The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028703	Escherichia coli strain ME8067 chromosome, complete genome	4614635	1138321	1195598	4614635	integrase,transposase	Streptococcus_phage(22.22%)	54	1152807:1152866	1176352:1176411
WP_108118599.1|1138321_1138819_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|1139042_1140782_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001301266.1|1140741_1141512_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|1141582_1142638_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554757.1|1142689_1142983_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|1142985_1143384_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|1143393_1143846_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|1144151_1144418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|1144350_1144887_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_108118600.1|1144943_1146401_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_108118601.1|1146661_1147120_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000174689.1|1148513_1148915_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|1148953_1150009_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|1150296_1151400_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|1151411_1152665_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
1152807:1152866	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_108118602.1|1153246_1154263_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|1154470_1155874_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|1155860_1156793_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|1156901_1157948_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|1159169_1159508_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|1159530_1159881_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_010723086.1|1159974_1161129_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|1161423_1162332_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|1162346_1164314_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|1164540_1165923_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|1165934_1167545_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|1167549_1168308_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|1168446_1169451_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|1170645_1171377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108118603.1|1171467_1172094_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|1172365_1173064_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|1173090_1173945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|1174063_1174288_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|1174284_1174725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|1174841_1176242_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_001111342.1|1176526_1176937_-	hypothetical protein	NA	NA	NA	NA	NA
1176352:1176411	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000121359.1|1176915_1177872_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|1177881_1180080_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000643333.1|1180076_1181033_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000070700.1|1181029_1181719_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|1182136_1182751_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|1182998_1183328_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001350485.1|1183640_1184351_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001310578.1|1184319_1185963_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131096.1|1185952_1188478_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000716398.1|1188503_1189172_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|1189229_1189817_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001301257.1|1189891_1190434_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147279.1|1191257_1191485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|1191519_1191660_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_096960675.1|1191659_1191923_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|1192286_1192388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000020224.1|1193502_1194390_+	attachment protein	NA	NA	NA	NA	NA
WP_085947771.1|1194436_1195598_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 2
NZ_CP028703	Escherichia coli strain ME8067 chromosome, complete genome	4614635	1374544	1438764	4614635	terminase,integrase,lysis,transposase,tRNA,protease	Enterobacteria_phage(50.0%)	65	1420161:1420207	1442723:1442769
WP_001295836.1|1374544_1375168_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|1375138_1375825_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|1375821_1378236_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|1378666_1382947_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|1382986_1383355_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|1384045_1384306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|1385537_1386632_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|1386700_1387627_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|1387856_1388339_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|1388416_1389232_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|1389321_1391103_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|1391115_1391892_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|1391991_1392870_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|1393038_1394493_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|1394552_1395914_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|1395970_1397272_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|1397293_1398439_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|1398666_1399452_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|1399462_1400698_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|1400719_1401769_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|1402085_1403753_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|1403762_1405022_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|1405032_1405848_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|1405844_1406738_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|1406932_1408000_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|1407996_1408506_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|1408623_1409346_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|1409348_1409843_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|1410016_1411402_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|1411437_1411959_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1412066_1412279_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_045152971.1|1412280_1413147_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.8	2.2e-30
WP_000776555.1|1413617_1414160_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|1414379_1415072_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|1415102_1417706_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|1417684_1418725_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|1418735_1419251_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|1419253_1419886_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1420161:1420207	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|1420220_1421384_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|1421503_1421767_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|1422089_1422185_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|1422247_1423409_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|1423720_1424053_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|1424100_1424250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|1424307_1425834_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|1426298_1426850_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_108118615.1|1426859_1427657_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1427773_1427875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|1427871_1428327_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|1428326_1428497_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|1428489_1428780_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|1428776_1429139_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1429135_1429276_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_085947771.1|1429672_1430834_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_010723085.1|1431403_1432420_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|1432424_1433492_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|1434064_1434280_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|1434279_1434777_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|1434993_1435176_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|1435266_1435560_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|1435850_1436261_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|1436546_1436753_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|1436917_1437112_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|1437500_1438046_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|1438020_1438764_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
1442723:1442769	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP028703	Escherichia coli strain ME8067 chromosome, complete genome	4614635	2050741	2072134	4614635	portal,tail,integrase,plate,tRNA	Shigella_phage(31.58%)	31	2042736:2042750	2078837:2078851
2042736:2042750	attL	CTTCAGCGTGGTTGT	NA	NA	NA	NA
WP_001297484.1|2050741_2051848_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2051901_2052363_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|2052372_2053026_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444484.1|2053197_2054448_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_000241967.1|2054941_2055607_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010723094.1|2055607_2056312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257372.1|2056769_2057663_+	cell death peptidase Lit	NA	NA	NA	NA	NA
WP_000741310.1|2057753_2058881_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
WP_000939945.1|2058861_2059107_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_011443584.1|2059143_2059455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723095.1|2059571_2059913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|2059850_2060159_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|2060333_2061008_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|2061098_2061299_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|2061342_2061900_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_001250269.1|2062075_2062255_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|2062244_2063612_+	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|2063623_2063806_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|2063805_2064279_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|2064205_2064997_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|2064987_2065572_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_000554707.1|2065575_2066364_+|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
