The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	447243	481807	5439007	terminase,portal,protease,integrase,capsid,tail,transposase,head,tRNA	uncultured_Caudovirales_phage(68.75%)	34	464851:464868	482152:482169
WP_002919147.1|447243_448191_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|448205_448715_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|448843_449968_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|449939_450413_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|450438_450981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|450985_451558_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|451561_452380_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|452376_452634_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|452609_453164_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|458959_459181_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|459474_462585_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|462597_463737_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|464115_464766_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
464851:464868	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|465041_466268_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|466360_467302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|467483_467768_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|467778_468558_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_157263200.1|469060_469279_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	1.4e-34
WP_001549752.1|469271_469460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218267.1|469536_469665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|469763_470132_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|470128_470494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|470493_472629_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|472971_473307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|473355_473868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|474131_475298_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|475349_475910_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|475911_477153_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|477149_477485_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|477481_477781_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|477780_478224_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004150957.1|478216_478369_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_085955245.1|478584_479776_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004150955.1|480145_481807_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
482152:482169	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	1197381	1285713	5439007	plate,terminase,portal,lysis,integrase,capsid,tail,transposase,coat,head,tRNA	Salmonella_phage(78.26%)	100	1237772:1237818	1274339:1274385
WP_000019473.1|1197381_1198362_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_064185320.1|1198360_1198561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004217497.1|1198654_1199074_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_002914284.1|1199146_1199326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914281.1|1199531_1200434_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
WP_002914279.1|1200414_1200960_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_002914277.1|1200967_1201267_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002914274.1|1201342_1201948_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_004145715.1|1202051_1202960_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151036.1|1203042_1204830_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151035.1|1205093_1206614_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002914266.1|1207315_1207897_+	fimbrial protein	NA	NA	NA	NA	NA
WP_004185341.1|1208091_1208754_+	molecular chaperone	NA	NA	NA	NA	NA
WP_004197944.1|1208790_1211346_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002914264.1|1211353_1212448_+	fimbrial protein	NA	NA	NA	NA	NA
WP_002914263.1|1212460_1213489_-	fimbrial protein	NA	NA	NA	NA	NA
WP_004151033.1|1213491_1216029_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002914261.1|1216058_1216727_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002914260.1|1216768_1217317_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004218900.1|1217420_1218038_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002914253.1|1218390_1219239_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004152937.1|1219294_1219915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914250.1|1220070_1220865_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004151028.1|1220925_1221858_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_004151027.1|1221863_1222592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151026.1|1222592_1224113_-	amino acid ABC transporter permease/ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	1.7e-17
WP_004151025.1|1224143_1224947_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002914201.1|1224966_1226034_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_002914200.1|1226030_1226894_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_004151024.1|1226904_1227855_-	agmatinase	NA	NA	NA	NA	NA
WP_002914199.1|1227970_1228882_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002914191.1|1229295_1229775_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000347934.1|1229844_1232997_-	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_002914189.1|1233020_1234196_-	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
WP_002914181.1|1234530_1234893_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002914180.1|1234903_1235476_-	flavin oxidoreductase	NA	NA	NA	NA	NA
WP_002914178.1|1235687_1236572_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151022.1|1236696_1237497_+	hypothetical protein	NA	NA	NA	NA	NA
1237772:1237818	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004151021.1|1237931_1239482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151020.1|1239478_1240504_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
WP_004151019.1|1240506_1241136_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1241258_1241501_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1241533_1242043_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1242050_1242251_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1242214_1242553_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1242620_1242854_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1242853_1243081_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1243077_1243929_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1243925_1246310_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151011.1|1246472_1246661_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1246672_1246906_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1247001_1247685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1247671_1248751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1248750_1249752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1250273_1250543_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1250599_1251643_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1251642_1253406_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1253546_1254380_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1254396_1255449_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1255452_1256106_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1256201_1256666_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1256665_1256869_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1256872_1257088_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1257068_1257578_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1257582_1257966_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1257962_1258391_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_072093160.1|1258365_1258524_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150997.1|1258486_1258909_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1258901_1259348_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1259370_1260237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1260331_1260904_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1260900_1261263_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1261249_1262158_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1262150_1262822_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1262823_1264773_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1264782_1265901_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1265952_1267026_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1267174_1268347_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1268356_1268872_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1268924_1269224_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1269238_1269358_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_072093161.1|1269584_1271981_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
