converting_phage	53.9	1.4e-33
WP_108241294.1|271113_271575_-	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	67.3	2.9e-53
WP_108241295.1|271610_271847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108241296.1|271937_272354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108241297.1|272391_272700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108241298.1|272836_273148_+	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
WP_108241299.1|273144_273624_+	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_108241300.1|273691_274207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108242491.1|274247_275414_-	phage late control D family protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	78.1	9.3e-173
WP_033996919.1|275503_275944_-	oxidoreductase	NA	A0A2H4JG54	uncultured_Caudovirales_phage	83.6	5.9e-64
WP_108241301.1|275950_278635_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	36.1	4.4e-101
WP_079391068.1|278817_278934_-|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	72.7	8.6e-07
WP_108241302.1|278942_279242_-|tail	phage tail assembly protein	tail	E5E3Q1	Burkholderia_phage	64.6	9.7e-26
WP_108241303.1|279340_280171_-	hypothetical protein	NA	A0A0N7KZV8	Escherichia_phage	42.1	9.3e-34
WP_108241304.1|280182_280500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108241305.1|280796_281021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108241306.1|281104_281620_-|tail	phage major tail tube protein	tail	A0A2H4J916	uncultured_Caudovirales_phage	77.8	1.3e-75
WP_108241307.1|281668_282859_-|tail	phage tail protein	tail	A0A2H4JCP8	uncultured_Caudovirales_phage	90.2	3.0e-203
WP_108241308.1|283011_283587_-|tail	phage tail protein	tail	A0A2H4J924	uncultured_Caudovirales_phage	83.2	3.5e-48
WP_108241309.1|283588_285952_-	hypothetical protein	NA	A0A2R2YB20	Pseudomonas_phage	39.2	1.4e-26
WP_108242492.1|285951_286500_-|tail	phage tail protein I	tail	R4JET8	Burkholderia_phage	49.4	2.4e-46
WP_108241310.1|286492_287389_-|plate	baseplate assembly protein	plate	A0A088FQL4	Escherichia_phage	56.2	1.4e-83
WP_108241311.1|287385_287739_-|plate	baseplate assembly protein	plate	A0A2H4JE52	uncultured_Caudovirales_phage	85.7	1.1e-47
WP_108242493.1|287735_288269_-|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	62.1	6.3e-52
WP_108241312.1|288343_288796_-	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	71.2	7.7e-51
WP_108241313.1|288788_289313_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	73.9	5.8e-58
WP_108241314.1|289415_289859_-	DUF2570 domain-containing protein	NA	Q9ZXL5	Pseudomonas_virus	48.6	4.6e-24
WP_108241315.1|289855_290671_-	DUF3380 domain-containing protein	NA	A0A2H4JGJ9	uncultured_Caudovirales_phage	94.1	4.5e-142
WP_108241316.1|290667_290985_-|holin	phage holin, lambda family	holin	A0A2H4JFM8	uncultured_Caudovirales_phage	99.0	2.3e-49
WP_108242494.1|290977_291427_-	hypothetical protein	NA	A0A2H4J973	uncultured_Caudovirales_phage	97.3	3.1e-84
WP_108241317.1|291426_291636_-|tail	phage tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	98.6	2.0e-33
WP_108241318.1|291635_292106_-|head	head completion/stabilization protein	head	A0A2H4JCS4	uncultured_Caudovirales_phage	96.8	7.0e-79
WP_108241319.1|292204_293035_-|terminase	terminase	terminase	A0A2H4J948	uncultured_Caudovirales_phage	71.7	9.8e-84
WP_108241320.1|293037_294048_-|capsid	phage major capsid protein, P2 family	capsid	A0A2H4JCR7	uncultured_Caudovirales_phage	92.9	1.2e-173
WP_108241321.1|294075_294906_-|capsid	phage capsid protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	97.1	4.4e-145
WP_108241322.1|295056_296823_+|terminase	terminase	terminase	A0A2H4JGK4	uncultured_Caudovirales_phage	99.1	0.0e+00
WP_108241323.1|296822_297821_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	94.0	9.0e-185
WP_049324778.1|298298_299720_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_108241324.1|299912_300098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108241325.1|300962_302195_-	methyltransferase	NA	NA	NA	NA	NA
300814:300861	attR	TCGTGGTGCCGGCACCAGGAGTCGAACCCGGGACCTACTGATTACAAG	NA	NA	NA	NA
