The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029128	Klebsiella oxytoca strain AR380 chromosome, complete genome	5925399	388074	440687	5925399	lysis,holin,tail,integrase	Escherichia_phage(22.22%)	62	382297:382312	431090:431105
382297:382312	attL	CCTTTTCCGCAAACAG	NA	NA	NA	NA
WP_108703867.1|388074_391695_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.3	1.8e-153
WP_108703868.1|391660_395203_-	hypothetical protein	NA	Q6UAW1	Klebsiella_phage	64.0	0.0e+00
WP_108703869.1|395212_395824_-|tail	tail assembly protein	tail	K7P6V1	Enterobacteria_phage	62.5	5.7e-57
WP_108703870.1|395942_396656_-	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	70.3	6.6e-105
WP_108703871.1|396667_397420_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	67.1	2.0e-99
WP_108703872.1|397416_397764_-|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	61.7	1.0e-34
WP_108703873.1|397768_398005_-	hypothetical protein	NA	K7P7A9	Enterobacteria_phage	41.8	5.7e-05
WP_108703874.1|398291_398540_-|lysis	lysis protein	lysis	A0A127KNH9	Pseudomonas_phage	36.4	1.3e-07
WP_108703875.1|398662_398851_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_108703876.1|398914_399319_+	HicB family protein	NA	NA	NA	NA	NA
WP_108703877.1|399532_400138_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	50.8	3.6e-51
WP_108703878.1|400134_400479_-	DUF968 domain-containing protein	NA	Q6V7S4	Burkholderia_virus	52.5	1.7e-21
WP_108703881.1|401754_402018_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	69.0	9.1e-28
WP_162556068.1|402031_402184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162556077.1|402180_402342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108703882.1|402338_403127_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.7	5.6e-65
WP_108703883.1|403119_403335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108703884.1|403331_404000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108703885.1|404020_405010_-	hypothetical protein	NA	S5FM81	Shigella_phage	41.8	2.4e-28
WP_108703887.1|405275_405689_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	70.5	3.7e-44
WP_108703888.1|405688_405958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108703889.1|406007_406514_+	hypothetical protein	NA	Q7Y5W5	Haemophilus_phage	47.4	1.1e-10
WP_108703890.1|406927_407218_+	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_162556078.1|407310_407529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108703891.1|407634_407850_+	DUF1233 family excisionase	NA	NA	NA	NA	NA
WP_108703892.1|407849_409136_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U2JGI6	Escherichia_phage	54.2	4.3e-123
WP_088402565.1|409165_409249_+	protein MgtS	NA	NA	NA	NA	NA
WP_108703893.1|409855_410134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017145799.1|410299_411331_-	methionine synthase	NA	NA	NA	NA	NA
WP_108703894.1|411358_412336_-	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_070557679.1|412656_413886_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_064395819.1|414187_414646_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004102389.1|415035_416106_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	44.3	3.8e-64
WP_162556079.1|417840_419421_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	53.9	3.5e-167
WP_004113311.1|419476_420727_+	MFS transporter	NA	NA	NA	NA	NA
WP_024274239.1|420800_421889_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	82.5	6.4e-176
WP_004102395.1|421991_422255_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	81.2	1.1e-33
WP_004102396.1|422280_422535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004102397.1|422810_423137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004102398.1|423245_423518_+	DUF883 family protein	NA	NA	NA	NA	NA
WP_026055938.1|423752_424064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004102402.1|424272_424812_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_032728331.1|424921_425404_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_108703896.1|425630_426083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004102408.1|426079_426640_-	UDP-N-acetylglucosamine acyltransferase	NA	NA	NA	NA	NA
WP_070557682.1|427045_427717_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	1.3e-78
WP_004102413.1|427893_428505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108703897.1|428655_430155_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_064396138.1|430390_431299_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
431090:431105	attR	CTGTTTGCGGAAAAGG	NA	NA	NA	NA
WP_004112635.1|431299_431623_-	YdbL family protein	NA	NA	NA	NA	NA
WP_004101631.1|431630_431816_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_108703898.1|431815_434455_-	YdbH family protein	NA	NA	NA	NA	NA
