The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020484	Enterococcus faecium strain CFSAN059070 chromosome, complete genome	2880780	516753	583716	2880780	integrase,tRNA,transposase,protease	Streptococcus_phage(15.38%)	54	512306:512325	590565:590584
512306:512325	attL	GACAAGACTTTTGTCACAGC	NA	NA	NA	NA
WP_002286726.1|516753_517875_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_002295160.1|518114_519542_+	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_002286711.1|519555_520674_+	aminotransferase	NA	NA	NA	NA	NA
WP_002286708.1|520733_522026_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_002326790.1|522175_522736_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002286704.1|522864_523242_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_002304230.1|523174_525247_+	DNA topoisomerase III	NA	NA	NA	NA	NA
WP_002289773.1|525457_526405_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	51.0	5.0e-84
WP_002289775.1|526650_527115_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	38.7	8.8e-18
WP_002289776.1|527176_528220_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_002291188.1|528596_529562_-	TDT family transporter	NA	NA	NA	NA	NA
WP_002297022.1|529795_530641_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002291183.1|530831_532019_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_002295166.1|532024_532381_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	42.3	2.7e-22
WP_002291179.1|532382_532721_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
WP_002304234.1|533115_534150_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.1	4.2e-28
WP_002287674.1|534142_534829_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287678.1|534852_535701_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002287679.1|535897_536671_+	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FG22	Brazilian_cedratvirus	28.8	2.1e-08
WP_002287681.1|536683_537970_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_002287683.1|537966_539202_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	47.7	3.9e-113
WP_002287684.1|539188_539659_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_002287686.1|539663_541055_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_002297218.1|541170_542466_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002287705.1|542671_543814_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	34.8	3.3e-58
WP_002287709.1|543852_544587_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002287723.1|544818_545094_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048946547.1|545191_547189_+	hypothetical protein	NA	A0A1Z1LZK7	Bacillus_phage	24.4	5.5e-24
WP_002301912.1|547264_547600_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048946548.1|547978_548341_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_048946549.1|548386_548713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002298390.1|549555_551379_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002298389.1|551392_552802_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	27.6	3.2e-42
WP_002298387.1|552819_553656_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002317770.1|553720_554503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094850654.1|554906_556032_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	54.1	2.3e-75
WP_002297848.1|557384_557585_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002297850.1|557660_557858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297851.1|558154_559702_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	S4VPC4	Pandoravirus	25.7	4.6e-10
WP_002297853.1|559785_560589_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_002297855.1|560591_561374_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002297856.1|561370_562150_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002297857.1|562121_562913_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.3e-21
WP_002297858.1|562973_563903_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002297859.1|564097_564781_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002340328.1|564941_565985_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002340332.1|567924_569103_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002295743.1|569323_570232_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002321318.1|570360_570960_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_002321317.1|570959_571535_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_002344971.1|571559_575231_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_002340336.1|575294_578927_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_002321314.1|579042_581565_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_002321313.1|581682_583716_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
590565:590584	attR	GACAAGACTTTTGTCACAGC	NA	NA	NA	NA
>prophage 2
NZ_CP020484	Enterococcus faecium strain CFSAN059070 chromosome, complete genome	2880780	726195	734667	2880780		Streptococcus_phage(66.67%)	9	NA	NA
WP_002294039.1|726195_726840_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002292340.1|726854_727184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288071.1|727197_728136_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002288073.1|728171_728996_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288076.1|728988_729336_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288078.1|729404_730277_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002294035.1|730385_731507_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288081.1|731560_732163_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002288083.1|732477_734667_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
>prophage 3
NZ_CP020484	Enterococcus faecium strain CFSAN059070 chromosome, complete genome	2880780	787676	887441	2880780	portal,plate,tRNA,integrase,terminase,tail,protease,head,holin,transposase,capsid	Enterococcus_phage(11.63%)	116	836947:836965	872915:872933
WP_002286621.1|787676_790475_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.6e-74
WP_002286618.1|790523_792050_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
WP_002286616.1|792064_792712_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286678.1|792895_793225_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002286614.1|793401_794130_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002286612.1|794145_795159_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286608.1|795158_796436_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
WP_074400891.1|796498_799201_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286606.1|799352_799670_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002286604.1|799699_800020_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002371581.1|800127_801588_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002286598.1|801655_801877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286596.1|801907_802090_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_002286592.1|802089_802503_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002286589.1|802625_803807_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002286676.1|803877_804042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286587.1|804337_805477_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
WP_002296617.1|805775_806411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296616.1|806523_807159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303013.1|807192_807654_-	DUF4429 domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
WP_002296613.1|807783_808215_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002296612.1|808232_808553_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
WP_002290310.1|808851_809628_+	phage antirepressor protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296611.1|809642_809846_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002286573.1|809861_810200_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296610.1|810186_810366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|810408_810879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|810965_811664_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|811841_812183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|812175_812847_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_058825536.1|812852_813545_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	3.2e-88
WP_002286552.1|813541_814291_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_002304429.1|814302_814572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296607.1|814577_814742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303016.1|814734_815034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303017.1|815033_815336_+	hypothetical protein	NA	D2IZY1	Enterococcus_phage	70.7	2.8e-33
WP_002303018.1|815375_815741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303019.1|816230_816371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002369144.1|816367_816550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347162.1|816562_816757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303022.1|816789_817002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304431.1|817126_817330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303024.1|817326_817599_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	61.6	5.5e-20
WP_002303025.1|817599_817785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123838300.1|817771_818119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303026.1|818078_818555_+	DUF1492 domain-containing protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	50.8	2.2e-27