WP_108241326.1|302285_303662_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
WP_108241327.1|303654_304200_-	permease	NA	NA	NA	NA	NA
WP_108241328.1|304493_305600_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013981424.1|305676_306102_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
WP_045158014.1|306143_306452_-	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_108241329.1|306521_311216_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_108241330.1|311397_312978_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_108241331.1|313199_313913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108241332.1|314010_315795_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_017244720.1|315891_317256_-	inorganic triphosphatase	NA	NA	NA	NA	NA
WP_015278654.1|317369_318047_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_014595539.1|318088_319354_+	inorganic phosphate transporter	NA	M4QMY4	Ostreococcus_lucimarinus_virus	35.3	1.1e-57
WP_108241333.1|319472_320624_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_013981432.1|320669_321968_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_108241334.1|322001_323579_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_020306864.1|323705_324095_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_108241335.1|324097_326410_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_108241336.1|326507_329966_-	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_108241337.1|329972_332195_-	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_108241338.1|332191_334789_-	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_013981439.1|334790_335525_-	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_108241339.1|335521_335755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108241340.1|335762_337388_-	cellulose biosynthesis protein BcsG	NA	NA	NA	NA	NA
WP_049341196.1|337384_337567_-	cellulose biosynthesis protein BcsF	NA	NA	NA	NA	NA
WP_108241341.1|337563_339102_-	cellulose biosynthesis protein BcsE	NA	NA	NA	NA	NA
WP_013981444.1|339318_339705_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_053527126.1|339819_340554_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.7	5.5e-30
WP_014595553.1|340630_341962_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_011911526.1|341984_342890_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A127KMC2	Cyanophage	34.6	7.2e-40
WP_011911527.1|342886_343354_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP025149	Pseudomonas stutzeri strain SGAir0442 chromosome, complete genome	4524660	823190	892564	4524660	transposase	Escherichia_phage(23.53%)	60	NA	NA
WP_079761896.1|823190_824393_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	55.2	1.4e-110
WP_014595827.1|824755_825841_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_014595828.1|826024_827164_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_011912061.1|827163_828147_+	FAA hydrolase family protein	NA	NA	NA	NA	NA
WP_014595829.1|828136_828796_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_079327857.1|828877_830338_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_079327859.1|830526_832404_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.6	4.4e-31
WP_079761896.1|832449_833652_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	55.2	1.4e-110
WP_011912065.1|833840_834524_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_014595832.1|834527_835340_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_108241466.1|837213_838539_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.1	9.2e-52
WP_049324765.1|838600_838921_+	DUF2845 domain-containing protein	NA	NA	NA	NA	NA
WP_049341613.1|838995_839583_-	LysE family translocator	NA	NA	NA	NA	NA
WP_011912070.1|839684_840524_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_045633519.1|840719_841742_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.8	1.6e-35
WP_108241467.1|841769_843053_-	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011912072.1|843072_843993_-	histone deacetylase	NA	A0A1V0SJS0	Klosneuvirus	35.8	8.5e-12