WP_000548498.1|2066363_2066966_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_010723096.1|2066937_2067351_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000905001.1|2067759_2068314_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|2068420_2069254_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000943927.1|2069487_2069652_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|2069754_2070078_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|2070614_2070725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|2070777_2071182_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|2071402_2072134_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
2078837:2078851	attR	ACAACCACGCTGAAG	NA	NA	NA	NA
>prophage 4
NZ_CP028703	Escherichia coli strain ME8067 chromosome, complete genome	4614635	2254283	2295101	4614635	tail,integrase,lysis,transposase,tRNA	Escherichia_phage(45.16%)	43	2244769:2244783	2284709:2284723
2244769:2244783	attL	AGCGAAAAATAATGC	NA	NA	NA	NA
WP_010723085.1|2254283_2255300_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000605090.1|2255572_2255830_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|2255879_2256830_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|2256981_2257734_-	FNR family transcription factor	NA	NA	NA	NA	NA
WP_000945011.1|2257928_2258444_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|2258454_2259981_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_108118686.1|2260017_2261463_-	amidohydrolase	NA	NA	NA	NA	NA
WP_108118687.1|2261462_2262773_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_108118688.1|2262948_2263857_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|2264186_2264750_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|2264770_2266003_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2266257_2267241_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|2267718_2269092_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|2269220_2270156_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|2270207_2271443_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|2271444_2271660_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2271738_2271948_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|2271940_2272135_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|2272191_2273001_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|2272993_2275594_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|2275695_2275971_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|2276045_2276216_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|2276215_2276437_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|2276878_2277367_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2277363_2277519_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|2277972_2278449_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|2278572_2278869_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|2278891_2279314_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|2279326_2280184_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|2280190_2280937_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|2280959_2281520_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|2281607_2281793_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_108118689.1|2281989_2283447_+	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001350510.1|2283584_2283848_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|2283828_2284188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|2285953_2286934_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
2284709:2284723	attR	AGCGAAAAATAATGC	NA	NA	NA	NA
WP_000279097.1|2287256_2290619_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|2290618_2291194_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|2291291_2291882_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|2292198_2292432_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|2292500_2292614_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|2293392_2293827_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|2293967_2295101_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 5
NZ_CP028703	Escherichia coli strain ME8067 chromosome, complete genome	4614635	2487659	2532427	4614635	protease,lysis,transposase,tail	Enterobacteria_phage(31.03%)	61	NA	NA
WP_000527743.1|2487659_2489120_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|2489208_2490492_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2491096_2491210_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|2491278_2491512_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000086527.1|2491828_2492419_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001698950.1|2492516_2493092_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_001027733.1|2493091_2494054_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|2494004_2494574_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_108118710.1|2494962_2495196_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|2495253_2495664_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|2495815_2495989_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2496160_2496316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2496394_2496460_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2496462_2496651_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2496661_2496874_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2497236_2497734_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2497730_2498264_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|2498260_2498572_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2498576_2498792_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2499545_2499761_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2500061_2500274_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2500328_2500418_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2500695_2501448_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001393597.1|2501461_2502511_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	5.7e-113
WP_012304870.1|2502512_2502791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2502857_2503109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2503325_2503481_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2503552_2503840_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2503839_2504079_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2504103_2504409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2504611_2504944_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|2505380_2505530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|2505826_2506057_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|2506140_2506548_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|2506714_2506870_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|2507029_2507248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014639039.1|2507251_2507416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2507815_2508004_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|2508000_2508192_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001360138.1|2510934_2511045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|2511102_2512122_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|2512133_2513348_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|2513553_2513880_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|2514014_2514356_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|2514390_2514951_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_032260954.1|2514953_2515664_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|2515771_2516077_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_108118711.1|2516275_2518702_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	8.6e-213
WP_001340362.1|2518762_2521186_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|2521196_2521814_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526503.1|2521815_2522670_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|2522712_2523327_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071592181.1|2523485_2524778_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919231.1|2524730_2525426_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_047667691.1|2525550_2526702_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000547191.1|2526811_2528140_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_001019525.1|2528344_2529238_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|2529344_2530598_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743957.1|2530994_2531330_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233093.1|2531422_2531506_+	stationary phase-induced protein	NA	NA	NA	NA	NA
WP_001260865.1|2531605_2532427_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP028703	Escherichia coli strain ME8067 chromosome, complete genome	4614635	2967292	2975963	4614635		Escherichia_phage(28.57%)	8	NA	NA
WP_000272486.1|2967292_2968396_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|2968403_2969651_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100981.1|2969647_2970205_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_000783975.1|2970204_2971086_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001023610.1|2971143_2972043_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000699460.1|2972042_2973128_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_000183060.1|2973500_2974394_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_108118749.1|2974568_2975963_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 7
NZ_CP028703	Escherichia coli strain ME8067 chromosome, complete genome	4614635	3326140	3337350	4614635	integrase,tail	Enterobacteria_phage(50.0%)	17	3324115:3324131	3341025:3341041
3324115:3324131	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|3326140_3327073_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|3327384_3328542_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|3328694_3329057_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_108118772.1|3329053_3329974_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.5	1.6e-159
WP_001030215.1|3329970_3331302_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|3331336_3331618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|3331916_3332357_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|3332383_3332902_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|3332951_3333227_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|3333226_3333721_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|3333717_3334086_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|3334443_3334806_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|3334871_3335696_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|3335823_3336360_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|3336350_3336713_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|3336712_3337018_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|3337149_3337350_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
3341025:3341041	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 8
NZ_CP028703	Escherichia coli strain ME8067 chromosome, complete genome	4614635	3718856	3725995	4614635		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|3718856_3721418_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|3721523_3722180_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|3722230_3722998_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|3723193_3724102_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|3724098_3725265_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|3725356_3725995_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