WP_002349221.1|818700_819429_-	DUF4145 domain-containing protein	NA	A0A1X9I5M7	Streptococcus_phage	52.4	1.2e-58
WP_002303029.1|819476_819755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303030.1|819756_820143_+	hypothetical protein	NA	A0A1B1P7N8	Bacillus_phage	36.7	1.9e-10
WP_002304435.1|820139_820520_+	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	64.0	4.7e-41
WP_002303032.1|820631_821084_+	hypothetical protein	NA	A0A2H4JFK0	uncultured_Caudovirales_phage	66.2	6.8e-47
WP_002303033.1|821080_822808_+|terminase	terminase large subunit	terminase	A0A2H4JDG5	uncultured_Caudovirales_phage	73.3	6.9e-265
WP_002304437.1|822871_824059_+|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	65.5	1.3e-142
WP_002303035.1|824030_824600_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	71.7	3.6e-69
WP_002303037.1|824612_825977_+|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	69.1	2.2e-125
WP_002303039.1|825978_826260_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	62.7	4.7e-22
WP_002303041.1|826237_826564_+|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	53.4	2.9e-23
WP_002303043.1|826553_826892_+	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	45.9	9.6e-22
WP_002303045.1|826881_827247_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_002303047.1|827253_827880_+|tail	tail protein	tail	A0A2H4JGN2	uncultured_Caudovirales_phage	34.5	5.7e-28
WP_002303049.1|827879_828344_+	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	38.9	1.4e-15
WP_002303051.1|828538_830848_+|tail	phage tail tape measure protein	tail	Q8W5Z7	Listeria_phage	50.1	5.5e-84
WP_002349218.1|830859_831564_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002347164.1|831560_834320_+	CHAP domain-containing protein	NA	D7RWE0	Brochothrix_phage	55.7	1.6e-50
WP_002332773.1|834332_835241_+|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_002303523.1|835240_835858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002301867.1|835861_836311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305897.1|836310_836805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347165.1|836818_837250_+	hypothetical protein	NA	NA	NA	NA	NA
836947:836965	attL	TTTTGATAAAAAACAGTGG	NA	NA	NA	NA
WP_002303475.1|837251_837389_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002303476.1|837425_837719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|837715_837940_+|holin	holin	holin	NA	NA	NA	NA
WP_002303477.1|837936_838956_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
WP_002302747.1|839732_840032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302745.1|840037_840268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286470.1|840517_840718_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002296840.1|841034_842222_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002286469.1|842496_843729_-	aminopeptidase	NA	NA	NA	NA	NA
WP_002286467.1|843983_844553_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002286465.1|844730_845171_-	flavodoxin	NA	NA	NA	NA	NA
WP_002294533.1|845328_846093_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286461.1|846124_847048_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002286457.1|847123_848263_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002286455.1|848255_849056_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286453.1|849055_849883_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286451.1|849887_850595_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286449.1|850694_851561_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002286442.1|851574_852147_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002294532.1|852168_853197_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	6.4e-69
WP_002286428.1|853294_854146_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.7e-38
WP_002302719.1|854179_856213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042957143.1|856256_857537_+	EpaQ family protein	NA	NA	NA	NA	NA
WP_002289081.1|857746_858553_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002289079.1|858564_859785_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.1e-11
WP_002289078.1|859774_861361_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002289076.1|861399_863538_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002289074.1|863905_864889_-	serine hydrolase	NA	NA	NA	NA	NA
WP_002289073.1|865266_866658_+	sugar transferase	NA	NA	NA	NA	NA
WP_002289071.1|866673_867714_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	35.3	2.4e-07
WP_002289069.1|867732_868818_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_002289068.1|868850_869813_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_002292877.1|869805_871233_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_002302730.1|871234_872305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002292875.1|872291_873713_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
872915:872933	attR	TTTTGATAAAAAACAGTGG	NA	NA	NA	NA
WP_002289359.1|873725_874733_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.9	1.2e-40
WP_002292874.1|874744_875749_+	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_002289362.1|875745_876894_+	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_002289363.1|876866_877544_+	acetyltransferase	NA	NA	NA	NA	NA
WP_002326811.1|877533_878676_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	27.9	2.4e-24
WP_002289366.1|878688_879666_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002289368.1|879665_880574_+	dehydrogenase	NA	NA	NA	NA	NA
WP_002289370.1|880574_881327_+	acylneuraminate cytidylyltransferase family protein	NA	NA	NA	NA	NA
WP_002289372.1|881331_882279_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	37.7	2.8e-50
WP_060809400.1|882452_883748_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.2	1.5e-54
WP_000222572.1|884236_885190_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_000997695.1|886262_887441_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP020484	Enterococcus faecium strain CFSAN059070 chromosome, complete genome	2880780	1160537	1170080	2880780		unidentified_phage(16.67%)	9	NA	NA
WP_002348948.1|1160537_1161926_-	group II intron reverse transcriptase/maturase	NA	H7BVW2	unidentified_phage	26.0	7.0e-10
WP_002297115.1|1162494_1162872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288021.1|1163127_1163856_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002295474.1|1163855_1164110_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288017.1|1164111_1164783_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002288015.1|1164783_1167006_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288013.1|1166990_1168430_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002378443.1|1168461_1169505_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288010.1|1169501_1170080_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
>prophage 5
NZ_CP020484	Enterococcus faecium strain CFSAN059070 chromosome, complete genome	2880780	1445886	1488571	2880780	transposase,protease	Streptococcus_phage(23.08%)	52	NA	NA
WP_002287525.1|1445886_1447035_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002287522.1|1447051_1447456_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002291299.1|1447759_1447933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295138.1|1448572_1449046_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_002295139.1|1449054_1449282_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002295142.1|1449917_1450289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291278.1|1450544_1450787_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002296679.1|1450818_1451721_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002291274.1|1451733_1451922_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002296677.1|1451935_1452499_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002300977.1|1452536_1453430_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.0	5.2e-59
WP_002296674.1|1453507_1454446_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002296672.1|1454479_1454830_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002296671.1|1454862_1455765_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_002296670.1|1455757_1456615_-	glycosyltransferase family 8 protein	NA	A0ZYL4	Archaeal_BJ1_virus	27.1	1.3e-19
WP_002296669.1|1456948_1457758_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002296667.1|1457797_1458295_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002321681.1|1458939_1459263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296665.1|1459426_1459681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296663.1|1459750_1459996_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296662.1|1460071_1460437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303842.1|1460497_1461061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|1461712_1463008_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002302440.1|1463246_1464548_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002293303.1|1464651_1464852_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	77.3	3.9e-23
WP_002296658.1|1465247_1465397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296656.1|1465603_1466317_-	HAD family phosphatase	NA	A0A1D8KPI1	Synechococcus_phage	23.0	5.4e-06
