The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	520968	618637	5391064	transposase,protease,tail,terminase,capsid,portal,integrase,tRNA,head	Enterobacteria_phage(45.0%)	88	577763:577809	610111:610157
WP_000186631.1|520968_521448_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_000365135.1|521651_522446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001370330.1|522583_522925_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	9.3e-41
WP_000083976.1|523139_525644_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.1	1.4e-114
WP_000883019.1|525905_526838_+	glutaminase A	NA	NA	NA	NA	NA
WP_000982172.1|526840_528133_+	amino acid permease	NA	NA	NA	NA	NA
WP_001026747.1|528257_528665_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000970323.1|528665_529124_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000904502.1|529120_530038_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_001157535.1|530183_530861_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
WP_001323739.1|530847_531627_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001295322.1|531689_532544_-	chaperedoxin	NA	NA	NA	NA	NA
WP_000148959.1|532604_533414_-	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295836.1|533403_534027_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|533997_534684_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561833.1|534680_537095_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014917.1|537523_541714_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	44.6	1.3e-22
WP_000879785.1|541694_542186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001158006.1|543187_544282_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|544350_545277_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|545506_545989_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|546066_546882_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001370296.1|546971_548753_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.8	6.0e-38
WP_000943556.1|548765_549542_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|549641_550520_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401125.1|550688_552143_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006887.1|552202_553564_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001370313.1|553620_554922_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001370319.1|554943_556089_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	4.1e-48
WP_000540996.1|556316_557102_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001370308.1|557112_558348_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703894.1|558369_559419_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580865.1|559735_561403_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495365.1|561412_562672_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001325209.1|562682_563498_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855398.1|563494_564388_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815538.1|564526_565594_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|565590_566100_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|566217_566940_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|566942_567437_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|567610_568996_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|569031_569553_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|569660_569873_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|569874_570741_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776558.1|571221_571764_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_001370299.1|572705_575315_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691045.1|575327_576335_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001396973.1|576345_576861_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805418.1|576863_577496_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
577763:577809	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001370298.1|577822_578986_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	9.8e-199
WP_000446905.1|578841_579213_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|579184_579463_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|579510_579729_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001443983.1|579827_580109_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_087661054.1|580165_581378_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_029594360.1|581436_581961_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.7	2.2e-89
WP_001027188.1|581935_583861_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.3	0.0e+00
WP_000198151.1|583857_584070_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	95.7	1.6e-27
WP_001370283.1|584066_585668_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.2e-308
WP_000123282.1|585648_586968_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	95.7	6.3e-226
WP_001358596.1|586977_587310_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	1.4e-54
WP_000063297.1|587364_588390_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	1.2e-189
WP_000158902.1|588431_588827_+	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.6e-55
WP_000752996.1|588838_589192_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_032212787.1|589203_589782_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	86.5	2.3e-79
WP_024200945.1|589778_590174_+	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_001370356.1|590181_590922_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	5.0e-132
WP_000479147.1|590937_591360_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	1.9e-72
WP_000459457.1|591341_591776_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840238.1|591768_594330_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.7	0.0e+00
WP_000847371.1|594326_594656_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.6	2.1e-53
WP_001152565.1|594655_595354_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	3.6e-132
WP_000194780.1|595359_596103_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|596039_596672_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000515724.1|596732_600074_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.8	0.0e+00
WP_085947772.1|600094_601307_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001230348.1|601476_602076_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_077633707.1|604239_605211_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	89.3	2.1e-37
WP_000885574.1|605210_605795_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.2e-101
WP_000239881.1|605849_606518_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937500.1|606574_606880_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226375.1|607063_608548_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|608734_609688_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177464.1|610200_610962_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
610111:610157	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|611144_612035_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662369.1|612035_615008_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383947.1|614994_617232_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420919.1|617500_618637_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	957360	971780	5391064	tRNA,protease,transposase	Stx2-converting_phage(30.0%)	12	NA	NA