WP_011912073.1|844063_844618_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_013981787.1|844694_845564_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_041755371.1|845560_846151_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011912076.1|846253_847111_-	metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	39.6	2.9e-38
WP_041755373.1|847229_847664_-	DUF411 domain-containing protein	NA	NA	NA	NA	NA
WP_013981791.1|847855_848395_+	DUF4345 domain-containing protein	NA	NA	NA	NA	NA
WP_014595842.1|848398_849094_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_108241468.1|849189_849975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108241469.1|850141_850798_-	two-component system response regulator NarL	NA	NA	NA	NA	NA
WP_108241470.1|850727_852704_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_095460607.1|852971_854573_+	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_011912084.1|854588_855047_+	universal stress protein	NA	NA	NA	NA	NA
WP_108241471.1|855061_856549_+	MFS transporter	NA	NA	NA	NA	NA
WP_108241472.1|856654_860413_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_108241473.1|860424_861963_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	44.2	1.4e-19
WP_102821068.1|861966_862722_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_058063803.1|862714_863506_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_108241474.1|863587_864547_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_004364961.1|864779_865187_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_108241475.1|865282_866167_+	cation transporter	NA	NA	NA	NA	NA
WP_004574636.1|866704_867994_+|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	9.5e-86
WP_108241476.1|868267_869116_-	chlorite dismutase	NA	NA	NA	NA	NA
WP_031297790.1|869353_869632_-	cytochrome c	NA	NA	NA	NA	NA
WP_011913346.1|869961_871047_+|transposase	IS5-like element ISPst12 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	31.9	5.6e-15
WP_108241477.1|871478_874247_+	dimethylsulfide dehydrogenase	NA	A0A077SK27	Escherichia_phage	25.8	9.3e-22
WP_108241478.1|874259_875240_+	respiratory nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	38.4	3.9e-23
WP_108241479.1|875256_875994_+	protein DdhD	NA	NA	NA	NA	NA
WP_108242497.1|876041_876818_+	dimethylsulfide dehydrogenase	NA	NA	NA	NA	NA
WP_051375859.1|876828_877914_+	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
WP_108241225.1|877980_878970_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	53.5	1.8e-97
WP_023444698.1|879293_881060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108241480.1|881077_882067_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_003281653.1|882310_882856_+	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_108241481.1|882852_884085_+	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
WP_108241482.1|884140_884692_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	41.2	6.4e-15
WP_053527335.1|884750_886223_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_014821503.1|886216_886876_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.7	1.3e-33
WP_108241483.1|886936_887587_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_108241484.1|887583_888420_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_108241485.1|888406_889078_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_108241486.1|889093_890539_-	long-chain acyl-CoA synthetase	NA	A0A1V0SBX8	Catovirus	22.9	8.3e-14
WP_108241487.1|890522_891212_-	thermostable hemolysin	NA	NA	NA	NA	NA
WP_079761896.1|891361_892564_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	55.2	1.4e-110
>prophage 4
NZ_CP025149	Pseudomonas stutzeri strain SGAir0442 chromosome, complete genome	4524660	1628428	1659650	4524660	transposase,tRNA,integrase	Stx2-converting_phage(28.57%)	30	1647259:1647276	1659702:1659719
WP_108241225.1|1628428_1629418_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	53.5	1.8e-97
WP_019405843.1|1629501_1630203_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_013982429.1|1630249_1630549_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_013982430.1|1630742_1631927_+	response regulator	NA	NA	NA	NA	NA