WP_002296654.1|1466309_1467395_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002296653.1|1467411_1467855_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002321678.1|1467888_1468242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296650.1|1468353_1468755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296648.1|1468791_1469301_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002303107.1|1469322_1470180_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002296646.1|1470197_1471031_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002303106.1|1471044_1471842_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002321677.1|1471874_1472159_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002296641.1|1472155_1473157_-	2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	29.0	2.8e-24
WP_002296640.1|1473158_1474061_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A1D8KGX1	Synechococcus_phage	35.3	3.3e-53
WP_002296639.1|1474224_1475073_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296638.1|1475718_1475925_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_002296637.1|1476126_1477128_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	31.8	2.5e-09
WP_002311095.1|1477132_1479046_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_002296634.1|1479213_1479720_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002296633.1|1479879_1480320_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002296632.1|1480345_1481503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296631.1|1481505_1481862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296629.1|1482159_1483134_-	LPXTG-anchored fibrinogen/nidogen-binding adhesin SgrA	NA	NA	NA	NA	NA
WP_002296628.1|1483329_1484169_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002296627.1|1484353_1485241_+	rotamase	NA	NA	NA	NA	NA
WP_002311093.1|1485834_1486530_-	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.5	1.0e-22
WP_002296624.1|1486513_1486912_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287107.1|1487320_1488571_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
>prophage 6
NZ_CP020484	Enterococcus faecium strain CFSAN059070 chromosome, complete genome	2880780	1496421	1543259	2880780	integrase,transposase	Streptococcus_phage(44.44%)	44	1491611:1491626	1501332:1501347
1491611:1491626	attL	AAAGGATACTTTTTTT	NA	NA	NA	NA
WP_000997695.1|1496421_1497600_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_000222572.1|1497755_1498709_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002288357.1|1498765_1499893_+|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	55.5	1.8e-109
WP_010729348.1|1500110_1501253_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	32.4	4.5e-39
WP_010729347.1|1501257_1501443_-	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
1501332:1501347	attR	AAAAAAAGTATCCTTT	NA	NA	NA	NA
WP_002353648.1|1501796_1502042_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010729346.1|1502035_1502437_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010729345.1|1502623_1504432_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	48.4	2.3e-154
WP_010729344.1|1504454_1506221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729343.1|1506233_1507028_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_010729700.1|1507037_1508414_-	MFS transporter	NA	NA	NA	NA	NA
WP_010729341.1|1508533_1509181_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_010729340.1|1509264_1510692_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_010729339.1|1510765_1511845_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_010729338.1|1511847_1513479_-	mannitol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_025481115.1|1513788_1514454_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010729336.1|1515172_1515343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000202380.1|1515466_1516786_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
WP_010729334.1|1517294_1517747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729333.1|1517753_1518302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000202380.1|1518555_1519875_-|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
WP_010729332.1|1520030_1520363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033630243.1|1520376_1520607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010710550.1|1520828_1521371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108680002.1|1521391_1522471_-	CHAP domain-containing protein	NA	A0A0B5A7F4	Streptococcus_phage	29.9	4.6e-25
WP_010729329.1|1522489_1524700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729328.1|1524715_1527244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729327.1|1527295_1527706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312989.1|1527718_1527937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729326.1|1527933_1528926_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_010729325.1|1529004_1529916_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_010729324.1|1529934_1530279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729321.1|1530935_1531436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729320.1|1531436_1531982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729319.1|1531978_1533235_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_010729318.1|1533595_1533907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050566171.1|1533929_1535240_-	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	36.8	1.3e-61
WP_010729316.1|1535853_1536306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729315.1|1536307_1536673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729314.1|1536771_1541055_-	VaFE repeat-containing surface-anchored protein	NA	NA	NA	NA	NA
WP_010729313.1|1541201_1541441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312949.1|1541530_1541803_-	hypothetical protein	NA	A0A1W6JN36	Lactococcus_phage	57.4	1.6e-19
WP_010710562.1|1541885_1542137_-	hypothetical protein	NA	D2IZL0	Enterococcus_phage	58.5	1.1e-06
WP_002303350.1|1542299_1543259_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP020484	Enterococcus faecium strain CFSAN059070 chromosome, complete genome	2880780	1647454	1769657	2880780	integrase,tRNA,transposase,protease	Streptococcus_phage(35.14%)	110	1660015:1660032	1683501:1683518
WP_000222572.1|1647454_1648408_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002326695.1|1648404_1648986_-	DUF443 family protein	NA	NA	NA	NA	NA
WP_002321528.1|1649172_1649823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289698.1|1650365_1651301_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.1	2.0e-53
WP_002289697.1|1651334_1652333_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	62.9	2.6e-115
WP_002289695.1|1652329_1653214_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	5.4e-08
WP_002296517.1|1653348_1654080_-	aspartate racemase	NA	NA	NA	NA	NA
WP_002294441.1|1654083_1655349_-	D-aspartate ligase	NA	NA	NA	NA	NA
WP_002296519.1|1655611_1658428_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.4	3.6e-311
WP_002302999.1|1658437_1660432_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
1660015:1660032	attL	CATTTCTTTCTAATAATG	NA	NA	NA	NA
WP_002296521.1|1660690_1662193_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002292113.1|1662194_1662932_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	44.7	2.8e-34
WP_010729704.1|1663102_1664296_-|integrase	site-specific integrase	integrase	A0A1S5SEW7	Streptococcus_phage	63.8	3.9e-142
WP_002341493.1|1664374_1664581_-	excisionase	NA	A0A1S5SF07	Streptococcus_phage	87.3	1.1e-25
WP_010729705.1|1664573_1665716_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	35.4	1.5e-63
WP_008788621.1|1666227_1666863_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001814923.1|1667338_1667455_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_000691736.1|1667470_1669390_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	99.5	0.0e+00
WP_000336323.1|1669508_1669676_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_001227347.1|1669735_1670089_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
WP_022278534.1|1670592_1671012_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_025481129.1|1671037_1671244_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002296523.1|1671471_1671645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158003447.1|1671620_1672286_+	sugar diacid utilization regulator	NA	NA	NA	NA	NA
WP_002289374.1|1672367_1673534_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.7	1.9e-24
WP_002292134.1|1673684_1675514_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.8	2.2e-136
WP_002296525.1|1675564_1676128_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002289532.1|1676221_1677265_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_002300943.1|1678679_1678907_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_002289535.1|1679390_1679981_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_002289536.1|1680170_1680884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|1681063_1682359_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002289537.1|1682520_1683531_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
1683501:1683518	attR	CATTTCTTTCTAATAATG	NA	NA	NA	NA
WP_002294466.1|1683567_1684050_-|tRNA	prolyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_002294467.1|1684199_1684568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296526.1|1685032_1685485_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288523.1|1685608_1686460_-	sugar transporter	NA	NA	NA	NA	NA
