The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029133	Proteus mirabilis strain AR379 chromosome, complete genome	4219380	82346	91190	4219380		Caulobacter_phage(50.0%)	9	NA	NA
WP_017827550.1|82346_83492_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	1.2e-31
WP_004245609.1|83884_84469_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_036919012.1|84469_85630_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_004245607.1|85654_86110_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_004249445.1|86144_87170_+	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004249446.1|87237_87816_+	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245603.1|87892_88468_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004245602.1|88564_89245_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_108716811.1|89645_91190_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.0e-11
>prophage 2
NZ_CP029133	Proteus mirabilis strain AR379 chromosome, complete genome	4219380	647579	687124	4219380	head,tail,tRNA,terminase,lysis	Burkholderia_phage(23.08%)	52	NA	NA
WP_049197309.1|647579_648080_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	56.4	8.0e-41
WP_108716871.1|648079_650047_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	39.8	7.6e-119
WP_108716872.1|650061_650346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108716873.1|650357_650690_-	hypothetical protein	NA	H9C158	Pectobacterium_phage	38.1	3.6e-05
WP_060556278.1|650947_651148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108716874.1|651144_651525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108717280.1|651878_652520_-	LexA family transcriptional regulator	NA	H9C160	Pectobacterium_phage	35.6	1.6e-30
WP_108716875.1|652626_652812_+	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	60.0	1.9e-08
WP_036895397.1|652852_653308_+|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	55.4	5.8e-30
WP_004250533.1|653325_653550_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	55.4	9.5e-18
WP_108716876.1|653551_654418_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	59.7	3.1e-32
WP_080047789.1|654410_655004_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	47.6	1.4e-44
WP_080047790.1|654996_656370_+	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	45.4	4.2e-100
WP_080047791.1|656567_656801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049219165.1|656797_657601_+	DNA adenine methylase	NA	A0A0K1LM14	Caulobacter_phage	46.1	9.2e-63
WP_108716877.1|658026_658620_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	54.7	4.3e-57
WP_049211163.1|658631_658943_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	68.8	5.9e-34
WP_049211165.1|658930_659464_+	antiterminator	NA	Q5TJL7	Enterobacteria_phage	51.9	6.1e-39
WP_080047945.1|659732_660731_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_108717281.1|660746_661946_+	hypothetical protein	NA	A0A291AUQ1	Sinorhizobium_phage	27.5	1.1e-32
WP_049211167.1|662150_662420_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	46.7	4.8e-16
WP_080047793.1|662419_662890_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	59.9	6.8e-50
WP_080047794.1|663032_663494_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	73.5	2.9e-45
WP_006533523.1|663613_663805_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	53.4	3.6e-10
WP_080047795.1|663874_664873_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	37.0	8.2e-37
WP_080047947.1|665323_666685_+	TerL protein	NA	A9YWZ6	Burkholderia_phage	61.6	2.4e-156
WP_080047796.1|666689_668192_+	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	42.4	1.0e-99
WP_080047948.1|668229_668943_+|head	phage head morphogenesis protein	head	A0A2H5BG15	Pseudoalteromonas_phage	35.7	1.4e-33
WP_080047797.1|668939_670199_+	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	51.3	1.6e-45
WP_049221480.1|670198_670696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250578.1|670695_671763_+	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	39.3	1.1e-52
WP_080047798.1|671832_672174_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	35.5	1.6e-08
WP_080047799.1|672176_672608_+	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	32.4	3.3e-11
WP_080047800.1|672607_673066_+	hypothetical protein	NA	Q6IWU9	Burkholderia_phage	39.6	8.5e-13
WP_080047801.1|673065_673437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036937870.1|673423_673939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080047802.1|673947_675435_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	38.3	7.9e-84
WP_080047803.1|675445_675898_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.8	3.4e-22
WP_004250588.1|675937_676396_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	6.7e-26
WP_080047804.1|676479_678774_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	27.7	1.4e-18
WP_080047805.1|678770_679298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250595.1|679297_679615_+	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	32.3	7.4e-08
WP_036937853.1|679580_680396_+	hypothetical protein	NA	A1Z005	Burkholderia_virus	26.0	1.8e-10
WP_049197352.1|680398_681091_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	39.4	9.1e-35