WP_004150983.1|1271977_1272463_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1272459_1273554_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1273620_1273839_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1273866_1274244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1274847_1275330_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1274339:1274385	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|1275440_1275917_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1275906_1276197_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1276263_1276605_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004145681.1|1276586_1276727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914159.1|1276752_1278414_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1278500_1279379_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1279503_1280094_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1280213_1281500_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1281519_1282311_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1282474_1283839_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1284098_1284347_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1284365_1284914_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1284945_1285713_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	1382729	1435141	5439007	terminase,integrase,capsid,holin,tail,tRNA	Salmonella_phage(45.65%)	63	1377983:1377999	1430665:1430681
1377983:1377999	attL	TAAATTTGTTGTTGGCG	NA	NA	NA	NA
WP_004149335.1|1382729_1384004_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913890.1|1384038_1384659_+	YfgM family protein	NA	NA	NA	NA	NA
WP_002913889.1|1384669_1385848_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_002913888.1|1385961_1387440_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_004151982.1|1387557_1388637_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004144303.1|1388686_1388905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151981.1|1388888_1390280_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	6.3e-35
WP_004151980.1|1390438_1391905_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1391972_1393550_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004152549.1|1393742_1394993_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
WP_004152548.1|1395009_1395201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152547.1|1395197_1395380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152546.1|1395376_1395970_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_004152545.1|1395966_1396125_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_004153052.1|1396117_1396411_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004152543.1|1396520_1396769_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
WP_004152542.1|1396820_1397843_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_004152541.1|1397852_1398752_-	endonuclease	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
WP_004164029.1|1398748_1399048_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004152539.1|1399414_1399996_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004152538.1|1400149_1400383_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1400530_1400740_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004152536.1|1400739_1401507_+	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.0	3.4e-139
WP_004152535.1|1401503_1402289_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004152534.1|1402408_1402756_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152532.1|1402948_1403359_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152531.1|1403342_1403534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152530.1|1403530_1403956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152529.1|1403952_1404696_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
WP_004141386.1|1404866_1405079_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152527.1|1405075_1405744_+	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004152526.1|1405736_1405976_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152525.1|1405975_1406314_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152524.1|1406388_1406646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152523.1|1406723_1407308_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_004164044.1|1407304_1408780_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.9	1.9e-279
WP_004152473.1|1408823_1409345_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	55.2	7.8e-47
WP_004152472.1|1410050_1410254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152471.1|1410257_1411937_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	58.9	3.4e-192
WP_004152470.1|1411933_1412239_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004152468.1|1412520_1412919_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
WP_004152467.1|1412931_1413939_+|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	2.7e-181
WP_004152466.1|1413948_1414341_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_004152465.1|1414333_1414612_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	6.7e-21
WP_004153043.1|1414660_1415272_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	1.2e-46
WP_004152463.1|1415271_1417749_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.5	3.6e-267
WP_004152462.1|1417750_1418221_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	7.3e-44
WP_004152461.1|1418213_1418711_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	40.5	5.7e-23
WP_004152460.1|1418723_1421468_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.2	9.1e-94
WP_004152459.1|1421467_1424857_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	6.3e-121
WP_004152458.1|1424866_1425481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152457.1|1425755_1426154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152456.1|1426158_1426341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152455.1|1426531_1427227_-	hypothetical protein	NA	A0A193GYJ9	Enterobacter_phage	52.7	4.4e-61
WP_157833602.1|1427310_1427499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152454.1|1427607_1427805_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	69.8	2.0e-19
WP_004152453.1|1427808_1428066_-	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	54.1	2.3e-12
WP_004221284.1|1428604_1430974_+|tail	phage tail fibers	tail	A0A2H5BN49	Klebsiella_phage	79.5	9.1e-268
1430665:1430681	attR	CGCCAACAACAAATTTA	NA	NA	NA	NA
WP_004146394.1|1431258_1431663_+	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_004146393.1|1431649_1431955_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004152706.1|1431944_1432574_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
WP_004152707.1|1432570_1433053_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
WP_004152009.1|1433272_1435141_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