WP_000188139.1|957360_959307_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|959379_959604_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|959926_960247_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|960277_962554_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001066422.1|962679_964236_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
WP_000631725.1|964255_964603_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|964599_965274_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001040187.1|965954_966173_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|966457_967162_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202187.1|967203_968925_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
WP_001043587.1|968925_970692_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_000537420.1|970814_971780_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
>prophage 3
NZ_CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	1056636	1166085	5391064	protease,holin,terminase,head,portal,capsid,integrase,tail	Escherichia_phage(34.69%)	131	1076307:1076325	1122129:1122147
WP_000156526.1|1056636_1058397_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877158.1|1058582_1059035_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750419.1|1059109_1060162_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1060518_1061028_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000841914.1|1061246_1061876_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875061.1|1061838_1064001_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1064010_1064457_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001295354.1|1064579_1066634_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
WP_000424181.1|1066665_1067124_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1067219_1067882_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1068054_1068468_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1068512_1068830_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1068887_1070078_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048233.1|1070172_1070451_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1070447_1070777_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|1070867_1071527_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_001370339.1|1071934_1072954_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.4	2.9e-85
WP_000273151.1|1072931_1073174_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_032212635.1|1073241_1075677_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	2.7e-57
WP_001098749.1|1075757_1075961_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449182.1|1075963_1076146_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
1076307:1076325	attL	CACCGCATCACAAAATTCA	NA	NA	NA	NA
WP_000394568.1|1076891_1077281_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	39.3	1.9e-21
WP_000379585.1|1077292_1077445_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_000948459.1|1077760_1078237_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1078360_1078657_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693884.1|1078679_1079105_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262384.1|1079176_1080247_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	62.2	8.2e-59
WP_001151153.1|1080287_1080710_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_001266134.1|1080706_1081003_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001209480.1|1080999_1081461_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|1081438_1081795_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|1081845_1082058_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|1082143_1082308_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|1082309_1082573_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|1082583_1083453_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|1083568_1083673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902696.1|1083861_1084074_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_001341388.1|1084241_1084520_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265133.1|1084521_1085571_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_000904103.1|1085583_1085943_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_000640048.1|1085951_1086482_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917767.1|1086723_1086921_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000024330.1|1087072_1088149_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	87.1	3.8e-181
WP_001443281.1|1088744_1089071_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	62.9	5.1e-36
WP_000142777.1|1091452_1091632_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_001290233.1|1091672_1091918_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	90.1	2.2e-15
WP_000284506.1|1091994_1092210_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087730.1|1092214_1092748_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
WP_001056806.1|1093018_1093588_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1093587_1093734_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1093961_1094147_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000373410.1|1094623_1095100_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	99.4	9.5e-84
WP_001077625.1|1095096_1097220_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102415.1|1097216_1097429_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|1097428_1098931_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_096955153.1|1098934_1100899_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1100986_1101313_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281348.1|1101305_1101587_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_000974958.1|1101589_1102213_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_000235098.1|1102630_1103383_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479043.1|1103396_1103819_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532075.1|1103845_1104154_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000847306.1|1106838_1107168_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001365123.1|1107167_1107866_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.7	1.8e-131
WP_032316709.1|1107876_1108620_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	96.7	8.0e-146
WP_077698919.1|1108565_1109198_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.7	1.6e-102
WP_106875772.1|1109446_1112923_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	95.1	0.0e+00
WP_001023407.1|1114965_1115235_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000938124.1|1115689_1117051_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_095585410.1|1117427_1117580_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
WP_001299351.1|1117862_1118882_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1118859_1119102_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034468.1|1119169_1121641_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	8.5e-59
WP_001098307.1|1121734_1121926_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1121922_1122111_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1122684_1122870_+	hypothetical protein	NA	NA	NA	NA	NA