WP_080047806.1|681087_681432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250602.1|681424_682612_+	hypothetical protein	NA	Q6IWQ3	Burkholderia_phage	40.6	1.1e-69
WP_004250603.1|682608_683265_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.3	7.5e-39
WP_108716878.1|683270_684710_+|tail	phage tail protein	tail	A0A2K9V2I0	Shigella_phage	42.3	2.2e-30
WP_080047809.1|684839_685394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080047810.1|685497_685773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895334.1|685797_686043_-	DinI-like family protein	NA	NA	NA	NA	NA
WP_004248453.1|686593_687124_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	31.5	1.4e-06
>prophage 3
NZ_CP029133	Proteus mirabilis strain AR379 chromosome, complete genome	4219380	886941	905809	4219380	holin,lysis	Burkholderia_phage(26.67%)	22	NA	NA
WP_108716897.1|886941_887757_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	1.6e-54
WP_004248367.1|888137_888437_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_017628006.1|888439_888844_+	hypothetical protein	NA	A0A0E3JJ20	Enterobacteria_phage	46.6	1.0e-25
WP_060555551.1|888840_889290_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_004248364.1|889326_889839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004248362.1|889847_891335_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.9e-77
WP_004243628.1|891345_891798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243627.1|891857_892316_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_108716899.1|892398_894702_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.8	4.4e-17
WP_036971128.1|894704_895199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243623.1|895204_895525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243622.1|895493_896306_+	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243621.1|896308_897001_+	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
WP_004243617.1|896997_897342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628010.1|897334_898522_+	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.7	1.9e-72
WP_004243615.1|898518_899175_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.9	2.3e-35
WP_108716900.1|899180_900416_+	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	34.1	2.4e-14
WP_017628013.1|900555_900735_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_004243612.1|901303_901846_+	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	1.9e-19
WP_004243611.1|901961_902738_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_049213336.1|902741_903359_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	68.3	4.4e-89
WP_012368081.1|903370_905809_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
>prophage 4
NZ_CP029133	Proteus mirabilis strain AR379 chromosome, complete genome	4219380	1265223	1354044	4219380	head,capsid,tail,portal,integrase,terminase,protease,lysis	Proteus_phage(18.52%)	128	1268344:1268398	1321186:1321240
WP_036895086.1|1265223_1266219_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.9	9.3e-73
WP_012367595.1|1266175_1266421_-	excisionase	NA	NA	NA	NA	NA
WP_004247455.1|1266417_1266756_-	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	45.0	5.6e-14
WP_036976666.1|1267689_1268148_-	ASCH domain-containing protein	NA	M1F3E2	Salmonella_phage	25.9	1.8e-10
WP_036976668.1|1268186_1268366_-	hypothetical protein	NA	NA	NA	NA	NA
1268344:1268398	attL	TCTTCTTTGAGTTTATCTGTCATATCTATCTCCTGTTTGCATCCTTGCACTGAGT	NA	NA	NA	NA
WP_036976670.1|1268433_1268862_-	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	73.9	4.7e-50
WP_080047825.1|1268851_1269550_-	YqaJ viral recombinase family protein	NA	A0A2R2Z325	Escherichia_phage	57.8	7.0e-75
WP_036976671.1|1269546_1270431_-	recombinase RecT	NA	A0A2L1IV84	Escherichia_phage	61.9	2.2e-94
WP_036976673.1|1270427_1270679_-	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	96.4	3.2e-38
WP_036976674.1|1270806_1270989_-	host cell division inhibitory peptide Kil	NA	A0A1P8DTH8	Proteus_phage	85.0	2.8e-20
WP_049254977.1|1271337_1271553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036976675.1|1271549_1271765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049237113.1|1271773_1272085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155120987.1|1272553_1272733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080047827.1|1272677_1273646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036907954.1|1273783_1274509_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	42.0	8.9e-41
WP_036907955.1|1274614_1274842_+	helix-turn-helix domain-containing protein	NA	E5AGE7	Erwinia_phage	67.6	6.0e-20
WP_036907956.1|1274984_1275332_+	hypothetical protein	NA	A0A1P8DTF0	Proteus_phage	35.4	2.6e-06
WP_108716939.1|1275598_1276366_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	51.9	1.2e-22
WP_017628813.1|1276365_1277751_+	AAA family ATPase	NA	Q716D2	Shigella_phage	47.7	1.4e-114
WP_026090523.1|1277778_1278108_+	hypothetical protein	NA	A0A1C9LVV9	Vibrio_phage	39.0	1.1e-22
WP_036919942.1|1278175_1278625_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	2.9e-13
WP_004245984.1|1278703_1278994_+	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_004245982.1|1279338_1279971_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	34.3	3.3e-23