WP_011912820.1|1631923_1632406_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_049341455.1|1632413_1633340_-	transaldolase	NA	E3SQJ7	Cyanophage	36.2	2.1e-10
WP_108242505.1|1633471_1634479_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_049324674.1|1634583_1635696_+|integrase	site-specific integrase	integrase	L7TP61	Pseudomonas_virus	75.2	9.8e-164
WP_102895822.1|1635692_1635974_-	Pyocin activator protein PrtN	NA	A0A2K8HN48	Pseudomonas_phage	76.6	1.3e-32
WP_003291613.1|1636552_1637131_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_108241672.1|1637134_1638643_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.6	9.2e-149
WP_003291615.1|1638678_1639023_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	68.2	9.7e-38
WP_079390046.1|1639019_1639466_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_108241673.1|1640076_1641030_+|transposase	IS1595-like element ISAchd1 family transposase	transposase	NA	NA	NA	NA
WP_108242506.1|1643201_1643306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023444848.1|1643703_1645074_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_074857882.1|1645226_1646216_-	arsenic resistance protein	NA	NA	NA	NA	NA
WP_009686162.1|1646443_1647004_+	hypothetical protein	NA	NA	NA	NA	NA
1647259:1647276	attL	GCTTTTGGCCGGTTAGCG	NA	NA	NA	NA
WP_108241674.1|1647328_1648102_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_108241675.1|1648333_1649146_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004350206.1|1649142_1650039_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_108241676.1|1650071_1650521_-	cyanase	NA	NA	NA	NA	NA
WP_096316815.1|1650546_1651452_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.7	5.0e-33
WP_004350202.1|1651441_1652293_-	nitrate ABC transporter, permease protein	NA	NA	NA	NA	NA
WP_042924922.1|1652289_1653696_-	nitrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023082835.1|1653723_1655061_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023082836.1|1655057_1656197_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_108241677.1|1656219_1656780_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
WP_031668848.1|1656981_1658574_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_108241678.1|1659029_1659650_-|integrase	integrase	integrase	NA	NA	NA	NA
1659702:1659719	attR	CGCTAACCGGCCAAAAGC	NA	NA	NA	NA
>prophage 5
NZ_CP025149	Pseudomonas stutzeri strain SGAir0442 chromosome, complete genome	4524660	1693592	1751879	4524660	transposase,tRNA,protease	Escherichia_phage(11.11%)	43	NA	NA
WP_011911868.1|1693592_1695131_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_003458515.1|1695120_1695390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108241682.1|1697223_1698723_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_013983152.1|1698715_1699519_+	ATPase	NA	A0A2L1IVB6	Escherichia_phage	36.2	4.0e-34
WP_049324903.1|1700224_1701133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108241683.1|1703611_1704934_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_108241684.1|1704930_1705458_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_108241685.1|1705504_1706560_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
WP_108241686.1|1706908_1708588_-	tannase/feruloyl esterase family alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017245718.1|1708909_1709863_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_108242508.1|1710077_1711439_+	benzoate 1,2-dioxygenase large subunit	NA	NA	NA	NA	NA
WP_108241687.1|1711441_1711930_+	benzoate 1,2-dioxygenase small subunit	NA	NA	NA	NA	NA
WP_049341567.1|1711940_1712951_+	NADH oxidase	NA	NA	NA	NA	NA
WP_011912831.1|1713023_1713800_+	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	NA	NA	NA	NA
WP_011912832.1|1713907_1715254_+	MFS transporter	NA	NA	NA	NA	NA
WP_108241688.1|1715282_1716404_+	muconate cycloisomerase	NA	NA	NA	NA	NA
WP_013982442.1|1716418_1716709_+	muconolactone Delta-isomerase	NA	NA	NA	NA	NA
WP_019405856.1|1716780_1717719_+	catechol 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_108241689.1|1717846_1719070_+	benzoate transporter BenE	NA	NA	NA	NA	NA