1122129:1122147	attR	TGAATTTTGTGATGCGGTG	NA	NA	NA	NA
WP_000394511.1|1123056_1123446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1123587_1123743_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1124019_1124307_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1124306_1124498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1124525_1124927_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1125035_1125308_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1125291_1125717_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1125923_1126379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205819.1|1126457_1127582_+	hypothetical protein	NA	V5URT9	Shigella_phage	67.9	1.6e-129
WP_000788752.1|1127578_1128319_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	85.0	2.0e-117
WP_000450862.1|1128344_1129115_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	3.7e-85
WP_001151233.1|1129130_1129544_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160651.1|1129895_1130669_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1131034_1131172_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|1131216_1131429_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_072145984.1|1131596_1131875_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001217436.1|1132937_1133309_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|1133298_1133670_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|1133821_1134640_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917739.1|1134926_1135124_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	95.4	5.7e-27
WP_000261909.1|1135261_1135975_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|1136422_1136854_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_153244796.1|1137203_1137347_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	97.4	3.7e-15
WP_000143462.1|1139404_1139584_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290231.1|1139624_1139897_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284518.1|1139973_1140189_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731198.1|1140193_1140538_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	1.4e-57
WP_000992152.1|1140588_1141122_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.0	6.2e-100
WP_012816791.1|1141640_1141826_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302717.1|1142310_1142625_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|1142706_1142931_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000235436.1|1143333_1143843_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001370721.1|1143814_1145743_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	1.8e-261
WP_000259002.1|1145726_1145933_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831794.1|1145929_1147522_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	2.1e-183
WP_001254023.1|1147511_1149017_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.8e-99
WP_109024224.1|1149053_1149380_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.1	2.1e-21
WP_000522623.1|1149457_1150486_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201512.1|1150537_1150921_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204559.1|1150913_1151267_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	67.5	3.3e-41
WP_000975030.1|1151281_1151815_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	5.0e-57
WP_000683065.1|1151811_1152207_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_001143019.1|1152214_1152967_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	1.4e-126
WP_000479115.1|1152980_1153412_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_000533420.1|1153438_1153852_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	7.8e-42
WP_000847298.1|1156407_1156737_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032212654.1|1156736_1157435_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	5.8e-130
WP_024174194.1|1157440_1158184_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	1.4e-142
WP_000090917.1|1158120_1158753_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_001233099.1|1162361_1162961_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.0	1.1e-108
WP_109024225.1|1163025_1164339_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.9	8.2e-77
WP_001023455.1|1164340_1164610_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000767049.1|1164831_1165374_+	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.0	9.3e-51
WP_106420821.1|1165318_1165513_+	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	84.6	4.1e-09
WP_001131653.1|1165503_1166085_+	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	64.2	5.1e-63
>prophage 4
NZ_CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	1285164	1375154	5391064	transposase,tail,protease,holin,portal,integrase,head	Stx2-converting_phage(29.11%)	116	1343298:1343315	1374927:1374944
WP_000074974.1|1285164_1286283_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	2.6e-84
WP_000003742.1|1286251_1286521_-	excisionase	NA	NA	NA	NA	NA
WP_000048560.1|1286582_1289054_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000560212.1|1289177_1289399_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	82.2	4.3e-31
WP_001331716.1|1289804_1289969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|1290111_1290411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|1290763_1291042_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|1291043_1291235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169687.1|1291255_1291627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|1291724_1292027_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693944.1|1292023_1292449_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|1292471_1293434_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_001151187.1|1293474_1293897_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	3.9e-65
WP_000935423.1|1294002_1294215_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	97.1	5.6e-36
WP_000209148.1|1294247_1294466_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_001370098.1|1294467_1294626_+	hypothetical protein	NA	A0A220NQU8	Salmonella_phage	75.6	2.2e-13
WP_001066422.1|1294629_1296186_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
WP_000631725.1|1296205_1296553_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|1296549_1297224_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_136865621.1|1297229_1297448_+	hypothetical protein	NA	S4TNB5	Salmonella_phage	70.8	7.6e-12
WP_000208016.1|1297458_1298328_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	79.2	8.5e-123
WP_001278454.1|1298443_1298548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024174193.1|1298736_1298949_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	97.1	2.5e-28
WP_000756560.1|1299066_1299414_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	81.7	9.2e-44
WP_000046991.1|1299534_1299807_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.1	1.9e-12
WP_001265272.1|1299808_1300858_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.1e-108
WP_001121083.1|1300870_1301245_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.1	6.4e-35
WP_000762899.1|1301241_1302063_+	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	8.2e-83