WP_004247148.1|1280282_1280804_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_060555895.1|1280962_1281385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247489.1|1281438_1281708_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	6.0e-19
WP_108716940.1|1281707_1282178_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	61.2	2.2e-48
WP_036907970.1|1282320_1282782_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	48.3	5.7e-25
WP_036976683.1|1282990_1283419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108716941.1|1283947_1284556_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	68.0	8.2e-64
WP_058336162.1|1284558_1286046_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	89.3	2.6e-265
WP_108716942.1|1286045_1287416_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	48.6	2.0e-118
WP_049235950.1|1287412_1288534_+	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	51.2	1.8e-104
WP_108716943.1|1288645_1289407_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.3	2.0e-67
WP_004245970.1|1289420_1290374_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.6	1.4e-126
WP_162558083.1|1290376_1290661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245968.1|1290699_1291179_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.7	2.9e-32
WP_108716944.1|1291181_1291532_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	44.2	6.4e-21
WP_004245966.1|1291533_1292115_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	51.6	1.0e-47
WP_108716945.1|1292111_1292513_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_004247505.1|1292558_1293215_+	hypothetical protein	NA	G8C7Q3	Escherichia_phage	57.7	8.6e-59
WP_004245960.1|1293266_1293572_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	55.4	6.6e-22
WP_080974786.1|1293598_1293874_+	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	49.3	8.6e-13
WP_004247508.1|1293902_1294109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247509.1|1294261_1294633_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	65.7	4.4e-36
WP_004247510.1|1294646_1294829_-	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	76.3	3.7e-20
WP_141225987.1|1295231_1295423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108716946.1|1295397_1295895_+	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_060555897.1|1296154_1296991_-	antirepressor	NA	I6S627	Salmonella_phage	59.6	1.7e-72
WP_049195353.1|1297155_1297545_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049195351.1|1297697_1298099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064971710.1|1298211_1298484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049195350.1|1298551_1298785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053089294.1|1298910_1299732_+	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	50.9	2.3e-21
WP_108716947.1|1299792_1302723_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	35.5	1.1e-132
WP_004245945.1|1302734_1303025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247516.1|1303387_1303729_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	50.0	9.0e-28
WP_004247517.1|1303725_1304469_+|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	58.6	7.1e-86
WP_004247518.1|1304465_1305176_+	C40 family peptidase	NA	A0A1P8DTI6	Proteus_phage	62.0	8.9e-86
WP_004247519.1|1305172_1305778_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	56.8	1.9e-52
WP_108716948.1|1305829_1310023_+	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	54.4	2.2e-301
WP_004245936.1|1310016_1310385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367646.1|1310386_1311001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247524.1|1311050_1311311_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
WP_012367647.1|1312019_1312325_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017628485.1|1312425_1313508_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_036919965.1|1313517_1316052_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_012367650.1|1316061_1316787_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_012367651.1|1316852_1317398_-	uroepithelial cell adherence major pilin UcaA	NA	NA	NA	NA	NA
WP_012367652.1|1317891_1318032_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	93.5	7.2e-16
WP_049211075.1|1318306_1319302_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.9	5.4e-73
WP_049211074.1|1319258_1319504_-	excisionase	NA	NA	NA	NA	NA
WP_108716949.1|1319500_1319839_-	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	45.0	1.3e-13
WP_049211072.1|1320165_1320411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049211071.1|1320403_1320673_-	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	53.9	4.1e-15
WP_049211070.1|1320672_1320852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036932464.1|1320881_1321208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049212213.1|1321241_1321580_-	hypothetical protein	NA	NA	NA	NA	NA
1321186:1321240	attR	TCTTCTTTGAGTTTATCTGTCATATCTATCTCCTGTTTGCATCCTTGCACTGAGT	NA	NA	NA	NA
WP_049212214.1|1321595_1322093_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	68.4	5.7e-47
WP_108716950.1|1322085_1322619_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	58.9	4.8e-52
WP_108716951.1|1322675_1323503_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	56.6	5.5e-79
WP_108716952.1|1323568_1323943_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	70.6	7.1e-42