WP_004101627.1|434650_435151_+	DedA family protein	NA	NA	NA	NA	NA
WP_004112629.1|435297_436287_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.7	1.9e-70
WP_070557686.1|436412_436853_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_004101621.1|436849_437122_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004101619.1|437449_437815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070557688.1|438045_438588_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	64.0	2.4e-67
WP_108703899.1|438595_438868_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	40.9	4.0e-10
WP_004101612.1|438857_439250_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	53.7	2.2e-25
WP_070557690.1|439326_439689_-	antitermination protein	NA	C6ZR44	Salmonella_phage	55.8	1.5e-28
WP_016807747.1|440150_440687_-	helix-turn-helix transcriptional regulator	NA	K7PKK1	Enterobacteria_phage	50.3	4.7e-31
>prophage 2
NZ_CP029128	Klebsiella oxytoca strain AR380 chromosome, complete genome	5925399	1049169	1073689	5925399	holin	Salmonella_phage(25.0%)	29	NA	NA
WP_004100552.1|1049169_1049928_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.2	1.6e-11
WP_049128024.1|1049958_1051161_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.2	4.2e-96
WP_108704017.1|1051947_1052724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108704018.1|1052726_1054571_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	55.0	2.7e-25
WP_108704019.1|1055527_1056301_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	52.1	2.7e-67
WP_108704020.1|1056297_1057497_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	74.8	1.3e-158
WP_108704021.1|1057496_1057850_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	77.8	5.6e-49
WP_108704022.1|1057851_1058877_-	DUF2184 domain-containing protein	NA	A0A2H4JCJ1	uncultured_Caudovirales_phage	76.9	2.4e-71
WP_108704023.1|1058888_1059383_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	63.1	6.1e-49
WP_108704024.1|1059394_1060594_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	55.3	2.2e-105
WP_108705026.1|1060855_1061404_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	54.6	9.7e-48
WP_108704025.1|1061459_1062911_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.1	1.2e-190
WP_162556087.1|1063071_1063299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108704027.1|1064781_1065051_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	48.3	3.2e-12
WP_108704028.1|1065058_1065685_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	76.3	2.2e-88
WP_108705027.1|1065684_1065831_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	52.1	2.1e-05
WP_064364905.1|1066382_1066595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064364907.1|1066591_1066885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108704029.1|1066897_1067974_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	43.2	4.3e-31
WP_004111712.1|1067970_1068225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004111711.1|1068238_1068664_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_071993411.1|1068647_1068875_-	transcriptional regulator	NA	H9C161	Pectobacterium_phage	35.1	7.1e-05
WP_108704030.1|1068957_1069374_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	50.4	2.0e-29
WP_108704031.1|1069891_1070185_+	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_128334537.1|1070250_1070484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108704032.1|1070707_1071394_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	61.2	1.5e-69
WP_108704033.1|1071390_1072095_+	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	32.5	3.0e-25
WP_004111685.1|1072187_1072403_+	DUF1233 family excisionase	NA	NA	NA	NA	NA
WP_108704034.1|1072402_1073689_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	54.5	9.7e-123
>prophage 3
NZ_CP029128	Klebsiella oxytoca strain AR380 chromosome, complete genome	5925399	4515799	4578599	5925399	plate,head,tail,lysis,tRNA,capsid,integrase,portal,terminase	Erwinia_phage(34.78%)	69	4516940:4516968	4548622:4548650
WP_004104636.1|4515799_4516567_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004104634.1|4516606_4516954_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
4516940:4516968	attL	GAGCGTCTTAACTAAGATTCGCTTTCGCG	NA	NA	NA	NA
WP_000972009.1|4517099_4517318_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	97.2	6.1e-38
WP_108704648.1|4517393_4518563_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	97.7	4.6e-204
WP_000978868.1|4518559_4519045_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	95.0	1.5e-81
WP_108704649.1|4519056_4521498_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	89.1	0.0e+00
WP_000763323.1|4521490_4521610_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	100.0	1.4e-15