WP_000917750.1|1302288_1302486_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935558.1|1302636_1303695_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	90.1	3.8e-189
WP_001344632.1|1304582_1304714_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_032212668.1|1305156_1307007_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	97.1	0.0e+00
WP_000411804.1|1307453_1307660_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_087661054.1|1307704_1308918_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_096910863.1|1309145_1310359_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_000138558.1|1310541_1310814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003112.1|1310973_1311507_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_001208682.1|1312153_1312360_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1312424_1312649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|1312766_1313923_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000347013.1|1314272_1314413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032208049.1|1314542_1314656_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	85.7	2.9e-07
WP_000088311.1|1314723_1315026_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094185360.1|1315123_1316279_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_077760344.1|1316272_1317016_+|portal	phage portal protein	portal	A0A0P0ZCZ4	Stx2-converting_phage	99.3	7.2e-78
WP_000125984.1|1317012_1317339_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|1317349_1317700_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|1317696_1318143_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1318139_1318484_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275483.1|1318549_1319266_+|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.6	2.1e-127
WP_000710949.1|1319280_1319655_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001453698.1|1319750_1319960_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212947.1|1320011_1323254_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.6	0.0e+00
WP_000807954.1|1323246_1323588_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_032212666.1|1323587_1324286_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_024174257.1|1329397_1329973_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	55.6	1.2e-59
WP_032212660.1|1330037_1331351_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.5	1.4e-79
WP_032212659.1|1331352_1331622_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	7.1e-44
WP_012817749.1|1331747_1332500_-	type III effector	NA	NA	NA	NA	NA
WP_000107384.1|1334730_1336524_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1336542_1337250_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|1337246_1337834_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063978.1|1337830_1338229_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004899.1|1338225_1339083_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263584.1|1339216_1340761_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460789.1|1340772_1341909_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|1341921_1342014_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001297112.1|1342093_1343392_+	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
1343298:1343315	attL	CAGGATGTGAAGAGCGAA	NA	NA	NA	NA
WP_000208650.1|1343506_1345687_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000057870.1|1345706_1346153_-	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_001295357.1|1346140_1347280_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000742335.1|1347325_1349422_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001038062.1|1349421_1350168_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001247610.1|1350164_1350809_-	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001295358.1|1350915_1351221_-	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_000087763.1|1351662_1351875_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|1352160_1352373_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1352383_1352572_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|1352546_1352777_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|1352766_1352940_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818477.1|1352988_1354062_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001399304.1|1354133_1356878_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	4.6e-37
WP_000533662.1|1356972_1358046_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	99.7	1.3e-200
WP_001303849.1|1358023_1358242_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|1358281_1358449_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_000022062.1|1358537_1358819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208006.1|1358933_1359731_-	DUF550 domain-containing protein	NA	A0A075B8H2	Enterobacteria_phage	41.1	5.7e-49
WP_000582238.1|1359741_1360497_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.8	4.2e-142
WP_001289864.1|1360498_1360906_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.8	2.8e-68
WP_000763386.1|1360902_1361124_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	98.6	6.4e-35
WP_001443983.1|1361222_1361504_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548546.1|1361514_1361706_-	DUF1382 family protein	NA	A0A0P0ZC49	Stx2-converting_phage	100.0	4.3e-27
WP_032204932.1|1361678_1361861_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	2.2e-28
WP_000186740.1|1361860_1362538_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100845.1|1362534_1363320_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995439.1|1363325_1363622_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372922.1|1363676_1363841_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	96.3	9.3e-23
WP_001198859.1|1363809_1363974_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	98.1	9.0e-26
WP_001132915.1|1364046_1364415_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	96.7	1.1e-63
WP_000213975.1|1364600_1364801_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_072097037.1|1365549_1366005_-	antitermination protein	NA	J3JZZ6	Escherichia_phage	96.1	6.8e-63
WP_096910866.1|1366353_1367172_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	46.2	3.3e-36
WP_001274756.1|1367338_1368052_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|1368152_1368353_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|1368471_1368765_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185425.1|1368797_1369697_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	6.0e-172
WP_000788869.1|1369693_1370395_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145926.1|1370391_1370682_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000736903.1|1370755_1371196_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_001254222.1|1371192_1371375_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_000566869.1|1371371_1371542_+	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	96.4	3.5e-25
WP_001108066.1|1371534_1372155_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	2.0e-94
WP_001028836.1|1372151_1372817_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	3.2e-130
WP_000750155.1|1373028_1373988_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|1374327_1374450_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097237.1|1374464_1375154_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