WP_152692713.1|1324205_1324733_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	32.5	2.5e-16
WP_036905221.1|1324945_1325149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905224.1|1325244_1325877_-	LexA family transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	44.8	3.9e-40
WP_036905227.1|1325979_1326171_+	cell division protein	NA	NA	NA	NA	NA
WP_071233569.1|1326222_1326885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036900998.1|1326900_1327359_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	6.0e-27
WP_004247132.1|1327645_1327825_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	1.1e-11
WP_108716954.1|1327837_1328899_+	replication protein	NA	H2DE83	Erwinia_phage	55.3	7.9e-30
WP_049219109.1|1329533_1329929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036904907.1|1330001_1330385_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	53.7	1.7e-27
WP_108716955.1|1330403_1331207_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.7	4.4e-89
WP_108716956.1|1331203_1332229_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.7	9.9e-86
WP_049211559.1|1332256_1332937_+	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	50.0	3.6e-52
WP_049210579.1|1333095_1333290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108716957.1|1333363_1334386_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	70.1	5.3e-132
WP_087726597.1|1334638_1335061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087726596.1|1335217_1335553_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_108716958.1|1335633_1335870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049217868.1|1335823_1336081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334538.1|1336219_1336489_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	2.7e-19
WP_087726540.1|1336488_1336959_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	61.2	6.8e-50
WP_004250565.1|1337101_1337563_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	34.0	8.5e-13
WP_108716959.1|1338211_1338796_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	41.0	2.4e-20
WP_108716960.1|1338792_1339002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108716961.1|1339033_1339342_+	hypothetical protein	NA	Q8HA83	Salmonella_phage	68.0	2.2e-33
WP_108716962.1|1339374_1339713_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.0	7.1e-41
WP_006537823.1|1339715_1339928_+	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	44.8	1.4e-07
WP_036905779.1|1340052_1340520_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	5.5e-44
WP_108716963.1|1340473_1342216_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.1	3.8e-146
WP_108716964.1|1342216_1343548_+|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	76.7	2.7e-200
WP_058336090.1|1343544_1344396_+|protease	Clp protease ClpP	protease	A0A1P8DTI2	Proteus_phage	84.6	5.4e-130
WP_058336091.1|1344407_1345622_+|capsid	phage major capsid protein	capsid	A0A1P8DTJ7	Proteus_phage	89.4	1.9e-200
WP_108716965.1|1345667_1345886_+	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	81.0	6.4e-11
WP_058336093.1|1345885_1346212_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1P8DTJ4	Proteus_phage	75.0	5.8e-40
WP_108716966.1|1346220_1346550_+|head	phage head closure protein	head	B5WZS5	Pseudomonas_phage	38.7	1.1e-11
WP_108716967.1|1346539_1347013_+	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	31.5	4.3e-12
WP_004251583.1|1347018_1347360_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_108716968.1|1347369_1348035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251577.1|1348099_1348516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072071177.1|1348512_1348791_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_108716969.1|1348831_1352119_+|tail	phage tail tape measure protein	tail	Q8W6T6	Burkholderia_virus	40.2	9.6e-50
WP_108716970.1|1352119_1352716_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	53.3	3.5e-51
WP_006537803.1|1352715_1353297_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	3.1e-52
WP_004251562.1|1353308_1353614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251558.1|1353645_1354044_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	47.7	9.2e-32
>prophage 5
NZ_CP029133	Proteus mirabilis strain AR379 chromosome, complete genome	4219380	1782616	1789371	4219380		Proteus_phage(66.67%)	8	NA	NA
WP_157677999.1|1782616_1782754_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	81.4	7.8e-15
WP_004247902.1|1783148_1783313_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-22
WP_108717015.1|1783806_1784769_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_108717016.1|1784749_1786339_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	34.5	5.4e-14
WP_108717017.1|1786335_1786965_+	TIGR02646 family protein	NA	NA	NA	NA	NA
WP_162558075.1|1787883_1788438_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	81.3	6.5e-68
WP_108717019.1|1788462_1789047_-	hypothetical protein	NA	A0A2H4PRH0	Proteus_phage	70.0	4.0e-23
WP_108717020.1|1789047_1789371_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	62.3	1.2e-26
>prophage 6
NZ_CP029133	Proteus mirabilis strain AR379 chromosome, complete genome	4219380	1792873	1801197	4219380	integrase	Phage_21(25.0%)	13	1787190:1787206	1800941:1800957