NZ_CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	1763871	1770778	5439007	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1763871_1764735_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_002912638.1|1764745_1765519_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004151134.1|1765761_1766658_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912635.1|1766900_1768262_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912634.1|1768580_1769303_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_004151135.1|1769299_1770778_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
>prophage 5
NZ_CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	1807345	1814970	5439007		Enterobacteria_phage(28.57%)	7	NA	NA
WP_004152488.1|1807345_1808752_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004152487.1|1808976_1810041_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004152486.1|1810067_1810937_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
WP_004152485.1|1810968_1811859_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_004152484.1|1811873_1812428_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
WP_004152483.1|1812608_1813775_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004152482.1|1813968_1814970_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
>prophage 6
NZ_CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	2055801	2112288	5439007	transposase,plate,protease	Microcystis_virus(25.0%)	54	NA	NA
WP_002910830.1|2055801_2056548_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_002910809.1|2056986_2057973_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004151439.1|2057965_2058766_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_002910767.1|2058752_2058926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004219597.1|2059223_2059367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|2059543_2060485_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|2060578_2061568_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|2061593_2062925_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910759.1|2062952_2064161_+	propionate kinase	NA	NA	NA	NA	NA
WP_004152312.1|2064189_2066484_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	2.3e-159
WP_004225356.1|2066535_2066682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910729.1|2066971_2068030_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002910727.1|2068139_2069054_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002910725.1|2069063_2070341_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_002910722.1|2070337_2071213_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.5	1.5e-10
WP_002910721.1|2071209_2071929_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
WP_002910720.1|2071934_2072828_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910719.1|2073111_2074755_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	9.8e-136
WP_002910717.1|2074804_2075281_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|2075379_2076306_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152313.1|2076609_2077905_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_004899032.1|2077916_2078726_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004152315.1|2078700_2079600_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|2079709_2080192_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004219568.1|2080289_2081081_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	3.0e-05
WP_002910652.1|2081106_2081646_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2081760_2082090_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_004148795.1|2082260_2082422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910645.1|2082658_2083999_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004152316.1|2083995_2084649_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004152317.1|2084652_2086350_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004152319.1|2089313_2090669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|2090669_2091179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2091175_2091682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910586.1|2091918_2092428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644641.1|2094033_2095002_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
WP_004199326.1|2095143_2095326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|2095322_2095652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|2095648_2096155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199323.1|2097664_2097976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|2097997_2098891_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_004217423.1|2098936_2099053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152633.1|2099074_2099968_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_038435084.1|2099993_2100122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004217421.1|2100263_2101037_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	28.1	1.2e-11
WP_004152632.1|2101212_2102103_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_000019473.1|2102439_2103420_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_072093175.1|2103645_2103780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093174.1|2104040_2104226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|2104523_2104790_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004198077.1|2104793_2105951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152262.1|2105934_2109345_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002910495.1|2109478_2111242_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152910.1|2111271_2112288_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 7
NZ_CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	2783010	2792424	5439007		Escherichia_phage(87.5%)	9	NA	NA
WP_160463746.1|2783010_2784645_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.8	3.1e-182
WP_004151612.1|2784699_2785965_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2785995_2787084_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2787170_2787431_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2787728_2788589_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2788609_2789371_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2789631_2790534_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2790545_2791811_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2791803_2792424_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 8
NZ_CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	3015610	3058658	5439007	terminase,transposase,integrase	Klebsiella_phage(33.33%)	63	3049771:3049785	3055780:3055794
WP_014343022.1|3015610_3018634_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	44.7	1.6e-22
WP_004152577.1|3018689_3018887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004231602.1|3018861_3018993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004231600.1|3019113_3019278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152575.1|3019752_3020526_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3020522_3021719_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3021718_3022072_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3022073_3022727_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004225248.1|3022780_3023131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004173705.1|3023383_3023569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3023621_3023963_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3023962_3024985_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004217362.1|3024987_3025215_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004225238.1|3025290_3025704_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.9	8.1e-31