1374927:1374944	attR	CAGGATGTGAAGAGCGAA	NA	NA	NA	NA
>prophage 5
NZ_CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	1378820	1422420	5391064	transposase,tail,holin,lysis,capsid,portal,tRNA,head	Enterobacteria_phage(39.29%)	37	NA	NA
WP_001341423.1|1378820_1379495_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|1379491_1379839_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066419.1|1379858_1381415_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000411802.1|1381637_1381844_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_001135302.1|1381843_1382341_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.6	1.4e-90
WP_000092313.1|1382337_1382775_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_001307652.1|1383728_1383923_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_001429103.1|1384350_1384857_+	DNA-packaging protein	NA	O64316	Escherichia_phage	47.9	1.5e-34
WP_000259002.1|1386738_1386945_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831794.1|1386941_1388534_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	2.1e-183
WP_000256807.1|1390064_1390412_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_000522623.1|1390469_1391498_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201512.1|1391549_1391933_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001143019.1|1393223_1393976_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	1.4e-126
WP_000479115.1|1393989_1394421_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_000533420.1|1394447_1394861_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	7.8e-42
WP_000847298.1|1397416_1397746_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032212654.1|1397745_1398444_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	5.8e-130
WP_032212652.1|1398449_1399193_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	5.6e-147
WP_024174257.1|1403549_1404125_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	55.6	1.2e-59
WP_001189217.1|1405521_1405770_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.8	1.2e-40
WP_085948186.1|1405822_1406979_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001131642.1|1407150_1407726_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001118085.1|1408016_1408598_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_012816780.1|1408665_1409301_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001299273.1|1409428_1410487_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144080.1|1410561_1411212_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132165.1|1411394_1411985_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_000799399.1|1412258_1413122_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531590.1|1413105_1414242_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.2	2.1e-28
WP_000359448.1|1414491_1415718_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|1415766_1416888_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735415.1|1416963_1418424_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1418423_1419095_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1419262_1420633_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|1420636_1421278_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001370675.1|1421313_1422420_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	1531365	1537781	5391064		Escherichia_phage(66.67%)	11	NA	NA
WP_000787428.1|1531365_1531773_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1531849_1532077_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705623.1|1532060_1532612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|1532583_1533624_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157830737.1|1533535_1534078_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000450692.1|1534111_1534846_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_122368318.1|1534842_1535007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1535705_1536464_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|1536742_1536955_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|1537175_1537433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1537502_1537781_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
>prophage 7
NZ_CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	1648145	1718811	5391064	transposase,protease,holin,terminase,portal,integrase,tRNA,tail	Escherichia_phage(45.76%)	77	1644831:1644846	1652741:1652756
1644831:1644846	attL	TGCTGGATAAGCTGCG	NA	NA	NA	NA
WP_000123758.1|1648145_1649519_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157421.1|1649647_1650583_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_001351710.1|1650634_1651813_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.0	4.6e-228
WP_096910863.1|1651875_1653089_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
1652741:1652756	attR	CGCAGCTTATCCAGCA	NA	NA	NA	NA
WP_000079604.1|1653184_1653400_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1653478_1653688_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1653680_1653875_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000595429.1|1653931_1654741_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	69.9	2.2e-104
WP_000102191.1|1654733_1657403_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	59.6	2.0e-194
WP_001427414.1|1657483_1657654_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_000560223.1|1657653_1657875_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001169149.1|1658299_1658452_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	57.4	2.1e-08
WP_001253182.1|1658832_1659297_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	69.5	1.2e-54
WP_000171139.1|1659401_1659677_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	65.9	1.4e-23
WP_000702023.1|1659660_1660083_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_000899743.1|1660095_1660953_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	94.4	4.0e-80
WP_000788989.1|1660959_1661706_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	2.8e-114
WP_001370676.1|1661727_1662489_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	2.0e-120
WP_001151266.1|1662504_1662921_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	86.2	1.6e-58
WP_001275735.1|1662917_1663391_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	74.8	2.9e-64
WP_001204666.1|1663713_1664292_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_000156213.1|1664251_1665349_-	hypothetical protein	NA	A0A0U2S621	Escherichia_phage	99.7	9.5e-212
WP_085947598.1|1665902_1667065_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000813257.1|1667167_1667323_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	4.2e-17
WP_000119356.1|1667534_1667714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818166.1|1667732_1668218_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000940340.1|1668679_1669279_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.5	1.2e-107
WP_000228018.1|1669278_1669569_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	90.6	1.5e-47
WP_000640170.1|1669565_1670120_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	1.8e-70
WP_106875738.1|1671661_1673608_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	97.1	0.0e+00
WP_000142777.1|1673744_1673924_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_001290233.1|1673964_1674210_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	90.1	2.2e-15