WP_002288522.1|1686472_1687258_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002288521.1|1687609_1688551_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_002288520.1|1688554_1689478_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_002288514.1|1692655_1692829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|1693099_1694395_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288513.1|1694589_1694937_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002288511.1|1694963_1697270_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.7	3.6e-19
WP_002288509.1|1697282_1697594_-	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_002288501.1|1697590_1697884_-	YlxR family protein	NA	NA	NA	NA	NA
WP_002288500.1|1697905_1699081_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002288499.1|1699103_1699577_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002288497.1|1699721_1704080_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	40.8	1.9e-21
WP_002294137.1|1704291_1706001_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002294136.1|1706068_1707337_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002294135.1|1707497_1708298_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002294134.1|1708294_1709107_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_002297404.1|1709515_1710766_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002323245.1|1711097_1712270_+|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_002293875.1|1712416_1712974_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002293877.1|1712976_1713699_-	UMP kinase	NA	NA	NA	NA	NA
WP_002293878.1|1713834_1714716_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293880.1|1714814_1715597_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293881.1|1715955_1716435_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326698.1|1716651_1717743_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002288432.1|1718866_1720558_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	2.9e-74
WP_002288434.1|1720977_1721925_-	carbamate kinase	NA	NA	NA	NA	NA
WP_002288437.1|1722039_1723059_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288439.1|1723149_1724379_-	arginine deiminase	NA	NA	NA	NA	NA
WP_002288442.1|1724839_1725541_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002301319.1|1726149_1727166_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	5.4e-60
WP_002288445.1|1727162_1727627_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288446.1|1727633_1728176_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288447.1|1728159_1728984_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002288449.1|1729072_1730053_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002288451.1|1730076_1731561_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002288452.1|1731572_1732562_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_002288457.1|1732809_1732977_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_010729586.1|1733038_1734850_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288459.1|1734846_1735212_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_002288461.1|1735374_1735770_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288462.1|1735787_1736750_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002293902.1|1736749_1736962_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_106913973.1|1736982_1737681_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002289886.1|1737700_1738243_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002301321.1|1738374_1739379_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293904.1|1739375_1740365_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293905.1|1740361_1741168_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_002293906.1|1741333_1742290_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002296121.1|1742366_1742885_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002296119.1|1742972_1743122_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002288531.1|1743349_1743796_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002305724.1|1743990_1745886_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002303934.1|1746210_1747185_-	choloylglycine hydrolase family protein	NA	M1H001	Paramecium_bursaria_Chlorella_virus	29.7	3.0e-23
WP_002296332.1|1747750_1748317_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296334.1|1748572_1749904_+	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_002296335.1|1749869_1750220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296337.1|1750731_1751076_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002301399.1|1751341_1752301_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002287776.1|1752490_1753087_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002287775.1|1753210_1755010_+	glycerophosphoryl diester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002297633.1|1755287_1755500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293931.1|1755961_1756111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311774.1|1756363_1757323_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002326704.1|1757535_1758444_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002288573.1|1758492_1758879_+	YxeA family protein	NA	NA	NA	NA	NA
WP_002288574.1|1759186_1760533_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288575.1|1760644_1761994_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288576.1|1762110_1763364_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288577.1|1763434_1763920_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002305727.1|1763942_1764701_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288581.1|1764716_1765895_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
WP_002303943.1|1766124_1768245_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.0	8.2e-220
WP_002297185.1|1768361_1769657_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
>prophage 8
NZ_CP020484	Enterococcus faecium strain CFSAN059070 chromosome, complete genome	2880780	1775360	1846498	2880780	integrase,transposase	Streptococcus_phage(57.89%)	71	1795202:1795219	1853939:1853956
WP_002297218.1|1775360_1776656_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002302293.1|1776974_1777277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002323892.1|1778420_1778735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1778851_1780030_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321266.1|1780366_1780606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289617.1|1780967_1781228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289618.1|1781412_1781910_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289619.1|1782039_1782750_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289620.1|1782762_1784427_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002300930.1|1784631_1785294_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002303949.1|1785303_1786119_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288989.1|1786380_1786824_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002321036.1|1786957_1787296_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288986.1|1787283_1787661_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288985.1|1787884_1789078_+	MFS transporter	NA	NA	NA	NA	NA
WP_002288984.1|1789243_1789666_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002321037.1|1790060_1790255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288983.1|1790251_1790746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288982.1|1790907_1792080_-	class C sortase	NA	NA	NA	NA	NA
WP_002288981.1|1792285_1793101_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002288979.1|1793250_1793697_-	cell wall anchor	NA	NA	NA	NA	NA
WP_158003446.1|1793693_1794698_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002352916.1|1794737_1795067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305732.1|1795192_1797520_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
1795202:1795219	attL	TTCACCTGCTTTTTTCTT	NA	NA	NA	NA
WP_002288970.1|1798362_1798656_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002288969.1|1799058_1800237_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	31.1	1.4e-30
WP_002300928.1|1800340_1800655_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288966.1|1800761_1800977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288964.1|1801276_1801519_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288962.1|1801505_1801934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002299190.1|1802085_1803633_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002287659.1|1803734_1804088_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002285758.1|1804077_1804272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956687.1|1804402_1805565_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002289210.1|1806129_1806504_-	VOC family protein	NA	NA	NA	NA	NA
WP_002296814.1|1806526_1807927_-	beta-fructofuranosidase	NA	NA	NA	NA	NA
WP_002289214.1|1807930_1808341_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002289215.1|1808358_1808850_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289216.1|1808859_1809651_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002289217.1|1809643_1810417_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289218.1|1810572_1813107_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_002289219.1|1813188_1814061_-	ROK family protein	NA	NA	NA	NA	NA
WP_002289220.1|1814096_1814564_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002289221.1|1814573_1816043_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002296810.1|1816113_1817532_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_002296809.1|1817653_1818634_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_086956705.1|1818913_1820076_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.5	1.6e-79