1787190:1787206	attL	AATAATAAATAACATAC	NA	NA	NA	NA
WP_036970167.1|1792873_1793263_-	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	2.1e-12
WP_049206751.1|1793385_1793613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108717022.1|1793654_1794671_-	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	66.2	3.0e-127
WP_049202017.1|1794972_1795179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247850.1|1795485_1795758_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	67.2	1.3e-16
WP_004247849.1|1795763_1796021_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012367807.1|1796175_1796436_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004247847.1|1796657_1797056_-	antitermination protein Q	NA	B6SCZ7	Bacteriophage	55.3	4.6e-31
WP_036970213.1|1797068_1798142_-	hypothetical protein	NA	A0A2H4JEZ8	uncultured_Caudovirales_phage	36.3	4.9e-27
WP_108717285.1|1798472_1799120_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	44.0	3.7e-46
WP_049206746.1|1799376_1799619_+	excisionase	NA	NA	NA	NA	NA
WP_036970219.1|1799599_1800727_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	59.3	3.7e-118
WP_108717023.1|1801023_1801197_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	83.3	1.5e-18
1800941:1800957	attR	GTATGTTATTTATTATT	NA	NA	NA	NA
>prophage 7
NZ_CP029133	Proteus mirabilis strain AR379 chromosome, complete genome	4219380	1967439	2046440	4219380	plate,protease,tRNA	Bacillus_phage(18.75%)	57	NA	NA
WP_004244624.1|1967439_1967871_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_108717048.1|1967878_1969654_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004244621.1|1969617_1970655_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004247648.1|1970659_1971928_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_004244619.1|1971929_1972481_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_017628433.1|1972473_1973841_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244617.1|1973833_1974589_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004247646.1|1974597_1977321_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	1.4e-83
WP_004244614.1|1977324_1978113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244612.1|1978114_1978765_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244611.1|1978770_1980234_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004244610.1|1980236_1983785_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004244609.1|1983822_1985178_+	membrane protein	NA	NA	NA	NA	NA
WP_004247642.1|1985170_1986907_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_004244607.1|1986997_1987471_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004247640.1|1987563_1988214_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244605.1|1988263_1988812_-	YcbK family protein	NA	NA	NA	NA	NA
WP_004247638.1|1989143_1990859_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004247637.1|1991208_1991922_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_004247636.1|1992328_1992982_+	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	80.4	8.2e-102
WP_004247635.1|1993263_1997721_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_004247634.1|1997717_1998449_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_004244597.1|1998429_1999752_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004247633.1|1999761_2000535_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004247632.1|2000914_2001745_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004244594.1|2001867_2002629_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004244593.1|2002633_2002813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247631.1|2003227_2003443_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244590.1|2003938_2004940_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004244589.1|2004936_2006682_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_004244587.1|2009525_2009813_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_004244586.1|2009877_2011551_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244585.1|2011732_2012410_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_004247629.1|2012698_2013985_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004244582.1|2014181_2015270_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
WP_104459796.1|2015406_2016837_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.8	1.5e-07
WP_108717050.1|2016973_2018227_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004244579.1|2018301_2019339_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_036971369.1|2019566_2021324_+	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_004244577.1|2021994_2022849_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_004244576.1|2022903_2025186_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_004244575.1|2025293_2026034_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_108717051.1|2026391_2027297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108717052.1|2027369_2028419_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_108717053.1|2028819_2029152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244571.1|2029331_2030621_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
WP_012367706.1|2030754_2032104_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