WP_047720662.1|4521642_4521978_-|tail	phage tail assembly protein	tail	A0A218M4J8	Erwinia_phage	98.2	6.8e-52
WP_047720661.1|4522041_4522560_-|tail	phage major tail tube protein	tail	Q37845	Escherichia_phage	100.0	5.0e-94
WP_108704650.1|4522575_4523754_-|tail	phage tail sheath protein	tail	Q37844	Escherichia_phage	95.7	1.4e-213
WP_108704651.1|4523864_4524941_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	41.9	2.8e-30
WP_108704652.1|4524953_4525715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108704653.1|4525716_4527402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162556172.1|4527404_4527992_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	51.8	7.7e-51
WP_108704655.1|4527999_4528908_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	70.9	1.1e-112
WP_094963300.1|4528912_4529260_-|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	74.8	5.4e-44
WP_108704656.1|4529256_4529898_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	85.9	4.4e-100
WP_108704657.1|4529966_4530416_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	96.0	1.5e-70
WP_108704658.1|4530408_4530876_-|tail	phage tail protein	tail	O80312	Escherichia_phage	97.4	5.1e-82
WP_108704659.1|4530983_4531397_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	60.3	3.2e-35
WP_108704660.1|4531393_4531825_-	lysA protein	NA	A0A218M4L6	Erwinia_phage	81.8	1.6e-61
WP_063408324.1|4531821_4532334_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	97.6	3.0e-91
WP_108704661.1|4532317_4532539_-	primosomal protein	NA	A0A218M4L5	Erwinia_phage	97.3	3.2e-34
WP_108704662.1|4532529_4532733_-|tail	phage tail protein	tail	A0A218M4L8	Erwinia_phage	95.5	1.3e-29
WP_108704663.1|4532732_4533242_-|head	head completion/stabilization protein	head	A0A218M4L7	Erwinia_phage	98.8	2.5e-90
WP_108704664.1|4533335_4534085_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	90.4	4.6e-117
WP_108704665.1|4534089_4535157_-|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	96.6	9.6e-193
WP_108704666.1|4535232_4536087_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	83.5	1.4e-130
WP_108704667.1|4536252_4538022_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	99.2	0.0e+00
WP_108704668.1|4538021_4538768_+	hypothetical protein	NA	O80303	Escherichia_phage	94.8	8.1e-138
WP_108704669.1|4538764_4539787_+|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	99.1	4.7e-197
WP_001222154.1|4540264_4540498_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	98.7	8.0e-36
WP_000232650.1|4540501_4540684_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	100.0	4.1e-27
WP_162556173.1|4540803_4542873_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	92.3	0.0e+00
WP_108704672.1|4543016_4543298_-	DUF3850 domain-containing protein	NA	A0A0P0I3U9	Klebsiella_phage	50.0	1.3e-11
WP_057222569.1|4543294_4543567_-	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	73.3	6.3e-32
WP_108704673.1|4543563_4544145_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	78.2	6.8e-84
WP_108704674.1|4544141_4544369_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	80.6	5.6e-26
WP_094963280.1|4544368_4544596_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	97.3	2.2e-30
WP_108704675.1|4544663_4545002_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	93.8	2.1e-53
WP_000920169.1|4544965_4545166_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	100.0	1.2e-32
WP_020316738.1|4545173_4545683_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	99.4	4.3e-90
WP_001278194.1|4545715_4546087_-	hypothetical protein	NA	A0A0M4R4X7	Salmonella_phage	99.2	1.4e-61
WP_108704676.1|4546200_4547043_+	phage repressor protein CI	NA	A0A0M4RE65	Salmonella_phage	70.8	6.6e-112
WP_000830450.1|4547056_4547461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108704677.1|4547490_4548540_+|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	90.3	1.8e-188
WP_004104630.1|4548756_4549194_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
4548622:4548650	attR	GAGCGTCTTAACTAAGATTCGCTTTCGCG	NA	NA	NA	NA
WP_070555967.1|4549247_4550618_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_004104626.1|4550622_4551105_-	OmpA family protein	NA	NA	NA	NA	NA
WP_070555966.1|4551116_4552340_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_004104622.1|4552332_4552842_-	YfiR family protein	NA	NA	NA	NA	NA
WP_004104620.1|4553185_4554256_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	8.1e-91