WP_003458515.1|1719210_1719480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011911868.1|1719469_1721008_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_004423345.1|1721129_1721474_-	IS66 family insertion sequence hypothetical protein	NA	S5VXZ8	Leptospira_phage	33.7	1.1e-12
WP_004423344.1|1721470_1721761_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_108241690.1|1721850_1723113_+	porin	NA	NA	NA	NA	NA
WP_026006452.1|1729166_1729523_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	35.2	8.0e-11
WP_011913440.1|1729707_1731024_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017243949.1|1731141_1732203_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_019407311.1|1732249_1734244_-	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_108241691.1|1734429_1736025_-	isocitrate lyase	NA	NA	NA	NA	NA
WP_108241692.1|1736510_1737320_-	secretin	NA	NA	NA	NA	NA
WP_011913434.1|1737316_1737946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013982947.1|1737952_1738378_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017243945.1|1738370_1739537_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_014596824.1|1739614_1740985_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.8	1.7e-112
WP_108241693.1|1741070_1741709_-	lysogenization regulator HflD	NA	NA	NA	NA	NA
WP_108241694.1|1741705_1742833_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_011913428.1|1742900_1743341_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011913427.1|1743445_1745674_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011913426.1|1746029_1747286_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	79.6	2.4e-17
WP_013982942.1|1747345_1747609_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	4.7e-16
WP_026006451.1|1747827_1748190_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	39.6	2.3e-13
WP_011913423.1|1748219_1750490_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.4	9.6e-166
WP_014595397.1|1750676_1751879_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	54.4	2.0e-109
>prophage 6
NZ_CP025149	Pseudomonas stutzeri strain SGAir0442 chromosome, complete genome	4524660	2103369	2117143	4524660		uncultured_Caudovirales_phage(75.0%)	12	NA	NA
WP_011913132.1|2103369_2104038_+	BAX inhibitor (BI)-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	76.7	7.6e-87
WP_108241775.1|2104137_2105406_-	MFS transporter	NA	NA	NA	NA	NA
WP_048330491.1|2105634_2106027_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	9.0e-48
WP_108241776.1|2106026_2106386_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	63.3	1.5e-33
WP_108241777.1|2106385_2106688_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	58.0	9.2e-24
WP_108241778.1|2106684_2107017_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	71.6	6.5e-39
WP_108241779.1|2107013_2107997_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	75.2	4.9e-143
WP_108241780.1|2108081_2109086_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_108241781.1|2109116_2111756_-	PAS domain S-box protein	NA	A0A2K9L5I4	Tupanvirus	28.6	2.0e-13
WP_013982686.1|2111685_2112849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108241782.1|2113163_2114354_-	porin	NA	NA	NA	NA	NA
WP_108241783.1|2114611_2117143_-	pyrroloquinoline quinone biosynthesis protein PqqF	NA	A0A1V0SJA4	Klosneuvirus	29.0	3.5e-15
>prophage 7
NZ_CP025149	Pseudomonas stutzeri strain SGAir0442 chromosome, complete genome	4524660	2893282	2938937	4524660	tail,integrase,terminase	Pseudomonas_phage(69.23%)	68	2888144:2888160	2941546:2941562
2888144:2888160	attL	CCACCGGCCGCACCGGC	NA	NA	NA	NA
WP_108242007.1|2893282_2894299_-	hypothetical protein	NA	A0A059VF40	Pseudomonas_phage	42.1	1.5e-33
WP_108242008.1|2894295_2897871_-	DUF1983 domain-containing protein	NA	A0A0S2SYC5	Pseudomonas_phage	45.2	4.0e-283
WP_108242009.1|2897867_2898434_-|tail	tail assembly protein	tail	W0LI27	Edwardsiella_phage	50.5	5.7e-43
WP_108242522.1|2898390_2899152_-	hydrolase Nlp/P60	NA	A0A2I6PI52	Pseudomonas_phage	52.5	3.9e-71
