The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026736	Bacillus megaterium strain YC4-R4 chromosome, complete genome	5129603	667837	677144	5129603		Bacillus_phage(33.33%)	8	NA	NA
WP_028411528.1|667837_669355_-	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	32.1	8.6e-54
WP_028411529.1|669378_670428_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013059046.1|670685_670934_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	54.1	3.6e-18
WP_028411530.1|671015_671591_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_028411531.1|672188_673763_+	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	30.2	7.6e-29
WP_028411532.1|673794_674484_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2D0ZM66	Rhodococcus_phage	41.5	7.2e-16
WP_033579740.1|674655_676428_-	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	26.3	7.5e-25
WP_013059051.1|676427_677144_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.2	2.2e-47
>prophage 2
NZ_CP026736	Bacillus megaterium strain YC4-R4 chromosome, complete genome	5129603	1819333	1827595	5129603		Synechococcus_phage(50.0%)	8	NA	NA
WP_013055036.1|1819333_1820626_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.5	5.9e-19
WP_099330574.1|1820700_1821408_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	39.3	2.7e-42
WP_014461938.1|1821415_1821667_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_013055039.1|1821663_1822350_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_028412530.1|1822333_1824565_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.8	2.7e-157
WP_013055041.1|1824540_1825956_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	4.3e-55
WP_028412529.1|1825982_1827020_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F0L1	Synechococcus_phage	45.6	1.7e-69
WP_014461934.1|1827016_1827595_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.8	9.6e-30
>prophage 3
NZ_CP026736	Bacillus megaterium strain YC4-R4 chromosome, complete genome	5129603	3777898	3786112	5129603		Bacillus_virus(83.33%)	7	NA	NA
WP_028413475.1|3777898_3778675_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	41.9	6.6e-34
WP_108674691.1|3778747_3779296_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	44.4	2.6e-32
WP_028413473.1|3779319_3780789_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	48.2	2.5e-114
WP_049164380.1|3780804_3781485_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	43.3	2.2e-41
WP_028413471.1|3781519_3782341_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	64.4	3.9e-93
WP_013056909.1|3782522_3782960_+	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_028413470.1|3783700_3786112_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	36.4	1.2e-17
>prophage 1
NZ_CP026740	Bacillus megaterium strain YC4-R4 plasmid unnamed4	98205	6871	84121	98205	coat,integrase	Bacillus_phage(15.38%)	57	23653:23681	90659:90687
WP_049166424.1|6871_7804_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_108675009.1|7982_9371_-	replication initiation protein	NA	A0A1V0E006	Clostridioides_phage	28.3	1.2e-09
WP_049166422.1|10363_11257_+	transcriptional regulator	NA	Q2I8D8	Bacillus_phage	29.9	9.7e-21
WP_108675010.1|11433_25245_+	tandem-95 repeat protein	NA	A0A2I2L613	Orpheovirus	25.0	2.7e-05
23653:23681	attL	GTGGTAAATGCAGATGGAACGTTTAGCTA	NA	NA	NA	NA
WP_049166418.1|25397_25925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033580849.1|26345_26834_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_049166417.1|26942_27644_-	peptidase	NA	NA	NA	NA	NA
WP_028412740.1|27845_28250_-	DUF4183 domain-containing protein	NA	NA	NA	NA	NA
WP_028412741.1|28568_28853_+	DUF4183 domain-containing protein	NA	NA	NA	NA	NA
WP_108675011.1|28938_29508_-	DUF4183 domain-containing protein	NA	NA	NA	NA	NA
WP_033580848.1|30106_30583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048019995.1|31011_31524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049166416.1|31724_32285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028412743.1|32425_33481_-	phosphotransferase	NA	NA	NA	NA	NA
WP_014462109.1|33486_34662_-	carbamoyl-phosphate synthase	NA	NA	NA	NA	NA
WP_049166414.1|34665_35970_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_033580846.1|35966_36623_-	PIG-L family deacetylase	NA	A0A2D2W2P2	Stenotrophomonas_phage	24.5	5.6e-10
WP_014462112.1|36863_37013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049166433.1|37404_37926_+	kinase	NA	NA	NA	NA	NA
WP_033580845.1|38068_38890_-	YncE family protein	NA	NA	NA	NA	NA
WP_014462115.1|39186_39402_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014462116.1|39540_40101_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014462117.1|40126_40555_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014462118.1|40761_41196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034327521.1|41439_42756_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_014462120.1|42757_42976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014462121.1|42991_43516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034327523.1|43661_44378_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_014462123.1|44532_45615_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_033580842.1|45649_46894_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_014462126.1|47465_48197_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_014462127.1|48473_49364_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A222YY99	Synechococcus_phage	26.5	1.4e-19
WP_049166411.1|49579_50803_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_028412738.1|50917_51835_+	GDP-mannose 4,6-dehydratase	NA	A0A0E3I8S3	Synechococcus_phage	32.6	1.1e-38
WP_033580840.1|51972_52596_+	peptidase	NA	A0A1V0SAM1	Catovirus	32.1	6.1e-06
WP_033580839.1|52905_53094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033580838.1|53298_54123_-	SDR family oxidoreductase	NA	A0A2P1ELT6	Moumouvirus	35.9	4.6e-33
WP_014462133.1|54123_55110_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	33.5	1.3e-45
WP_033580837.1|55102_56194_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A2P1ELS7	Moumouvirus	47.5	8.9e-93
WP_049166410.1|56597_57293_-	peptidase	NA	NA	NA	NA	NA
WP_049166409.1|57433_58114_-	peptidase	NA	NA	NA	NA	NA
WP_053086232.1|58326_59574_-	peptidase S8	NA	A0A1B0T6A2	Bacillus_phage	52.9	1.0e-100
WP_014462141.1|60685_60874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108675013.1|61082_61325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014462143.1|61397_61679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049166408.1|62173_63514_-	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	27.3	1.1e-39
WP_014462076.1|71965_72577_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.4	1.4e-15
WP_033580880.1|72757_72955_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_049166430.1|73505_74354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014462080.1|74541_75276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049166429.1|75463_76123_+	peptidase	NA	NA	NA	NA	NA
WP_049166428.1|77228_77972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_176542911.1|78143_78305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049166427.1|79070_79328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049166425.1|80293_80965_-	sulfotransferase family 2 domain-containing protein	NA	NA	NA	NA	NA
WP_014462093.1|81577_82153_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049166424.1|83188_84121_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
90659:90687	attR	GTGGTAAATGCAGATGGAACGTTTAGCTA	NA	NA	NA	NA