WP_004104619.1|4554265_4555387_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_064374018.1|4555456_4556329_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_004104617.1|4556325_4557486_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_101706155.1|4557592_4557640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004104616.1|4557747_4558083_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_004104615.1|4558354_4559092_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_004104614.1|4559224_4560205_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_108704678.1|4560201_4560933_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_108704679.1|4561060_4563634_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	1.8e-128
WP_004114495.1|4569568_4570024_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	46.7	3.3e-33
WP_004104606.1|4570297_4571596_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.5	1.2e-43
WP_004104604.1|4571598_4571925_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_064398091.1|4571965_4573321_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_108704681.1|4573414_4576093_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_004114489.1|4576128_4576827_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_108704682.1|4576896_4577322_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	41.0	1.6e-13
WP_004104598.1|4577525_4578599_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP029128	Klebsiella oxytoca strain AR380 chromosome, complete genome	5925399	5120033	5133706	5925399		Enterobacteria_phage(20.0%)	13	NA	NA
WP_108704779.1|5120033_5120951_+	hypothetical protein	NA	A0A0N7KVT5	Yellowstone_lake_phycodnavirus	36.2	7.1e-27
WP_108704780.1|5120985_5121945_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_108704781.1|5122250_5123657_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	7.3e-39
WP_108704782.1|5123869_5125285_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.5	5.6e-55
WP_108704783.1|5125307_5126678_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.4	7.1e-31
WP_108704784.1|5126772_5127837_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.9e-104
WP_108704785.1|5127848_5128718_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.3	1.5e-103
WP_108704786.1|5128749_5129640_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.1	6.9e-27
WP_108704787.1|5129654_5130209_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.7	1.6e-50
WP_108704788.1|5130382_5131549_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.0	7.0e-112
WP_162556121.1|5131928_5132093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004138729.1|5132111_5132234_-	small membrane protein	NA	NA	NA	NA	NA
WP_004103673.1|5132701_5133706_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	6.8e-31
>prophage 5
NZ_CP029128	Klebsiella oxytoca strain AR380 chromosome, complete genome	5925399	5299846	5321160	5925399	holin,terminase,integrase	Pectobacterium_phage(29.41%)	22	5299659:5299718	5321414:5321481
5299659:5299718	attL	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATTGG	NA	NA	NA	NA
WP_064167254.1|5299846_5300863_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	64.5	2.8e-125
WP_015365914.1|5300846_5301092_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	41.4	2.8e-07
WP_108704849.1|5301488_5302055_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	63.0	7.9e-53
WP_108704850.1|5302054_5304208_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.1	6.9e-97
WP_041165546.1|5304252_5304576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041165547.1|5305065_5305452_-	helix-turn-helix domain-containing protein	NA	A5VW98	Enterobacteria_phage	59.4	1.5e-15
WP_041165548.1|5305532_5305727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082236706.1|5305789_5306236_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.4	1.0e-26
WP_015365921.1|5306319_5306478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108704851.1|5306480_5307473_+	replication protein RepO	NA	A0A067ZIA1	Vibrio_phage	52.3	9.1e-28
WP_108705084.1|5307481_5308393_+	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	40.7	2.5e-16
WP_040200578.1|5308395_5308884_+	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	49.0	3.5e-09
WP_108704852.1|5308889_5311604_+	transglycosylase SLT domain-containing protein	NA	G9L6D3	Escherichia_phage	58.5	1.8e-288
WP_108704853.1|5311603_5314498_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	71.2	0.0e+00
WP_162556125.1|5314494_5314932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076752321.1|5315065_5315407_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	48.2	2.0e-19
WP_076752320.1|5315403_5317014_+|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	70.8	1.2e-226
WP_108704855.1|5317031_5319683_+	hypothetical protein	NA	A0A0F6TJC8	Escherichia_coli_O157_typing_phage	40.9	1.5e-45
WP_108704856.1|5319691_5319970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108704857.1|5320059_5320284_+|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	70.1	1.6e-20
WP_108704858.1|5320267_5320804_+	lysozyme	NA	K7PM52	Enterobacteria_phage	78.0	6.1e-79