WP_108242010.1|2899215_2899431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108242011.1|2899434_2900097_-|tail	phage minor tail protein L	tail	A0A2I6PIA7	Pseudomonas_phage	55.4	1.2e-71
WP_045158758.1|2900093_2900447_-	hypothetical protein	NA	K7P7R1	Enterobacteria_phage	41.4	2.2e-16
WP_108242012.1|2900443_2903503_-	hypothetical protein	NA	A0A0H5AWE4	Pseudomonas_phage	81.2	0.0e+00
WP_108242013.1|2903558_2903936_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_108242014.1|2903968_2904232_-	hypothetical protein	NA	A0A0H5ARS5	Pseudomonas_phage	92.7	3.0e-39
WP_108242015.1|2904279_2904591_-	hypothetical protein	NA	A0A0H5AUF4	Pseudomonas_phage	87.4	6.7e-46
WP_108242016.1|2904644_2905292_-|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	94.9	2.6e-108
WP_108242017.1|2905354_2905762_-	hypothetical protein	NA	A0A0H5ARK5	Pseudomonas_phage	94.8	1.9e-69
WP_108242018.1|2905764_2906160_-	hypothetical protein	NA	A0A0H5AWD5	Pseudomonas_phage	94.7	7.7e-63
WP_108242019.1|2906159_2906546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108242020.1|2906547_2906916_-	hypothetical protein	NA	A0A0H5AUF0	Pseudomonas_phage	61.8	5.2e-29
WP_108242021.1|2906916_2907105_-	hypothetical protein	NA	A0A0H5BBX8	Pseudomonas_phage	95.2	1.1e-24
WP_108242022.1|2907151_2908135_-	hypothetical protein	NA	A0A0H5ARK0	Pseudomonas_phage	94.8	1.9e-166
WP_108242023.1|2908147_2908894_-	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	96.0	7.3e-123
WP_108242523.1|2909016_2909514_-	DNA-binding protein	NA	A0A0H5ARR4	Pseudomonas_phage	65.8	5.5e-66
WP_108242024.1|2909772_2910003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045158744.1|2910030_2910282_-	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	58.2	3.9e-20
WP_108242025.1|2910289_2911375_-	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	48.7	7.7e-89
WP_108242026.1|2911374_2912727_-	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	93.3	9.8e-243
WP_108242027.1|2912729_2913977_-|terminase	terminase	terminase	A0A2R3UAD4	Siphoviridae_environmental_samples	77.8	8.1e-191
WP_108242028.1|2913957_2914518_-	hypothetical protein	NA	A0A2H4J1J5	uncultured_Caudovirales_phage	36.2	1.4e-12
WP_108242524.1|2914632_2914815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108242029.1|2914842_2915028_-	hypothetical protein	NA	A0A0H5ARJ1	Pseudomonas_phage	84.7	2.6e-21
WP_108242030.1|2915479_2915692_-	hypothetical protein	NA	A0A0H5ARQ8	Pseudomonas_phage	77.6	6.4e-24
WP_108242031.1|2915688_2915982_-	hypothetical protein	NA	A0A0H5AUD7	Pseudomonas_phage	37.0	7.3e-10
WP_108242032.1|2916585_2917176_-	hypothetical protein	NA	A0A0S2SYA9	Pseudomonas_phage	46.1	5.7e-46
WP_108242033.1|2917172_2918684_-	hypothetical protein	NA	A0A292GAH2	Xanthomonas_phage	38.4	2.0e-82
WP_108242034.1|2918683_2919049_-	endodeoxyribonuclease RusA	NA	A0A088F6Y8	Sulfitobacter_phage	48.2	1.7e-19
WP_108242035.1|2919045_2919297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108242036.1|2919327_2919612_-	DUF3310 domain-containing protein	NA	A0A1I9SET2	Klebsiella_phage	72.2	1.3e-24
WP_108242037.1|2919781_2920090_-	DUF1364 family protein	NA	G8C7V5	Escherichia_phage	62.1	4.0e-27
WP_108242525.1|2920089_2920527_-	endonuclease	NA	R9QM99	Lactococcus_phage	39.4	7.1e-17
WP_108242038.1|2920622_2921081_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	43.9	3.7e-16
WP_108242526.1|2921073_2921319_-	TraR/DksA family transcriptional regulator	NA	A0A0H5ARI0	Pseudomonas_phage	56.8	3.3e-16
WP_108242039.1|2921327_2921621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108242040.1|2921769_2922420_-	hypothetical protein	NA	A0A0S2SYE7	Pseudomonas_phage	31.6	1.5e-18
WP_108242041.1|2922419_2923760_-	replicative DNA helicase	NA	Q9MC54	Pseudomonas_phage	73.5	2.3e-183
WP_108242042.1|2923756_2924746_-	phage replication protein	NA	A0A0S2SYI8	Pseudomonas_phage	71.8	2.9e-127
WP_108242043.1|2924939_2925152_-	helix-turn-helix domain-containing protein	NA	A0A2D1GND2	Pseudomonas_phage	50.0	1.7e-08
WP_108242527.1|2925368_2925989_+	helix-turn-helix transcriptional regulator	NA	W6MVG5	Pseudomonas_phage	65.5	9.9e-57
WP_108242044.1|2926227_2926593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108242045.1|2926935_2927304_+	helix-turn-helix transcriptional regulator	NA	A0A0H5AUC3	Pseudomonas_phage	83.6	3.1e-50