WP_002305710.1|1820168_1820678_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002302055.1|1821016_1821970_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_077828749.1|1821922_1822159_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002305709.1|1822578_1823700_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_002321361.1|1824027_1825437_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_002289053.1|1825433_1826162_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	5.1e-36
WP_002289055.1|1826289_1827201_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	42.2	1.1e-59
WP_002289057.1|1827217_1828225_-	lipoprotein	NA	A0A1S5SEZ8	Streptococcus_phage	63.9	4.8e-117
WP_002305708.1|1828221_1830351_-	FUSC family protein	NA	A0A1S5SF30	Streptococcus_phage	60.3	1.8e-182
WP_002296840.1|1830651_1831839_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002298631.1|1832883_1834710_-	group II intron reverse transcriptase/maturase	NA	H7BVW2	unidentified_phage	26.8	3.7e-11
WP_002288938.1|1836943_1837333_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	65.9	1.4e-40
WP_002305705.1|1837382_1838279_-	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	29.7	1.1e-16
WP_002288935.1|1838281_1840129_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_002288934.1|1840225_1840726_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.6	7.0e-53
WP_002298822.1|1840738_1840960_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	87.7	4.5e-28
WP_002297187.1|1840964_1841084_-	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286934.1|1841098_1842283_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	60.8	1.9e-141
WP_002286933.1|1842538_1842793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286932.1|1842817_1843960_-	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	62.1	1.7e-126
WP_002349191.1|1844019_1845372_-	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	64.4	3.8e-162
WP_002286928.1|1845442_1845787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286926.1|1845796_1846171_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	62.9	1.1e-34
WP_002286925.1|1846183_1846498_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.7e-25
1853939:1853956	attR	TTCACCTGCTTTTTTCTT	NA	NA	NA	NA
>prophage 9
NZ_CP020484	Enterococcus faecium strain CFSAN059070 chromosome, complete genome	2880780	1854049	1946375	2880780	portal,plate,tRNA,integrase,terminase,tail,protease,head,holin,transposase,capsid	Enterococcus_phage(24.07%)	105	1850962:1851002	1892897:1892937
1850962:1851002	attL	GATTTCTTTGATACGAGCAGCTTTTCCGTGTAATGCACGTA	NA	NA	NA	NA
WP_020944989.1|1854049_1855066_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.7	9.8e-62
WP_002302122.1|1855076_1855274_-|holin	holin	holin	A0A0S2MYF6	Enterococcus_phage	85.9	7.8e-24
WP_002332427.1|1855289_1855532_-|holin	holin	holin	D2J075	Enterococcus_phage	63.3	1.2e-21
WP_002332428.1|1855566_1855704_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002332429.1|1855705_1856152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290627.1|1856148_1856298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729422.1|1856314_1858375_-|plate	BppU family phage baseplate upper protein	plate	A0A249XZH9	Enterococcus_phage	44.9	1.7e-65
WP_002290629.1|1858392_1859217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002332431.1|1859220_1860270_-	hypothetical protein	NA	Q5K5I4	Oenococcus_phage	27.9	1.9e-31
WP_002350711.1|1860266_1861139_-|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_002350712.1|1861139_1864988_-	tape measure protein	NA	A0A0M5M3L4	Enterococcus_phage	76.0	0.0e+00
WP_002290636.1|1864987_1865179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002329391.1|1865202_1865514_-	hypothetical protein	NA	A0A0S2MY76	Enterococcus_phage	44.8	4.0e-14
WP_002332434.1|1865638_1866199_-|tail	phi13 family phage major tail protein	tail	V5UQL2	Enterococcus_phage	46.2	3.4e-40
WP_002329393.1|1866214_1866586_-	hypothetical protein	NA	A0A060ANH4	Enterococcus_phage	46.2	2.5e-23
WP_002350714.1|1866582_1866978_-	hypothetical protein	NA	C0LZZ2	Enterococcus_phage	44.5	4.3e-21
WP_002342516.1|1866974_1867310_-|head	phage head closure protein	head	A0A249XUC8	Enterococcus_phage	44.1	2.2e-18
WP_002350715.1|1867313_1867640_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_002350716.1|1867654_1868848_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	55.4	1.5e-114
WP_002350717.1|1868844_1869522_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	51.0	4.9e-49
WP_002350718.1|1869556_1870777_-|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	38.5	1.2e-61
WP_010729418.1|1872331_1873093_-	GIY-YIG nuclease family protein	NA	A0A220BXN1	Staphylococcus_phage	45.9	7.9e-40
WP_010729417.1|1873185_1873344_+	ribbon-helix-helix domain-containing protein	NA	A0A0A7RUX5	Clostridium_phage	65.9	5.3e-07
WP_002290653.1|1873810_1874332_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	34.2	1.1e-16
WP_002350721.1|1874433_1874598_+	YjzC family protein	NA	A0A0A7RTS6	Clostridium_phage	69.8	3.6e-14
WP_016922443.1|1874754_1875072_-	HNH endonuclease	NA	A0A1B1P8D2	Bacillus_phage	39.8	2.0e-13
WP_016922444.1|1875072_1875618_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016922446.1|1876029_1876194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304479.1|1876813_1877227_-	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.1e-56
WP_012197617.1|1877713_1878001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012197619.1|1877997_1878201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020944994.1|1878130_1878400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012197625.1|1878396_1878927_-	DUF1642 domain-containing protein	NA	A0A059T7S4	Listeria_phage	37.2	1.8e-11
WP_012197627.1|1878919_1879234_-	hypothetical protein	NA	D2IZY1	Enterococcus_phage	72.7	4.6e-34
WP_074394665.1|1879233_1879539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296606.1|1879535_1879697_-	antitoxin	NA	NA	NA	NA	NA
WP_002350665.1|1879693_1880011_-	VRR-NUC domain-containing protein	NA	A0A1B0YA93	Lactobacillus_phage	61.5	3.6e-31
WP_012197635.1|1880257_1882570_-	phage/plasmid primase P4 family domain-containing protein	NA	R4IBW2	Listeria_phage	55.9	1.3e-250
WP_012197636.1|1882584_1883085_-	DUF669 domain-containing protein	NA	A8ATF2	Listeria_phage	52.9	1.1e-34
WP_002350668.1|1883086_1883560_-	transcriptional regulator	NA	A8ATW6	Listeria_phage	43.9	7.7e-09
WP_002350669.1|1883550_1884900_-	DEAD/DEAH box helicase	NA	A0A0P0ID30	Lactobacillus_phage	53.4	4.1e-132
WP_012197638.1|1884874_1885561_-	AAA family ATPase	NA	A0A1P8VVS4	Streptococcus_phage	52.7	1.1e-61
WP_025480431.1|1885679_1885997_-	DUF5406 family protein	NA	F0PIH7	Enterococcus_phage	57.1	1.6e-26
WP_044384563.1|1886002_1886434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350673.1|1886690_1886867_-	hypothetical protein	NA	D7RWL9	Brochothrix_phage	60.7	1.3e-09
WP_002329420.1|1886883_1887363_-	siphovirus Gp157 family protein	NA	E5DV79	Deep-sea_thermophilic_phage	49.0	5.3e-34
WP_002350675.1|1887295_1887613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002332465.1|1887780_1888239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002342492.1|1888340_1888511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002325021.1|1888541_1888790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002315391.1|1888802_1888988_-	helix-turn-helix transcriptional regulator	NA	Q5YAA3	Bacillus_phage	56.7	8.4e-12
WP_002315392.1|1889291_1889666_+	helix-turn-helix transcriptional regulator	NA	O03970	Lactobacillus_phage	38.7	3.2e-18
WP_002350678.1|1889670_1890099_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_012197642.1|1890148_1890802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002350679.1|1890937_1891504_+	hypothetical protein	NA	A0A0P0IXE0	Lactobacillus_phage	92.3	1.9e-06
WP_012197643.1|1891619_1892756_+|integrase	site-specific integrase	integrase	A0A1P8BMN3	Lactococcus_phage	36.8	8.4e-54
WP_002286913.1|1892887_1893235_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
1892897:1892937	attR	GATTTCTTTGATACGAGCAGCTTTTCCGTGTAATGCACGTA	NA	NA	NA	NA
WP_002293717.1|1893370_1894132_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002293716.1|1894121_1894643_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002297190.1|1894812_1895604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290277.1|1895728_1895980_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002290274.1|1895991_1896267_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002293714.1|1896519_1897074_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002297192.1|1897152_1897674_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002293710.1|1897677_1898256_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002293709.1|1898367_1899786_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002293708.1|1899806_1900145_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002297194.1|1900104_1900608_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_002293705.1|1900738_1901443_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
WP_002297195.1|1901439_1903176_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002305697.1|1903278_1905750_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	29.2	3.1e-45
WP_002289807.1|1906074_1906965_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_002305696.1|1907161_1907644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289810.1|1907851_1908217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322761.1|1908420_1908738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287105.1|1909467_1910442_-	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	5.4e-25