WP_108704859.1|5320800_5321160_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	44.0	1.3e-16
5321414:5321481	attR	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATTGGGATAAAGC	NA	NA	NA	NA
>prophage 6
NZ_CP029128	Klebsiella oxytoca strain AR380 chromosome, complete genome	5925399	5346639	5426392	5925399	plate,lysis,tRNA,coat,integrase,terminase	Escherichia_phage(38.46%)	96	5348595:5348615	5393847:5393867
WP_004103405.1|5346639_5347383_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	29.1	1.5e-22
WP_004103403.1|5347422_5347818_-	membrane protein	NA	NA	NA	NA	NA
5348595:5348615	attL	CACGCAATTAAAGTGGCGGGC	NA	NA	NA	NA
WP_108704864.1|5348647_5349907_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	89.7	4.3e-224
WP_023283988.1|5349949_5350195_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	92.1	1.4e-35
WP_108704865.1|5350354_5350570_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	50.0	5.2e-13
WP_038989582.1|5350571_5350790_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	2.1e-09
WP_108705085.1|5350786_5352793_-	phage N-6-adenine-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	46.0	6.4e-113
WP_046878446.1|5352807_5352966_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	69.2	2.2e-13
WP_108704866.1|5352962_5353643_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.9	1.8e-123
WP_108704867.1|5353639_5354485_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.8	2.9e-67
WP_108704868.1|5354500_5354785_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	77.7	4.7e-38
WP_108704869.1|5354792_5355764_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	75.7	5.6e-38
WP_019725103.1|5355852_5356047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162556180.1|5356039_5356165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077266559.1|5356577_5357174_-	helix-turn-helix transcriptional regulator	NA	K7P850	Enterobacteria_phage	28.6	3.3e-09
WP_064349506.1|5357281_5357494_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_064349508.1|5357514_5357835_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	67.9	8.5e-36
WP_162556126.1|5357921_5358068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162556127.1|5358108_5358960_+	DNA replication protein	NA	F1C5C3	Cronobacter_phage	56.0	9.0e-85
WP_162556182.1|5358964_5360380_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.5	2.9e-184
WP_108704872.1|5360379_5360682_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_108704873.1|5360678_5361104_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	65.9	1.3e-20
WP_108704874.1|5361100_5361496_+	hypothetical protein	NA	G8C7U4	Escherichia_phage	79.7	1.7e-57
WP_108704875.1|5361488_5361947_+	plasmid protein	NA	NA	NA	NA	NA
WP_108704876.1|5361943_5362435_+	hypothetical protein	NA	A0A2H4FRZ0	Salmonella_phage	70.7	1.9e-26
WP_108704877.1|5362434_5362950_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	73.3	2.9e-70
WP_108704878.1|5362946_5363645_+	hypothetical protein	NA	C6ZR26	Salmonella_phage	57.1	8.4e-12
WP_108704879.1|5363631_5364270_+	hypothetical protein	NA	L0AQZ0	Klebsiella_phage	41.5	2.0e-44
WP_108704880.1|5364358_5364616_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	71.4	6.0e-24
WP_064349536.1|5364806_5365256_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	52.4	9.7e-38
WP_108704881.1|5365248_5365419_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	74.5	1.8e-16
WP_028013586.1|5365411_5365702_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	89.6	1.2e-44
WP_108704882.1|5365698_5366061_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	83.1	5.6e-52
WP_108704883.1|5366057_5366198_+	YlcG family protein	NA	NA	NA	NA	NA
WP_032737394.1|5366194_5366695_+	antiterminator	NA	G8C7V7	Escherichia_phage	92.7	6.7e-88
WP_032729783.1|5367134_5367338_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	84.1	1.0e-26
WP_108705086.1|5367315_5367813_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	86.1	3.9e-80
WP_108704884.1|5367809_5368271_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	64.7	1.0e-45
WP_108704885.1|5368721_5369462_+	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	29.9	1.9e-14
WP_108704886.1|5369465_5370797_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	59.7	3.5e-152
WP_108704887.1|5370808_5372227_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	36.5	3.6e-86
WP_108704888.1|5372223_5373045_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	40.8	2.0e-52
WP_108704889.1|5373057_5374671_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_108704890.1|5374686_5375547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108704891.1|5375560_5376592_+	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	45.8	3.3e-73