WP_000284506.1|1674286_1674502_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087730.1|1674506_1675040_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
WP_001056806.1|1675310_1675880_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1675879_1676026_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1676253_1676439_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348566.1|1676954_1677431_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	96.2	2.2e-80
WP_001077633.1|1677427_1679551_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
WP_000102415.1|1679547_1679760_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_109024229.1|1679759_1681262_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	99.2	1.0e-288
WP_001114424.1|1681206_1683231_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001281345.1|1683645_1683927_+	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	98.9	2.7e-46
WP_044862705.1|1683929_1684553_+|tail	tail protein	tail	Q8VNN3	Enterobacteria_phage	99.5	2.6e-105
WP_000682719.1|1684565_1684964_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	98.5	2.9e-70
WP_000235098.1|1684971_1685724_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479045.1|1685737_1686160_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|1686186_1686600_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_032212771.1|1686580_1689193_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	87.8	0.0e+00
WP_000847401.1|1689189_1689519_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_001299882.1|1689518_1690217_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
WP_001370115.1|1690222_1690966_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	5.0e-148
WP_077696211.1|1690911_1691547_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.5	1.5e-97
WP_109024230.1|1691782_1695259_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	95.0	0.0e+00
WP_001230496.1|1695325_1695925_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.3e-109
WP_032212694.1|1695989_1697303_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	5.3e-76
WP_001023386.1|1697304_1697574_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	95.5	6.0e-43
WP_122988840.1|1697684_1697762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993102.1|1697976_1698990_+	peptidase M85	NA	NA	NA	NA	NA
WP_016241229.1|1699360_1699675_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347482.1|1699734_1701018_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000214712.1|1702603_1702807_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000215549.1|1702984_1703671_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000636571.1|1703759_1704506_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_001370614.1|1704642_1706688_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_001024746.1|1706731_1707250_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000671731.1|1707525_1707918_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_000592837.1|1708172_1709063_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.8e-19
WP_000901367.1|1709281_1709377_-	protein MgtS	NA	NA	NA	NA	NA
WP_001054189.1|1709503_1710691_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000087216.1|1710885_1711785_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000577184.1|1711829_1712528_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000722571.1|1712726_1713038_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_001370581.1|1713152_1714475_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001296721.1|1714502_1714814_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001022785.1|1714869_1716543_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_085948186.1|1717655_1718811_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
>prophage 8
NZ_CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	1844744	1956453	5391064	transposase,tail,holin,terminase,head	Enterobacteria_phage(29.82%)	103	NA	NA
WP_000826419.1|1844744_1845953_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.3	9.5e-205
WP_096910863.1|1846601_1847814_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_001261010.1|1847854_1848466_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586720.1|1848768_1849362_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001296725.1|1849358_1850351_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234074.1|1850474_1851455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000140888.1|1851449_1851986_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|1852048_1852273_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375956.1|1852412_1854068_-	glucan biosynthesis protein	NA	NA	NA	NA	NA
WP_000013789.1|1854292_1855636_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414564.1|1855852_1856776_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098531.1|1856813_1858454_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|1858852_1859002_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|1859073_1859247_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001397126.1|1859491_1860022_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	2.4e-19
WP_000048667.1|1860210_1861212_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000115935.1|1861253_1862693_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027942.1|1862889_1863690_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139574.1|1863961_1867864_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048948.1|1868064_1868670_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627379.1|1868720_1870037_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000890932.1|1871465_1872362_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000177543.1|1872361_1872967_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_085948186.1|1875467_1876623_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000097838.1|1876773_1877634_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123454.1|1877865_1878456_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039890.1|1878437_1879388_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632286.1|1879488_1880802_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206188.1|1880828_1882034_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018416.1|1882033_1882456_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973382.1|1882445_1883873_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969778.1|1883874_1884663_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292357.1|1884662_1885430_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206362.1|1885426_1886497_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189197.1|1886504_1887002_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072831.1|1887016_1887763_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|1887771_1888059_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191073.1|1888070_1889000_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186507.1|1889284_1891330_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535469.1|1891577_1893851_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138618.1|1893908_1895408_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001067509.1|1895643_1896549_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001296730.1|1896720_1897047_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698141.1|1897054_1897240_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900919.1|1897236_1899876_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|1900083_1901073_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001295716.1|1901183_1901606_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|1901602_1901869_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628168.1|1902142_1905667_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837940.1|1906032_1907166_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	59.1	6.3e-118