WP_004244569.1|2032114_2032720_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_108717054.1|2032832_2036663_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244566.1|2036790_2037285_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004247618.1|2037827_2038787_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	1.2e-64
WP_036894531.1|2038925_2040695_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
WP_004244562.1|2040697_2042449_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.4e-18
WP_004247616.1|2042450_2043143_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004244560.1|2043462_2043681_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004244559.1|2043800_2046095_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244558.1|2046125_2046440_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
>prophage 8
NZ_CP029133	Proteus mirabilis strain AR379 chromosome, complete genome	4219380	2212992	2268440	4219380	tail,tRNA,integrase,terminase,lysis,bacteriocin	Cronobacter_phage(19.15%)	77	2214769:2214784	2275656:2275671
WP_012367653.1|2212992_2214660_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	85.0	1.0e-286
2214769:2214784	attL	GTAATTAATGAGAAAA	NA	NA	NA	NA
WP_046335367.1|2214902_2215133_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	92.1	1.2e-31
WP_046335368.1|2215492_2215747_-	cloacin	NA	NA	NA	NA	NA
WP_036969576.1|2215964_2216222_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_052715557.1|2216224_2218087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247523.1|2218519_2219134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004245936.1|2219135_2219504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108716948.1|2219497_2223691_-	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	54.4	2.2e-301
WP_046334564.1|2223742_2224330_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	60.4	2.9e-58
WP_046334563.1|2224326_2225037_-	C40 family peptidase	NA	F1C573	Cronobacter_phage	66.4	1.8e-86
WP_004245940.1|2225033_2225777_-|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	59.0	1.4e-86
WP_004247516.1|2225773_2226115_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	50.0	9.0e-28
WP_046334562.1|2226258_2226459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247513.1|2226478_2226769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247512.1|2226808_2227021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247511.1|2227043_2229983_-|tail	phage tail tape measure protein	tail	A0A2P0WA05	Enterobacter_phage	35.4	1.2e-141
WP_046334561.1|2230042_2230912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049257266.1|2230949_2231843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334560.1|2231839_2232097_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_004245955.1|2232210_2232372_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_046334559.1|2232441_2233275_+	antirepressor	NA	I6S627	Salmonella_phage	55.6	3.7e-67
WP_109880200.1|2233547_2234549_-	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	31.0	1.8e-36
WP_004247510.1|2234883_2235066_+	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	76.3	3.7e-20
WP_004247509.1|2235079_2235451_-	hypothetical protein	NA	E7C9U7	Salmonella_phage	65.7	4.4e-36
WP_080942618.1|2235837_2236113_-	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	49.3	6.6e-13
WP_004245960.1|2236139_2236445_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	55.4	6.6e-22
WP_004247505.1|2236496_2237153_-	hypothetical protein	NA	G8C7Q3	Escherichia_phage	57.7	8.6e-59
WP_046334555.1|2237198_2237600_-	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_046334553.1|2237596_2238178_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	51.6	1.8e-47
WP_046334552.1|2238179_2238530_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	41.6	5.1e-18
WP_004245968.1|2238532_2239012_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.7	2.9e-32
WP_107033975.1|2239051_2239336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334550.1|2239338_2240292_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.2	2.4e-126
WP_046334549.1|2240305_2241079_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.7	3.5e-67
WP_046334548.1|2241161_2241749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334547.1|2241765_2242869_-	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	50.4	2.1e-102
WP_046334545.1|2242865_2244236_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.4	2.8e-120
WP_046334544.1|2244235_2245810_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	86.9	7.8e-284
WP_046334543.1|2245806_2246373_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	64.1	1.8e-57
WP_046334542.1|2246398_2246668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245979.1|2246879_2247086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334540.1|2248011_2248473_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	34.1	2.8e-08
WP_046334539.1|2248615_2249086_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	61.2	2.6e-49
WP_046334538.1|2249085_2249355_-	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	2.7e-19
WP_046334537.1|2249421_2249844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334536.1|2249987_2250395_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_046334535.1|2251043_2251256_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	77.1	3.4e-25