WP_017898838.1|5376663_5377146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023283949.1|5377142_5377571_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	39.1	1.4e-22
WP_108704892.1|5377567_5378002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001139600.1|5377985_5378924_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	37.9	8.5e-52
WP_108704893.1|5378928_5380323_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	35.5	2.5e-68
WP_108704894.1|5380326_5380764_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	38.9	6.4e-26
WP_108704895.1|5380767_5381340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108705087.1|5381463_5383284_+	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	38.2	3.7e-19
WP_108704896.1|5383286_5384012_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	37.5	7.1e-30
WP_108704897.1|5384008_5384284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108704898.1|5384283_5385252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108704899.1|5385254_5385971_+	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	29.9	7.5e-24
WP_108704900.1|5385967_5386300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108704901.1|5386296_5387715_+|plate	baseplate J-like family protein	plate	A0A0U2RJZ0	Escherichia_phage	43.0	4.3e-47
WP_108704902.1|5387716_5388421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108704903.1|5388475_5388994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108704904.1|5389057_5391409_+	GDSL family lipase	NA	A0A2H4N7A3	Pectobacterium_phage	53.3	4.5e-33
WP_108704905.1|5391411_5392188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108704907.1|5392667_5393714_+	hypothetical protein	NA	I7B6L0	Escherichia_phage	43.9	2.0e-09
WP_064397741.1|5393938_5394505_-	hydrolase	NA	NA	NA	NA	NA
5393847:5393867	attR	CACGCAATTAAAGTGGCGGGC	NA	NA	NA	NA
WP_004103400.1|5394774_5396562_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004103398.1|5396563_5397007_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_004103396.1|5397156_5397897_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004113791.1|5398051_5398573_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_108704908.1|5398686_5399349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004103390.1|5399472_5400084_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_004103386.1|5400092_5401103_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.0	1.3e-08
WP_070556964.1|5401310_5402096_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_108704909.1|5402095_5402848_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.5	1.3e-15
WP_016808309.1|5402926_5403871_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_108704910.1|5403886_5405209_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.5e-14
WP_004103380.1|5405326_5406301_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_004103379.1|5406371_5407814_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_004103378.1|5407939_5408809_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004103371.1|5409170_5410646_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.7e-78
WP_004103369.1|5410866_5412678_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_004103368.1|5412715_5413357_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_004103366.1|5413410_5414589_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017145640.1|5414724_5415087_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_017145641.1|5415235_5415916_+	DUF533 domain-containing protein	NA	NA	NA	NA	NA
WP_016808307.1|5416049_5418110_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_004103360.1|5418116_5418776_-	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	32.3	1.0e-14
WP_004103351.1|5418854_5419085_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	1.3e-14
WP_016808306.1|5419220_5419595_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_108704911.1|5419599_5420469_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_023321222.1|5420485_5420824_+	YebY family protein	NA	NA	NA	NA	NA
WP_004113762.1|5421210_5422170_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_108704912.1|5422181_5424515_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_016808303.1|5424517_5425282_-	molecular chaperone	NA	NA	NA	NA	NA
WP_070557030.1|5425299_5425818_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004103335.1|5425840_5426392_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 1
NZ_CP029127	Klebsiella oxytoca strain AR380 plasmid unnamed1, complete sequence	78352	1027	75783	78352	integrase,tail,transposase	Macacine_betaherpesvirus(17.65%)	60	5577:5597	65767:65787
WP_108703702.1|1027_1996_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	33.8	7.5e-27