WP_001295593.1|1907306_1907741_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_085948186.1|1908595_1909751_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_122993102.1|1909800_1910814_-	peptidase M85	NA	NA	NA	NA	NA
WP_122988840.1|1911028_1911106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023356.1|1911216_1911486_-|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_032212629.1|1911487_1912801_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001230471.1|1912865_1913465_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	9.7e-110
WP_032212631.1|1913532_1917006_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	98.0	0.0e+00
WP_136865629.1|1917245_1917875_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	95.2	4.4e-105
WP_109024232.1|1918331_1918562_-	hydrolase	NA	A0A0P0ZE89	Stx2-converting_phage	96.8	6.5e-30
WP_032212713.1|1918572_1919271_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000847298.1|1919270_1919600_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_109024245.1|1919596_1921123_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.1	1.8e-253
WP_109024233.1|1921134_1921467_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	100.0	1.1e-51
WP_000479045.1|1922625_1923048_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000683137.1|1923820_1924216_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000753019.1|1924801_1925155_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000158899.1|1925166_1925562_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_001299443.1|1926682_1927015_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000198153.1|1929918_1930125_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_159090506.1|1930078_1932046_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	97.2	0.0e+00
WP_000867498.1|1932020_1932566_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|1932952_1933177_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|1933258_1933573_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|1934098_1934284_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|1934506_1934653_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|1934652_1935222_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992088.1|1935492_1936026_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_000731221.1|1936076_1936421_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|1936425_1936641_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000143128.1|1936790_1938653_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	95.5	0.0e+00
WP_001339373.1|1939475_1939628_-	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_001370152.1|1941963_1942953_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	2.3e-193
WP_001370224.1|1943004_1943262_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	9.5e-22
WP_000203855.1|1943258_1944659_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.2	6.4e-245
WP_000988265.1|1944655_1945555_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	94.8	8.8e-139
WP_000061545.1|1945565_1946390_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	78.4	1.2e-89
WP_000626861.1|1946607_1946802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001087349.1|1946798_1947965_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	61.1	3.6e-116
WP_000514175.1|1947961_1948546_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.3	2.1e-56
WP_001231956.1|1948573_1948771_-	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000981537.1|1948866_1949520_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_000135680.1|1949977_1950340_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081294.1|1950405_1951230_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	100.0	3.5e-150
WP_096910863.1|1951568_1952781_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_000543621.1|1952872_1953208_+	hypothetical protein	NA	U5P0T3	Shigella_phage	97.3	5.7e-59
WP_001242740.1|1953198_1953549_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145671.1|1953545_1954019_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
WP_000829413.1|1954165_1954633_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.1	1.1e-36
WP_001014294.1|1954634_1954826_+	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_001094871.1|1954828_1955563_+	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	98.8	1.4e-139
WP_001061339.1|1955562_1956135_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_001093921.1|1956171_1956453_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	95.7	4.1e-42
>prophage 9
NZ_CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	2995742	3030801	5391064	tRNA,transposase,integrase,protease	Stx2-converting_phage(46.15%)	27	2986557:2986572	3040383:3040398
2986557:2986572	attL	CGACCTGTGCCGGAAT	NA	NA	NA	NA
WP_000450589.1|2995742_2996075_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000633393.1|2996116_2997607_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-33
WP_000094682.1|2997913_2999434_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000018003.1|2999587_3000211_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001065895.1|3000487_3001252_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000290297.1|3001548_3002865_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.8	6.6e-34
WP_000268401.1|3002994_3003591_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	89.4	2.0e-99
WP_000248065.1|3003683_3005297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000270113.1|3006026_3006254_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000335713.1|3006349_3007783_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282106.1|3008795_3009359_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000233443.1|3009513_3011874_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	31.8	2.6e-33
WP_000035067.1|3011891_3012080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997983.1|3012146_3013685_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.9e-296
WP_000612591.1|3013734_3014082_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001066419.1|3014340_3015897_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000631725.1|3015916_3016264_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|3016260_3016935_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_077633724.1|3016948_3017197_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	80.2	1.3e-28
WP_001034023.1|3017650_3021742_-|protease	serine protease autotransporter EspI	protease	Q9LA58	Enterobacterial_phage	44.6	6.8e-311