WP_004152566.1|3025889_3027893_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3027882_3028035_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3028070_3028496_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_085955245.1|3028822_3030014_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152178.1|3029955_3030246_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_004152177.1|3030256_3031402_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3031405_3031846_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3031940_3032327_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3032326_3032833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3032829_3033249_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3033217_3033499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3033538_3034480_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3034491_3034986_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3034989_3036192_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3036243_3036792_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3036847_3038299_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3038536_3039937_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004218030.1|3039887_3040376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152170.1|3040741_3041062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3041296_3041686_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3041682_3042213_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3042215_3042464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218026.1|3042481_3042610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152168.1|3042647_3042803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3042869_3043652_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3043648_3044125_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004218023.1|3044121_3045099_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3045085_3046744_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3047320_3047542_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3047639_3048308_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3048478_3048793_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3048785_3048974_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004218017.1|3049347_3049509_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
WP_004152157.1|3049501_3049756_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
3049771:3049785	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004146412.1|3049823_3049946_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
WP_004152156.1|3049942_3050368_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3050364_3050559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3050555_3051383_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3051487_3052006_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3052011_3052722_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3052711_3052936_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004218013.1|3053031_3053145_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	4.6e-13
WP_014343018.1|3053387_3053621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198245.1|3053693_3053840_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_004152148.1|3053799_3054042_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3054022_3055204_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3055400_3055949_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3055780:3055794	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3056147_3057680_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3057896_3058658_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 9
NZ_CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	3091591	3179567	5439007	terminase,integrase,holin,tail,transposase,protease	Enterobacteria_phage(18.03%)	99	3091373:3091388	3154925:3154940
3091373:3091388	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|3091591_3092263_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3092449_3093277_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3093352_3094618_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|3094619_3095039_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004178082.1|3095118_3096606_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152776.1|3097500_3097923_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|3098515_3099220_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389365.1|3099396_3100161_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000376623.1|3100667_3101168_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|3101295_3102135_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3102128_3102476_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|3102639_3103431_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_015057121.1|3103576_3104536_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_001067855.1|3104426_3105131_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152703.1|3105379_3107323_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
WP_004152702.1|3107564_3108164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152700.1|3108388_3109120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644627.1|3109123_3112078_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
WP_004152652.1|3112154_3115223_-	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_004152651.1|3115219_3115600_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152650.1|3115609_3116092_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_004152649.1|3116272_3116737_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_004152648.1|3117051_3117387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|3117577_3118558_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004217331.1|3118670_3121568_-|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
WP_099119318.1|3121829_3122021_-	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
WP_004217333.1|3122245_3122602_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_016831940.1|3122678_3122885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004226994.1|3123022_3123505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217341.1|3123558_3124731_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004190640.1|3124754_3125147_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217343.1|3125143_3125695_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
WP_004217344.1|3125696_3126080_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004190646.1|3126066_3126300_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217346.1|3126309_3126564_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
WP_004217348.1|3126565_3126961_-	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_142689607.1|3127001_3127274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190653.1|3127282_3128236_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_004217351.1|3128246_3129032_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_019405022.1|3129562_3130675_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
WP_004218551.1|3130658_3132059_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
WP_004190663.1|3132058_3133366_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218556.1|3133343_3134348_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004218558.1|3135210_3135456_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004190672.1|3136414_3136690_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004190674.1|3136686_3137031_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004218565.1|3137027_3137567_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|3137563_3137863_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_022644626.1|3138341_3139388_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004232548.1|3139613_3140303_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3140302_3140443_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|3140439_3141078_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3141070_3141739_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3141735_3141903_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3141883_3142351_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004243011.1|3142483_3142762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218530.1|3142871_3143900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3144107_3144