WP_058336160.1|2251840_2252299_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_046335273.1|2252538_2253171_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	33.8	2.1e-22
WP_046335274.1|2253170_2253527_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	72.4	1.4e-44
WP_004245984.1|2253523_2253814_-	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_012367619.1|2253892_2254342_-	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	3.7e-13
WP_046335275.1|2254367_2255753_-	AAA family ATPase	NA	Q716D2	Shigella_phage	47.7	1.0e-114
WP_012367617.1|2255752_2256520_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	51.9	1.5e-22
WP_046335276.1|2256786_2257134_-	hypothetical protein	NA	A0A1P8DTF0	Proteus_phage	35.4	3.4e-06
WP_004245989.1|2257297_2257507_-	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	98.6	3.3e-33
WP_004245990.1|2257589_2258273_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	98.2	1.5e-130
WP_004245991.1|2258281_2258623_+	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	62.8	2.1e-37
WP_004247475.1|2258748_2259873_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_004247474.1|2259869_2260379_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_108717071.1|2260802_2261120_+	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	51.4	6.0e-18
WP_036976675.1|2261128_2261344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049254977.1|2261340_2261556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895085.1|2261725_2262268_+	hypothetical protein	NA	A0A1B1W2E3	Salmonella_phage	38.5	1.8e-33
WP_004247466.1|2262378_2262606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628822.1|2262857_2263112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628824.1|2263257_2263578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628825.1|2263579_2264464_+	ATP-binding protein	NA	A0A1B1P9H8	Acinetobacter_phage	52.0	1.9e-61
WP_088206760.1|2264453_2264993_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	59.7	8.1e-55
WP_094960056.1|2265253_2265709_+	ASCH domain-containing protein	NA	M1F3E2	Salmonella_phage	25.9	5.4e-12
WP_049199156.1|2265771_2266026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088206763.1|2266096_2266351_+	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	64.3	3.8e-23
WP_088206764.1|2266343_2266589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154599060.1|2266747_2266909_+	hypothetical protein	NA	A0A1P8DTF6	Proteus_phage	100.0	2.6e-25
WP_094960055.1|2266901_2267240_+	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	45.0	1.9e-14
WP_012367595.1|2267236_2267482_+	excisionase	NA	NA	NA	NA	NA
WP_108717072.1|2267438_2268440_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	43.1	9.1e-68
2275656:2275671	attR	TTTTCTCATTAATTAC	NA	NA	NA	NA
>prophage 9
NZ_CP029133	Proteus mirabilis strain AR379 chromosome, complete genome	4219380	2304355	2316317	4219380		Mycobacterium_phage(25.0%)	12	NA	NA
WP_004246054.1|2304355_2305567_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
WP_026090527.1|2305765_2306029_+	YbeD family protein	NA	NA	NA	NA	NA
WP_004246056.1|2306386_2307031_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_004246057.1|2307132_2308098_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246058.1|2308113_2308488_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246068.1|2309556_2309766_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246069.1|2309963_2310437_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246071.1|2310718_2310943_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246072.1|2310954_2311359_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004252248.1|2311387_2313514_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
WP_004247427.1|2313539_2314508_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
WP_004247426.1|2315117_2316317_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
>prophage 10
NZ_CP029133	Proteus mirabilis strain AR379 chromosome, complete genome	4219380	2555208	2629932	4219380	protease,transposase	Sodalis_phage(20.0%)	60	NA	NA
WP_004239726.1|2555208_2556273_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004239729.1|2558390_2560760_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001351060.1|2560770_2562852_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_077788456.1|2563770_2563968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001351058.1|2564170_2564407_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_071550302.1|2564312_2564531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000669584.1|2565412_2565823_-	fimbrial protein	NA	NA	NA	NA	NA
WP_105874332.1|2566668_2566725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004239731.1|2567039_2567351_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_004239732.1|2567365_2567698_-	exported protein	NA	NA	NA	NA	NA
WP_017827828.1|2567732_2567924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036919097.1|2568141_2569053_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	43.1	7.2e-56
WP_000202155.1|2569073_2569541_-	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_000370330.1|2569973_2570174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004239734.1|2570424_2572479_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	28.9	7.4e-40