WP_002297404.1|1910851_1912102_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002305694.1|1912387_1912645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008266934.1|1912876_1913290_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_086953915.1|1913568_1914908_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_042959742.1|1914977_1915553_-	hypothetical protein	NA	Q9MCC6	Lactobacillus_phage	35.9	4.8e-13
WP_094932120.1|1915633_1916795_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	2.7e-79
WP_002294835.1|1917169_1917739_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_002323057.1|1917812_1919102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305691.1|1919359_1920304_+	MoxR family ATPase	NA	A0A1C9EGB9	Acidianus_two-tailed_virus	26.4	7.6e-08
WP_002323055.1|1920317_1921391_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_002305688.1|1921380_1923552_+	transglutaminase	NA	NA	NA	NA	NA
WP_059355943.1|1923663_1925820_-	copper/silver-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	32.3	2.9e-71
WP_002349136.1|1925962_1928149_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.7	1.4e-121
WP_002289040.1|1928148_1928358_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_002294855.1|1928370_1928811_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002349135.1|1928884_1929358_-	hypothetical protein	NA	A0A097BYE2	Leuconostoc_phage	28.8	1.1e-10
WP_002297185.1|1929584_1930880_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002288779.1|1931189_1932656_-	amino acid permease	NA	NA	NA	NA	NA
WP_002305684.1|1932966_1935051_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.7	9.9e-117
WP_002288776.1|1935574_1935934_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002323072.1|1935963_1936305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305683.1|1936301_1936976_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002305681.1|1937770_1939069_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002305679.1|1939108_1940299_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002348809.1|1940319_1940847_-	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_002304681.1|1940893_1943683_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.1e-89
WP_002288762.1|1943829_1944030_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002323868.1|1944481_1944802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|1945079_1946375_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
>prophage 10
NZ_CP020484	Enterococcus faecium strain CFSAN059070 chromosome, complete genome	2880780	2521649	2643009	2880780	portal,plate,tRNA,integrase,terminase,tail,protease,holin,transposase,capsid	Enterococcus_phage(22.86%)	108	2578100:2578115	2638909:2638924
WP_002301399.1|2521649_2522609_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002285985.1|2522759_2525462_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_002285982.1|2525474_2526764_-	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_002285981.1|2526913_2527960_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002285980.1|2527961_2530115_+	alpha-1,2-mannosidase	NA	NA	NA	NA	NA
WP_002285977.1|2530587_2532033_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002285976.1|2532035_2533760_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002285975.1|2533752_2534367_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002285974.1|2534711_2536169_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002285972.1|2536209_2537130_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002285971.1|2537141_2538089_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002285969.1|2538567_2539287_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002304848.1|2539335_2540982_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002285964.1|2541160_2541751_+	transporter	NA	NA	NA	NA	NA
WP_002285962.1|2541842_2543348_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
WP_002285961.1|2543431_2544784_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002285960.1|2544783_2545302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002285954.1|2545317_2545644_-	PTS cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002285949.1|2545656_2547636_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_002285948.1|2547656_2547971_-	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_002285944.1|2548138_2548432_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_002321621.1|2548509_2549622_-	FUSC family protein	NA	NA	NA	NA	NA
WP_002297280.1|2549774_2549999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002285932.1|2550008_2550188_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_104674935.1|2550381_2550552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016252731.1|2550975_2551995_-	collagen binding domain-containing protein	NA	NA	NA	NA	NA
WP_002285924.1|2552141_2555213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002323245.1|2556863_2558036_+|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_002303189.1|2558451_2559213_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002344993.1|2559312_2561034_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	1.3e-37
WP_002304835.1|2561048_2562833_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	2.1e-46
WP_002285917.1|2563213_2564767_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002285916.1|2565114_2567529_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	72.8	0.0e+00
WP_002301403.1|2567955_2569974_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXE4	Bacillus_phage	39.6	5.8e-13
WP_002285911.1|2570343_2571000_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002285909.1|2570999_2571956_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	57.4	3.3e-43
WP_002285906.1|2571955_2572522_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	42.8	2.2e-34
WP_049052232.1|2572957_2573188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002337498.1|2573193_2573493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|2573528_2573900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296902.1|2573901_2574303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286474.1|2574316_2574724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087046766.1|2575646_2576809_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002286484.1|2577748_2578774_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
2578100:2578115	attL	ATCTGTCAGCGTAGGA	NA	NA	NA	NA
WP_002286683.1|2578770_2578995_-|holin	holin	holin	NA	NA	NA	NA
WP_002318262.1|2578991_2579285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071974452.1|2579322_2579460_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002347165.1|2579461_2579893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305897.1|2579906_2580401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298034.1|2580400_2580850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303306.1|2580853_2581474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048946725.1|2581473_2582382_-|plate	phage baseplate upper protein	plate	A0A1P8BKW9	Lactococcus_phage	24.3	1.1e-08
WP_049050347.1|2582394_2585157_-	CHAP domain-containing protein	NA	Q9AZX5	Lactococcus_phage	39.5	1.1e-139
WP_002349898.1|2585153_2585894_-|tail	tail protein	tail	NA	NA	NA	NA
WP_002349899.1|2585883_2588673_-	tape measure protein	NA	D7RWD8	Brochothrix_phage	38.9	5.4e-70
WP_002303297.1|2588914_2589256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303295.1|2589255_2589864_-|tail	tail protein	tail	NA	NA	NA	NA
WP_002317765.1|2589864_2590242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048946577.1|2590243_2590639_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_002298048.1|2590631_2591003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298050.1|2591002_2591344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311614.1|2591355_2591571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312521.1|2591593_2592484_-	DUF5309 domain-containing protein	NA	NA	NA	NA	NA
WP_002349163.1|2592498_2593200_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_002298058.1|2593248_2593566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298060.1|2593567_2594446_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_002298062.1|2594537_2596067_-|portal	phage portal protein	portal	A0A0S2MVB2	Bacillus_phage	25.0	1.7e-28
WP_048946578.1|2596078_2597494_-	DEAD/DEAH box helicase family protein	NA	C9E2I7	Enterococcus_phage	79.4	1.4e-218
WP_048946579.1|2597486_2598320_-|terminase	small subunit of terminase	terminase	D2IYW0	Enterococcus_phage	67.9	4.7e-78
WP_048946580.1|2598478_2598709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060763461.1|2599455_2599923_-	hypothetical protein	NA	D7RWH7	Brochothrix_phage	28.5	2.4e-07
WP_002341971.1|2599997_2600438_-	transcriptional regulator	NA	D2IYV6	Enterococcus_phage	38.4	5.3e-20
WP_048946598.1|2600467_2600761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048946597.1|2600791_2600986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033646791.1|2601091_2601544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002318210.1|2601569_2602031_-	class I SAM-dependent methyltransferase	NA	A0A2H4PBJ4	Lactobacillus_phage	67.1	1.1e-60
WP_002299339.1|2602231_2603083_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	30.2	2.3e-27
WP_048946585.1|2603097_2603898_-	hypothetical protein	NA	B4XYS6	Lactobacillus_phage	54.9	3.0e-58