353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3144408_3144711_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3144707_3145556_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3145552_3146413_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3146498_3146720_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3146760_3146988_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3147099_3147798_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_004201109.1|3148085_3149162_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3149243_3149447_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004219883.1|3149757_3149883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004135674.1|3149875_3150070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3150158_3150443_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3150458_3151304_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|3151300_3151588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|3151589_3152270_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3152266_3152695_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3152691_3153354_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151900.1|3153561_3154779_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	8.6e-121
WP_004151901.1|3154925_3155816_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3154925:3154940	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3155815_3156808_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3156809_3157619_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004151902.1|3157663_3159043_-	cytosine permease	NA	NA	NA	NA	NA
WP_004152967.1|3159290_3159833_+	HutD family protein	NA	NA	NA	NA	NA
WP_004140277.1|3160031_3160820_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004151905.1|3161010_3162168_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002901787.1|3162249_3164184_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
WP_004140283.1|3164264_3164522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002901785.1|3164593_3165343_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_004225185.1|3165414_3165534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002901783.1|3165618_3165837_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_002901782.1|3165968_3166295_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_004151907.1|3166294_3167032_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_002901781.1|3167223_3168393_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_002901780.1|3168399_3168708_-	LapA family protein	NA	NA	NA	NA	NA
WP_002901779.1|3168843_3169611_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_002901778.1|3169774_3170377_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
WP_002901777.1|3170423_3173096_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_002901776.1|3173484_3173652_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_002901772.1|3173897_3174872_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_002901763.1|3175217_3177815_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
WP_002901761.1|3178221_3178473_+	YciN family protein	NA	NA	NA	NA	NA
WP_002901758.1|3178520_3179567_-|protease	protease SohB	protease	NA	NA	NA	NA
>prophage 10
NZ_CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	3533903	3626854	5439007	plate,terminase,portal,lysis,integrase,capsid,tail,head,protease,tRNA	Salmonella_phage(57.63%)	97	3589429:3589447	3626929:3626947
WP_002898139.1|3533903_3535196_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3535286_3536630_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3536638_3537250_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3537372_3541626_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3541761_3542256_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004147787.1|3542539_3542671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002898019.1|3542788_3543757_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3543871_3545638_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3545638_3547360_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_004141853.1|3547386_3548106_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3548459_3548678_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3548798_3551078_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3551108_3551426_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3551751_3551973_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3552049_3553990_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3553986_3555102_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3555248_3556907_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3557326_3558022_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3558137_3559037_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3559180_3560833_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3560843_3561812_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3562023_3562458_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3562609_3564328_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3564366_3565368_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3565378_3566821_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3566908_3567922_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3567918_3568749_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3568780_3569920_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3570797_3571313_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3571539_3572268_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3572288_3573020_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3573026_3573743_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3573742_3574411_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3574594_3575326_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3575368_3576841_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3576837_3577554_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3577632_3578760_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3578801_3579290_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3579347_3580193_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3580189_3581143_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_004176719.1|3581153_3582320_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.3e-30
WP_002896368.1|3582450_3583563_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3583911_3584391_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3584479_3585382_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3586203_3586491_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3586693_3586957_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3586963_3587347_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3587613_3589299_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_004226292.1|3589290_3589413_-	hypothetical protein	NA	NA	NA	NA	NA
3589429:3589447	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3589518_3589737_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3589828_3590929_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3590925_3591411_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_014342962.1|3591407_3593801_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