WP_000748138.1|2572488_2573025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000437242.1|2573072_2573777_-	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000115888.1|2574059_2574578_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_004239736.1|2574827_2576123_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004239737.1|2576249_2576534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042848758.1|2576523_2577114_-	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_000845359.1|2577638_2579288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000549132.1|2579302_2580655_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	53.5	6.6e-122
WP_001095747.1|2580866_2581298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001351053.1|2581375_2582263_-	ParA family protein	NA	NA	NA	NA	NA
WP_004247373.1|2582710_2582959_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.5	2.9e-07
WP_036905867.1|2583178_2583451_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004252392.1|2583677_2583947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036900799.1|2583950_2584529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107034653.1|2585653_2585761_+	DUF2618 domain-containing protein	NA	NA	NA	NA	NA
WP_108717087.1|2586134_2588297_+	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_004247370.1|2588360_2589689_+	putrescine-ornithine antiporter	NA	NA	NA	NA	NA
WP_049196952.1|2589818_2590496_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001985443.1|2590763_2592023_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001985442.1|2592042_2594205_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.5	8.0e-29
WP_001985440.1|2594229_2595483_-	TolC family protein	NA	NA	NA	NA	NA
WP_026090475.1|2595587_2597525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244870.1|2602593_2602899_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004244871.1|2603540_2604332_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004244872.1|2604305_2605163_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036919891.1|2605501_2606653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052124582.1|2606665_2607202_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_036919888.1|2607201_2607735_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_036919887.1|2607727_2608156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036919885.1|2608187_2608919_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_036972201.1|2608954_2611477_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_036919880.1|2611537_2612110_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_036972197.1|2612299_2612860_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004247348.1|2613004_2613289_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_104459489.1|2613933_2614758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036969813.1|2614754_2615207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036969810.1|2615369_2616338_+	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_036969808.1|2616456_2617878_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_104731524.1|2617903_2620621_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_108717089.1|2620613_2621258_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_004247343.1|2621313_2622699_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_108717090.1|2623067_2624324_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_004244894.1|2624317_2625202_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_108717091.1|2625669_2627661_+|protease	metalloprotease	protease	NA	NA	NA	NA
WP_036919866.1|2627967_2629932_+|protease	metalloprotease	protease	NA	NA	NA	NA
>prophage 11
NZ_CP029133	Proteus mirabilis strain AR379 chromosome, complete genome	4219380	3687802	3696649	4219380	integrase	Morganella_phage(50.0%)	14	3678052:3678066	3700895:3700909
3678052:3678066	attL	AGTGTATTTTTTAAT	NA	NA	NA	NA
WP_108717187.1|3687802_3689014_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	68.7	2.3e-158
WP_108717188.1|3689227_3689887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108717189.1|3690066_3690285_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	45.3	4.3e-07
WP_108717190.1|3690284_3690677_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	58.7	2.5e-29
WP_108717191.1|3690692_3690968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108717192.1|3690989_3691784_+	phage antirepressor Ant	NA	A0A0R6PJV6	Moraxella_phage	48.3	1.7e-24
WP_108717193.1|3691884_3692076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162558080.1|3692125_3692422_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_108717195.1|3692414_3692609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108717196.1|3692601_3692808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108717197.1|3692800_3692998_+	hypothetical protein	NA	A0A1W6JPF0	Morganella_phage	66.0	3.2e-09
WP_108717198.1|3692985_3693294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108717199.1|3693293_3693836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108717200.1|3693931_3696649_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	67.4	0.0e+00
3700895:3700909	attR	ATTAAAAAATACACT	NA	NA	NA	NA