WP_002301573.1|2603940_2604831_-	hypothetical protein	NA	D2IYT9	Enterococcus_phage	84.5	1.4e-136
WP_033646797.1|2604832_2605774_-	endonuclease	NA	D2IZK1	Enterococcus_phage	79.2	1.0e-145
WP_002303273.1|2606006_2606342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002330811.1|2606667_2606856_-	hypothetical protein	NA	D2IZW5	Enterococcus_phage	60.3	7.4e-08
WP_002299325.1|2606933_2607158_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	81.1	2.2e-27
WP_002299323.1|2607154_2607310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297389.1|2607449_2607662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297388.1|2607664_2607877_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002297387.1|2608151_2608562_+	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	51.4	2.8e-31
WP_002297386.1|2608574_2609027_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_048946584.1|2609117_2610398_+	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	50.5	2.8e-61
WP_033647077.1|2610469_2611591_+|integrase	site-specific integrase	integrase	C9E2L6	Enterococcus_phage	38.5	4.0e-64
WP_049058602.1|2611672_2613445_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	2.7e-54
WP_002285883.1|2613447_2615160_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	25.4	1.2e-14
WP_002303070.1|2615274_2615943_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002295567.1|2616009_2616798_-	esterase family protein	NA	NA	NA	NA	NA
WP_002295566.1|2616880_2618353_-	MFS transporter	NA	NA	NA	NA	NA
WP_002289731.1|2618482_2619676_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	72.0	1.3e-150
WP_002296055.1|2627985_2629482_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.9	8.7e-91
WP_002290055.1|2629592_2630597_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002296053.1|2630597_2631485_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_002287418.1|2631701_2633813_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	50.3	9.1e-110
WP_002287415.1|2633902_2634448_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.3	4.1e-06
WP_002287414.1|2634447_2635893_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	E3T4I1	Cafeteria_roenbergensis_virus	24.5	6.8e-08
WP_002287412.1|2636012_2636483_-	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_002287409.1|2636528_2636954_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_002287407.1|2637020_2637290_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_002287405.1|2637300_2638896_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002287403.1|2638910_2642432_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
2638909:2638924	attR	TCCTACGCTGACAGAT	NA	NA	NA	NA
WP_002287401.1|2642448_2643009_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP020484	Enterococcus faecium strain CFSAN059070 chromosome, complete genome	2880780	2750102	2766998	2880780		Streptococcus_phage(92.86%)	19	NA	NA
WP_002297366.1|2750102_2750417_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.0e-25
WP_002297365.1|2750429_2750804_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
WP_002297364.1|2750813_2751149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729284.1|2751231_2752572_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	65.2	1.5e-163
WP_002297358.1|2752649_2753324_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002297357.1|2753316_2753481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321810.1|2753556_2753991_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SDW2	Streptococcus_phage	77.1	6.5e-63
WP_002297356.1|2753991_2754699_+	DNA methylase	NA	A0A1S5SEK0	Streptococcus_phage	50.4	5.8e-53
WP_002297354.1|2754688_2754979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297353.1|2755237_2756422_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
WP_002297352.1|2756436_2756556_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|2757301_2759212_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033658092.1|2759315_2759540_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002297350.1|2759552_2760056_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_002297349.1|2760115_2760505_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
WP_010729283.1|2760491_2762939_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	75.9	0.0e+00
WP_002297347.1|2762943_2765067_+	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	59.7	1.2e-181
WP_002297346.1|2765063_2766068_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	63.5	5.6e-118
WP_002297345.1|2766086_2766998_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	44.0	2.2e-65
>prophage 1
NZ_CP020485	Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence	217014	2691	55756	217014	integrase,transposase	Bacillus_phage(28.57%)	46	3942:3958	12723:12739
WP_002300314.1|2691_3861_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
3942:3958	attL	AAAATATTAATAAAAAT	NA	NA	NA	NA
WP_002290383.1|4333_4888_+|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	46.1	8.6e-36
WP_002290382.1|5060_5534_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	44.2	2.3e-13
WP_002342357.1|5545_6082_+	glyoxalase	NA	NA	NA	NA	NA
WP_002290380.1|6121_6493_+	glyoxalase	NA	NA	NA	NA	NA
WP_002290379.1|6776_8048_+	substrate-binding domain-containing protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	45.0	4.1e-17
WP_002338088.1|8292_9318_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_002350067.1|9611_10721_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002350071.1|11715_12540_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002329911.1|12571_13882_+	alpha-glucosidase/alpha-galactosidase	NA	NA	NA	NA	NA
12723:12739	attR	AAAATATTAATAAAAAT	NA	NA	NA	NA
WP_002290371.1|14029_15289_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002290370.1|15298_16171_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002290368.1|16182_17013_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002290367.1|17052_19236_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_002342361.1|19296_20517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002335326.1|20513_21974_+	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_002290357.1|23478_23688_+	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_002290356.1|23680_23830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002290352.1|24932_26018_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_002290351.1|26351_26585_+	addiction module antitoxin	NA	NA	NA	NA	NA
WP_002329899.1|26581_26989_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A0N9SKD8	Staphylococcus_phage	38.9	4.0e-14
WP_002287870.1|28125_28644_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_002305874.1|29010_29259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108676098.1|29761_30923_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002300328.1|31421_31898_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002289252.1|31910_33413_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002289253.1|33426_34116_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289254.1|34276_35095_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289255.1|35324_35555_+	resolvase	NA	NA	NA	NA	NA
WP_002301718.1|36140_36596_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
WP_086953894.1|36838_38264_+|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002297218.1|38440_39736_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_002302077.1|39956_40919_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_002302078.1|40920_42360_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002293868.1|42544_44491_+	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002292418.1|44754_45627_+	ROK family protein	NA	NA	NA	NA	NA
WP_010729776.1|47484_47955_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	33.6	1.5e-09
WP_000824191.1|47999_48167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366408.1|48200_48500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224538.1|48540_49158_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
WP_002304891.1|49482_49878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344083.1|49957_52309_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_000718009.1|52433_53123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000751236.1|53136_53589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086968564.1|53823_54965_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.7	3.8e-78
WP_001015311.1|55075_55756_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
>prophage 2
NZ_CP020485	Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence	217014	69251	110507	217014	transposase,protease	Streptococcus_phage(45.45%)	34	NA	NA
WP_059355947.1|69251_70874_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.3	1.4e-121
WP_002301195.1|71159_72536_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002298083.1|72535_73192_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.3e-22
WP_002301194.1|73201_74479_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_087121905.1|74728_75890_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_010729386.1|75920_76370_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_002298088.1|76525_77068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002331383.1|78061_78742_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.8e-127
WP_002292680.1|78989_79847_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
WP_002292678.1|80408_80738_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002314366.1|80814_81087_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_002297422.1|81086_81350_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002336205.1|82494_83670_-	MFS transporter	NA	NA	NA	NA	NA