WP_002896220.1|3594027_3594147_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3594161_3594461_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3594513_3595029_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3595038_3596211_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3596349_3597426_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_004232615.1|3597455_3597617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3597655_3598387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3598390_3601342_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3601343_3601943_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3601935_3602844_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|3602830_3603193_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|3603189_3603762_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004226282.1|3603876_3604041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199112.1|3604039_3604549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3604545_3604992_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3604984_3605416_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896170.1|3605378_3605525_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896168.1|3605511_3605940_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3605936_3606320_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3606324_3606834_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3606814_3607030_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3607033_3607237_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3607236_3607701_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3607796_3608447_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3608450_3609509_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3609525_3610359_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3610501_3612268_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3612267_3613293_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3613354_3615097_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3615372_3616050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3616164_3616398_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3616408_3616597_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3616750_3619165_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3619161_3620019_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3620015_3620243_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3620242_3620476_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3620543_3620885_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3620848_3621049_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3621056_3621566_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3621598_3621820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3621965_3622844_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3622855_3623800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|3623898_3625386_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_014342959.1|3625873_3626854_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
3626929:3626947	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 11
NZ_CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	4073163	4118438	5439007	lysis,integrase,head,tRNA	Escherichia_phage(26.42%)	65	4066376:4066422	4115510:4115556
4066376:4066422	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004151249.1|4073163_4075641_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
WP_004151250.1|4075627_4076023_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004199076.1|4076019_4076490_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151252.1|4076489_4076966_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.7	3.0e-37
WP_004151253.1|4077008_4080455_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151254.1|4080547_4081051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151255.1|4081178_4081964_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151256.1|4082029_4082743_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151257.1|4082732_4082903_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151258.1|4083002_4083362_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151259.1|4083378_4083849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151260.1|4084142_4084397_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151261.1|4084399_4085155_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151262.1|4085330_4086008_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151263.1|4086060_4086813_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151264.1|4086881_4087274_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151265.1|4087270_4087696_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151266.1|4087698_4088061_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151267.1|4088060_4088234_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151268.1|4088233_4088614_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151269.1|4088616_4088856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151270.1|4088866_4089961_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151271.1|4089972_4090401_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151272.1|4090404_4091790_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151273.1|4091862_4092339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151274.1|4092380_4093385_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151275.1|4093359_4094781_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151276.1|4094793_4096266_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151277.1|4096265_4096868_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151279.1|4097238_4097568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151280.1|4097673_4098138_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151281.1|4098134_4098665_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151282.1|4098667_4098916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151283.1|4099825_4100515_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151284.1|4100511_4101042_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151285.1|4101034_4101172_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004151286.1|4101168_4101804_-	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151287.1|4101796_4101967_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151288.1|4101966_4102422_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151291.1|4102922_4103570_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151293.1|4103742_4104585_-	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151294.1|4104691_4105198_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151295.1|4105194_4105488_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004230547.1|4105487_4106903_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.1	1.8e-183
WP_004230546.1|4106907_4107759_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	56.3	5.3e-85
WP_004151298.1|4107799_4107946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001548453.1|4108031_4108253_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151299.1|4108293_4108527_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_004151300.1|4108654_4109344_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151301.1|4109694_4109910_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151302.1|4109906_4110017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151303.1|4110009_4110204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151304.1|4110292_4110577_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151305.1|4110592_4111438_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151306.1|4111434_4112115_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151308.1|4112111_4112270_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151310.1|4112266_4112923_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151312.1|4112919_4113687_+	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151314.1|4113683_4113902_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151316.1|4113903_4114119_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151317.1|4114120_4114456_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151318.1|4114332_4115496_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
WP_004143017.1|4115926_4116793_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4115510:4115556	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|4116794_4117007_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|4117052_4118438_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 12
NZ_CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	4327992	4339646	5439007	integrase	Enterobacteria_phage(70.0%)	15	4327844:4327857	4332057:4332070
4327844:4327857	attL	TCTGACATATTTTT	NA	NA	NA	NA