WP_162556063.1|2437_2668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108703703.1|2717_3752_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_108703705.1|4482_5593_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.3	1.2e-47
5577:5597	attL	AAAAATGCATGGAACTAAAAC	NA	NA	NA	NA
WP_108703707.1|7113_7881_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.1	9.2e-28
WP_108703708.1|8532_9285_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	86.6	3.1e-121
WP_108703709.1|11318_12452_+|tail	tail fiber domain-containing protein	tail	A0A1Z1LZI1	Serratia_phage	26.7	9.7e-18
WP_108703710.1|12532_14650_+	colicin-D	NA	NA	NA	NA	NA
WP_047722708.1|14646_14913_+	colicin-D	NA	NA	NA	NA	NA
WP_048993616.1|15458_15773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108703753.1|15832_16441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108703711.1|16508_17288_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.3	1.6e-51
WP_108703712.1|17432_18383_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.9	5.2e-73
WP_044348065.1|18503_18770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108703714.1|19141_19390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108703754.1|19472_19652_-	Par-like protein	NA	NA	NA	NA	NA
WP_058673570.1|19771_20398_-	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	44.1	1.3e-40
WP_108703715.1|20629_21901_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	9.2e-158
WP_108703716.1|21900_22326_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	54.7	4.9e-31
WP_108703717.1|22533_22764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108703755.1|23842_24562_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_108703718.1|24940_25357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108703719.1|25517_26141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108703720.1|26146_26797_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_108703721.1|26793_27102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162556066.1|27256_27757_+	DUF1669 domain-containing protein	NA	A0A1B2LRT6	Wolbachia_phage	33.8	4.7e-17
WP_108703723.1|27956_28676_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_108703724.1|28756_30043_-	MFS transporter	NA	NA	NA	NA	NA
WP_108703725.1|30098_30866_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	27.6	6.4e-21
WP_108703726.1|31203_32457_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.7	3.9e-44
WP_108703728.1|32554_33196_-	recombinase family protein	NA	NA	NA	NA	NA
WP_108703756.1|33363_36351_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.2	2.1e-293
WP_108703729.1|37022_38210_+	microcin B17 processing protein McbC	NA	NA	NA	NA	NA
WP_073991198.1|38219_38945_+	protein mcbE	NA	NA	NA	NA	NA
WP_108703730.1|38941_39670_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.9	2.4e-09
WP_108703731.1|39673_40234_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_108703757.1|40575_41580_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_108703732.1|41934_42195_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_015344939.1|42428_42503_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_108703733.1|42483_43359_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_108703735.1|44579_45296_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_108703736.1|45448_46078_-	LysE family translocator	NA	NA	NA	NA	NA
WP_108703758.1|46087_47032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108703737.1|48006_48711_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	94.0	2.0e-130
WP_108703738.1|50708_51311_+	fimbrial protein	NA	NA	NA	NA	NA
WP_108703739.1|51387_52089_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_108703740.1|52121_54791_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_108703741.1|54885_55452_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_162556064.1|55871_56828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108703760.1|58019_58127_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_108703761.1|58637_59600_+	bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA	NA	NA	NA	NA	NA
WP_108703745.1|62036_63126_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.8	1.6e-46
WP_108703746.1|64175_64673_+	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_108703747.1|64988_65648_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_108703748.1|68074_68638_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
65767:65787	attR	GTTTTAGTTCCATGCATTTTT	NA	NA	NA	NA
WP_108703762.1|68864_71441_+	outer membrane usher protein	NA	NA	NA	NA	NA
WP_108703749.1|71533_72295_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_108703750.1|72351_72912_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_162556065.1|73176_74067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108703751.1|74706_75783_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