WP_002314387.1|83672_85922_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_002287525.1|86971_88120_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002287522.1|88136_88541_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002323400.1|89847_90783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290394.1|91341_91659_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002323399.1|91659_91914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287522.1|92272_92677_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002323589.1|92693_93842_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
WP_002348857.1|94548_94743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002326172.1|96094_97135_+	replication protein RepA	NA	NA	NA	NA	NA
WP_002323647.1|97958_98291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295674.1|98909_99251_+	DUF5406 domain-containing protein	NA	F0PIH7	Enterococcus_phage	62.5	1.5e-35
WP_002297404.1|99487_100738_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295673.1|101147_101387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295672.1|101453_101663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002336710.1|101722_102394_+	class A sortase	NA	NA	NA	NA	NA
WP_010729784.1|102446_104423_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_010729785.1|104435_105191_+	class C sortase	NA	NA	NA	NA	NA
WP_002350398.1|105187_106012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025481135.1|106300_108412_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002350400.1|108449_110507_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP020485	Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence	217014	146867	194217	217014	transposase	Streptococcus_phage(33.33%)	46	NA	NA
WP_010861579.1|146867_147548_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	2.9e-126
WP_010729797.1|147601_148312_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010729798.1|148295_149030_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002301686.1|149246_150260_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301685.1|150270_150681_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002301684.1|150680_151148_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002301683.1|151165_151912_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002301682.1|151911_152721_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_080114943.1|154683_155085_-	hypothetical protein	NA	A0A0N9S006	Staphylococcus_phage	49.2	2.5e-24
WP_010729801.1|155311_156490_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	27.1	2.7e-23
WP_074394709.1|156537_157275_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_002299198.1|157432_158362_-	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	23.3	1.1e-06
WP_002299197.1|158434_159046_-	VanZ family protein	NA	NA	NA	NA	NA
WP_010729802.1|159261_160170_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002311511.1|161628_162471_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002298377.1|162795_163212_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002298375.1|163208_163679_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_010729805.1|163692_164466_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298371.1|164479_165292_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002322451.1|165345_166311_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_010729806.1|166446_169170_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_010729807.1|169182_169815_+	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	27.9	3.0e-08
WP_077974475.1|170019_170247_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_014748823.1|170315_170582_+	antitoxin	NA	NA	NA	NA	NA
WP_002389879.1|170571_170841_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SCV8	Streptococcus_phage	48.8	8.7e-18
WP_002302440.1|171019_172321_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002296127.1|172549_174097_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002287659.1|174198_174552_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002285758.1|174541_174736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729749.1|174814_176107_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002336724.1|176869_177838_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002288615.1|177848_178664_+	fructoselysine 6-kinase	NA	NA	NA	NA	NA
WP_010729750.1|178731_179442_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288620.1|179477_180719_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_002296840.1|180776_181964_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002298077.1|182498_183899_+	putative basic amino acid antiporter YfcC	NA	NA	NA	NA	NA
WP_002322961.1|183931_184099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002350223.1|184964_185825_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162846309.1|186257_187178_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_016922376.1|187226_187832_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	53.2	1.3e-56
WP_002339142.1|187851_189072_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	58.5	3.9e-57
WP_002336713.1|189129_189810_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.8e-127
WP_002331328.1|190305_190527_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002342384.1|190542_191385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729753.1|191447_193250_+	exonuclease DNA polymerase III epsilon subunit	NA	A0A0A7RWA3	Clostridium_phage	30.4	7.6e-33
WP_010729754.1|193308_194217_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP020486	Enterococcus faecium strain CFSAN059070 plasmid unnamed2, complete sequence	49542	0	2672	49542		Enterococcus_phage(100.0%)	4	NA	NA
WP_002326767.1|50_401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073490843.1|397_568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001196543.1|1471_1747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429439.1|1718_2672_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	26.1	7.7e-16
>prophage 2
NZ_CP020486	Enterococcus faecium strain CFSAN059070 plasmid unnamed2, complete sequence	49542	6825	14859	49542	transposase	Streptococcus_phage(33.33%)	8	NA	NA
WP_001015311.1|6825_7506_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002323245.1|8126_9299_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_001280781.1|9450_10146_+	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	4.9e-36
WP_002305818.1|10123_11278_+	VanA-type vancomycin resistance histidine kinase VanS	NA	W8CYF6	Bacillus_phage	23.3	1.5e-13
WP_001059542.1|11492_12461_+	D-lactate dehydrogenase VanH-A	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	33.1	3.5e-40
WP_001079845.1|12453_13485_+	D-alanine--(R)-lactate ligase VanA	NA	NA	NA	NA	NA
WP_000402347.1|13490_14099_+	D-Ala-D-Ala dipeptidase VanX-A	NA	NA	NA	NA	NA
WP_001015311.1|14178_14859_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
>prophage 3
NZ_CP020486	Enterococcus faecium strain CFSAN059070 plasmid unnamed2, complete sequence	49542	20235	47988	49542	transposase	Streptococcus_phage(68.42%)	29	NA	NA
WP_001062587.1|20235_20853_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	36.6	2.9e-16
WP_002331392.1|22483_23131_-	type A-7 chloramphenicol O-acetyltransferase	NA	A0A1X9I6V6	Streptococcus_phage	54.4	9.0e-69
WP_002331393.1|23260_24199_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000635249.1|26040_26280_+	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	81.5	6.8e-22
WP_106913981.1|26328_26397_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_002323245.1|26434_27607_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_001038795.1|27868_28606_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.2	3.1e-134
WP_086953915.1|29106_30445_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_032458614.1|30599_31454_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	97.9	2.3e-152
WP_001835296.1|31545_31761_+	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	97.1	4.2e-31
WP_002326825.1|31778_32051_+	antitoxin	NA	A0A1X9I6E5	Streptococcus_phage	96.7	5.4e-07
WP_002332783.1|32052_32916_+	toxin zeta	NA	NA	NA	NA	NA
WP_001067799.1|33693_34374_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.7e-126
WP_000205227.1|34762_34987_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000233000.1|35001_35871_+	hypothetical protein	NA	A0A1X9I6C9	Streptococcus_phage	90.7	6.7e-152
WP_000662263.1|35851_36586_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
WP_001255866.1|36618_37527_+	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	E4ZFP8	Streptococcus_phage	100.0	2.8e-177
WP_001015311.1|38092_38773_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002349227.1|38981_39194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000357244.1|39355_39874_+	YfbU family protein	NA	NA	NA	NA	NA
WP_000774078.1|39880_40393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|40496_41792_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_002288897.1|42185_42809_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.1	1.8e-13
WP_001015311.1|42904_43585_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_000599739.1|43782_44388_+	cell filamentation protein	NA	NA	NA	NA	NA
WP_000170424.1|44403_44976_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	46.0	6.8e-36
WP_002326781.1|45227_45485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002326780.1|45610_46426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002323245.1|46815_47988_+|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