WP_004144574.1|4327992_4329096_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
WP_002889940.1|4329106_4330360_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4330712_4331903_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4331890_4332841_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
4332057:4332070	attR	AAAAATATGTCAGA	NA	NA	NA	NA
WP_004152979.1|4332840_4333266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020802988.1|4333612_4333762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4333834_4334401_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4334418_4334664_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4334660_4335398_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_004903606.1|4335697_4335835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002889915.1|4335939_4336206_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_072028197.1|4336208_4336760_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_004219964.1|4336804_4336984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4336980_4337301_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4337312_4339646_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
>prophage 13
NZ_CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	4807892	4813717	5439007		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152207.1|4807892_4810226_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4810240_4810561_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4810557_4810785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093163.1|4810781_4811324_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_000556592.1|4811326_4811593_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004152204.1|4812153_4812891_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4812887_4813133_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4813150_4813717_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
>prophage 1
NZ_CP029100	Klebsiella pneumoniae strain AR438 plasmid unnamed2	29625	8269	18567	29625	transposase	Escherichia_phage(50.0%)	8	NA	NA
WP_004199413.1|8269_11287_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_002903955.1|12495_13398_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|13659_14421_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|14441_15302_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_004217321.1|15438_16143_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001549892.1|16535_16775_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_001549893.1|16861_17524_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_000516402.1|17904_18567_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
>prophage 1
NZ_CP029101	Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence	208035	28675	138419	208035	transposase,integrase,protease	Escherichia_phage(15.79%)	101	20418:20432	140198:140211
20418:20432	attL	AAAGCTGCACGTTAT	NA	NA	NA	NA
WP_001515717.1|28675_29416_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
20418:20432	attL	AAAGCTGCACGTTAT	NA	NA	NA	NA
WP_004152065.1|30559_31507_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|31533_31845_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011977741.1|31864_32833_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	2.5e-184
WP_004197688.1|33505_33763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020444838.1|34364_35819_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|36801_38079_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|38141_40139_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|41178_42386_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
40445:40459	attR	ATAACGTGCAGCTTT	NA	NA	NA	NA
WP_004178091.1|43814_44246_-	silver-binding protein SilE	NA	NA	NA	NA	NA
40445:40459	attR	ATAACGTGCAGCTTT	NA	NA	NA	NA
WP_003032875.1|44496_45972_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|45964_46645_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|46834_48220_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|48248_48602_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|48715_50008_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|50018_53165_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|53251_53692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|53818_56266_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|56306_56504_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|56537_57275_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|57563_58013_-	copper resistance protein	NA	NA	NA	NA	NA
WP_004152083.1|58246_60064_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|60063_60960_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|60999_61380_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|61384_62314_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|62368_63049_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|63045_64446_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|64662_65097_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|65328_65508_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|67250_67760_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|67809_68307_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|68638_68965_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004152093.1|68961_69675_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|69683_70229_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|70304_70667_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|72563_73100_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|73132_73558_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|73570_74860_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|74907_76659_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|76676_77039_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|77088_77439_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|77796_78066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|78053_78629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|78659_79154_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|79197_79566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|79599_79803_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|79851_80109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|80184_80439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|80614_80881_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|80868_81351_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|81562_82909_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|84751_85714_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|85700_86450_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|86687_86885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|86884_89680_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|89794_90364_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|90398_90680_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|90923_91187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|91201_91465_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000019473.1|92666_93647_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152692.1|94855_95725_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152693.1|95718_96729_-	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152694.1|96737_97565_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152695.1|97573_98437_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004153729.1|98433_99261_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004217321.1|100116_100821_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_044503635.1|102124_102793_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	3.3e-130