WP_108242046.1|2927319_2927550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108242047.1|2927552_2927783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108242048.1|2927782_2927989_+	hypothetical protein	NA	A0A2H4J2M2	uncultured_Caudovirales_phage	76.5	1.7e-29
WP_108242049.1|2928363_2928882_+	hypothetical protein	NA	A0A0P0YNE7	Yellowstone_lake_phycodnavirus	45.0	1.3e-12
WP_108242050.1|2928994_2929270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108242051.1|2929266_2929488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108242052.1|2929484_2929763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108242053.1|2930294_2930507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108242528.1|2930682_2931495_+	exodeoxyribonuclease VIII	NA	A0A1P8DTH1	Proteus_phage	57.7	1.7e-88
WP_108242054.1|2931491_2932292_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	65.9	4.4e-89
WP_108242055.1|2932272_2932509_+	hypothetical protein	NA	A0A2H4JFL8	uncultured_Caudovirales_phage	45.7	9.1e-11
WP_108242056.1|2932548_2932842_+	hypothetical protein	NA	A0A0H5ARL2	Pseudomonas_phage	91.8	5.0e-43
WP_108242057.1|2932990_2933446_+	hypothetical protein	NA	A0A0H5AU93	Pseudomonas_phage	94.0	8.8e-79
WP_108242058.1|2933442_2935089_+	DUF4942 domain-containing protein	NA	A0A059VA49	Pseudomonas_phage	55.5	8.5e-172
WP_108242059.1|2935132_2935327_+	hypothetical protein	NA	A0A0H5BBQ5	Pseudomonas_phage	82.8	1.0e-23
WP_108242529.1|2935863_2936103_+	DfrB family trimethoprim-resistant dihydrofolate reductase	NA	A0A0H5ARK7	Pseudomonas_phage	93.0	2.1e-23
WP_108242060.1|2936099_2936732_+	hypothetical protein	NA	A0A076G6T3	Escherichia_phage	53.6	5.2e-21
WP_108242061.1|2936732_2936921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108242062.1|2936982_2937255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108242063.1|2937279_2937549_+	hypothetical protein	NA	A0A0H5BBP9	Pseudomonas_phage	65.9	2.0e-22
WP_108242064.1|2937743_2938937_+|integrase	site-specific integrase	integrase	A0A0H5AW64	Pseudomonas_phage	97.5	4.5e-223
2941546:2941562	attR	CCACCGGCCGCACCGGC	NA	NA	NA	NA
>prophage 8
NZ_CP025149	Pseudomonas stutzeri strain SGAir0442 chromosome, complete genome	4524660	3701270	3720774	4524660	transposase,integrase	Stx2-converting_phage(28.57%)	18	3695019:3695033	3707780:3707794
3695019:3695033	attL	GTCGAGGCCGAGCCC	NA	NA	NA	NA
WP_003299771.1|3701270_3704264_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	47.6	5.7e-259
WP_003150546.1|3704267_3704678_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_003089107.1|3704677_3704917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108242280.1|3705109_3706003_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_004423344.1|3706251_3706542_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_004423345.1|3706538_3706883_+	IS66 family insertion sequence hypothetical protein	NA	S5VXZ8	Leptospira_phage	33.7	1.1e-12
WP_011911868.1|3707004_3708543_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
3707780:3707794	attR	GTCGAGGCCGAGCCC	NA	NA	NA	NA
WP_003458515.1|3708532_3708802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003291613.1|3709604_3710183_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_108241672.1|3710186_3711695_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.6	9.2e-149
WP_003291615.1|3711730_3712075_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	68.2	9.7e-38
WP_079390046.1|3712071_3712518_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_108242281.1|3712512_3712836_+	hypothetical protein	NA	C7BGE4	Burkholderia_phage	43.0	6.4e-15
WP_095460747.1|3713148_3714370_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	71.0	1.1e-110
WP_019406651.1|3714759_3717411_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.0	5.2e-155
WP_019406650.1|3717489_3717996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003458515.1|3718976_3719246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011911868.1|3719235_3720774_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