WP_000018329.1|102982_103798_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|103948_104653_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|104774_105680_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|105676_106915_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|106914_107499_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|107991_108756_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|108982_109288_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|109298_110504_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|110659_110863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|110990_111830_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|111823_112171_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|112334_113126_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|113131_113422_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|113533_114031_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|114175_115189_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|115391_115742_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|115867_116428_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|116430_119397_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000656305.1|119463_119841_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000412211.1|120041_120701_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_016197752.1|121678_121909_+	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_004152560.1|121908_123297_+	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	1.1e-50
WP_000005560.1|123289_124402_+	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
WP_004118217.1|124398_125034_+	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_020956879.1|125581_125968_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	90.7	1.1e-58
WP_004152557.1|125964_126312_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
WP_004118832.1|130134_131868_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004118225.1|131875_132823_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004152278.1|132867_134472_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118227.1|134484_135405_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152279.1|135404_136253_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118229.1|136249_136843_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004118840.1|136839_137967_-	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118231.1|138251_138419_-|integrase	integrase	integrase	NA	NA	NA	NA
140198:140211	attR	TGAAAACCTGCGCA	NA	NA	NA	NA
>prophage 1
NZ_CP029102	Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence	135655	21104	33196	135655		Escherichia_phage(25.0%)	13	NA	NA
WP_004152355.1|21104_21806_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_014343518.1|22007_22124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568040.1|22242_22473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152354.1|22533_23205_-	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_004152353.1|23207_24179_-	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152352.1|24410_24842_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_004152351.1|24841_26113_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152350.1|26513_27410_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152349.1|27731_28937_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152348.1|28933_29908_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152347.1|30284_30617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004227314.1|30841_31057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152345.1|31168_33196_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
>prophage 2
NZ_CP029102	Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence	135655	37771	106703	135655	integrase,transposase	Escherichia_phage(26.09%)	59	28557:28574	105935:106372
28557:28574	attL	CCGCCGGCGCAAGTCGAT	NA	NA	NA	NA
WP_004152342.1|37771_39040_+|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
28557:28574	attL	CCGCCGGCGCAAGTCGAT	NA	NA	NA	NA
WP_004152341.1|39159_39633_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011977773.1|39724_39955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|40846_41629_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_004152339.1|41628_41961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004171440.1|41967_42366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|42391_42721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|42748_43057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153649.1|43102_43309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093212.1|43543_44005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|43961_44192_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|44188_44605_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004152334.1|44678_45389_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_072093211.1|46120_46246_+	mercury transporter	NA	NA	NA	NA	NA
WP_001340589.1|46281_46704_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|46755_48450_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|48467_48830_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|48826_49063_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|49098_49767_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|49805_51110_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000027057.1|51677_52538_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|54281_54986_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152403.1|55058_57956_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
WP_004152402.1|58044_58665_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
WP_004152400.1|59830_60190_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
WP_108716773.1|60693_61908_+|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
WP_004152397.1|62153_63473_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
63320:63337	attR	CCGCCGGCGCAAGTCGAT	NA	NA	NA	NA
WP_004152396.1|63722_64604_-	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
63320:63337	attR	CCGCCGGCGCAAGTCGAT	NA	NA	NA	NA
WP_004152394.1|64891_65671_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|65667_66693_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|66799_69829_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|69938_71654_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001445937.1|72188_73145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153015.1|73664_78926_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_004152379.1|79006_79732_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.8	7.1e-06
WP_004152380.1|79803_80397_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_015060010.1|80557_81160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153014.1|81209_81854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152382.1|81909_82560_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_004152383.1|82556_82865_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
WP_014343478.1|83040_83520_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	2.7e-17
WP_013609506.1|83637_83907_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_004171450.1|84138_84216_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004152386.1|84208_85066_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_072093200.1|85116_85275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093201.1|85359_85494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152388.1|86284_86848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152389.1|86831_87443_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001445937.1|87839_88796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152391.1|89330_91046_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|91155_94185_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|94291_95317_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|95313_96093_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004152396.1|96380_97262_+	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152397.1|97511_98831_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152400.1|100794_101154_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
WP_004152402.1|102319_102940_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
WP_004152403.1|103028_105926_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
WP_001067855.1|105998_106703_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