WP_001021388.1|3024396_3025014_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001142971.1|3025025_3025700_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966484.1|3025700_3026165_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000065690.1|3026174_3027878_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_000612150.1|3027870_3028191_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|3028199_3028502_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_085948186.1|3029644_3030801_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
3040383:3040398	attR	CGACCTGTGCCGGAAT	NA	NA	NA	NA
>prophage 10
NZ_CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	3048863	3057596	5391064	transposase	Stx2-converting_phage(37.5%)	10	NA	NA
WP_000254140.1|3048863_3049445_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001054789.1|3049444_3050602_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|3050624_3051080_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|3051102_3052143_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|3052191_3052770_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301248.1|3052838_3053414_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_087661054.1|3053683_3054896_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001341423.1|3055001_3055676_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|3055672_3056020_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066419.1|3056039_3057596_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
>prophage 11
NZ_CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	3235763	3255783	5391064	transposase,integrase	Stx2-converting_phage(60.0%)	21	3240434:3240447	3255973:3255986
WP_001145628.1|3235763_3236402_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	42.7	9.0e-45
WP_000953521.1|3236693_3238058_+	EspK/GogB family type III secretion system effector	NA	Q9MBM1	Phage_Gifsy-1	29.5	7.3e-52
WP_096910863.1|3239070_3240284_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
3240434:3240447	attL	TATGAATTTGGTGC	NA	NA	NA	NA
WP_024174206.1|3240572_3241265_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001341423.1|3241361_3242036_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|3242032_3242380_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066419.1|3242399_3243956_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000839246.1|3244216_3244414_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000777666.1|3244425_3244914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854916.1|3244910_3245288_-	toxin	NA	NA	NA	NA	NA
WP_024174207.1|3245334_3245709_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692312.1|3245871_3246093_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_077633701.1|3246161_3246329_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000624681.1|3247611_3247962_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	1.8e-39
WP_000422707.1|3247958_3248384_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	2.9e-47
WP_096855415.1|3249888_3250131_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	8.6e-41
WP_001066422.1|3250159_3251716_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
WP_000631725.1|3251735_3252083_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|3252079_3252754_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000997985.1|3252862_3254401_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	8.7e-296
WP_001218841.1|3254517_3255783_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
3255973:3255986	attR	TATGAATTTGGTGC	NA	NA	NA	NA
>prophage 12
NZ_CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	3503685	3510825	5391064		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|3503685_3504324_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590409.1|3504320_3505583_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	4.4e-136
WP_000847985.1|3505579_3506488_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|3506683_3507451_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141315.1|3507501_3508158_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.8	4.3e-50
WP_001272924.1|3508263_3510825_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 13
NZ_CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	3592398	3686785	5391064	transposase,tail,holin,terminase,capsid,integrase,tRNA,head	Stx2-converting_phage(43.9%)	79	3584985:3585001	3608694:3608710
3584985:3585001	attL	TTGAAACTTTACAAAAA	NA	NA	NA	NA
WP_001234104.1|3592398_3593610_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000998846.1|3593602_3593824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001370696.1|3593832_3594966_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_085948186.1|3595906_3597063_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_024174260.1|3598146_3598542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000413407.1|3598656_3599070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159090507.1|3599465_3600779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096910863.1|3601223_3602437_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_000424040.1|3603286_3604945_+	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	98.7	0.0e+00
WP_000844622.1|3604946_3605915_+	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	98.8	2.3e-185
WP_001258395.1|3605914_3606775_+	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	97.2	8.6e-160
WP_001399360.1|3607016_3607259_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	97.5	2.1e-34
WP_001205467.1|3607258_3607609_+	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	89.1	6.8e-55
WP_101329723.1|3607660_3608551_+	DNA methyltransferase	NA	A0A0P0YLW3	Yellowstone_lake_mimivirus	29.0	4.9e-17
WP_000101315.1|3608597_3610001_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
3608694:3608710	attR	TTTTTGTAAAGTTTCAA	NA	NA	NA	NA
WP_001344632.1|3610631_3610763_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_000143014.1|3611205_3613059_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	95.9	0.0e+00
WP_000411795.1|3613351_3613558_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	2.0e-30
WP_000731236.1|3613562_3613907_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992122.1|3613957_3614491_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_047091958.1|3615008_3615194_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.3	1.3e-17
WP_000736096.1|3615279_3615504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095749.1|3615872_3616100_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_000958402.1|3616785_3617349_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_001399696.1|3617345_3619007_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.3	0.0e+00
WP_000173032.1|3619070_3621008_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.5	0.0e+00
WP_001063025.1|3621052_3621274_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|3623800_3624127_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|3624137_3624488_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|3624484_3624931_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|3624927_3625272_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275482.1|3625336_3626053_+|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.2	6.2e-127
WP_000710949.1|3626067_3626442_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001453698.1|3626537_3626747_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212947.1|3626798_3630041_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.6	0.0e+00
WP_000807954.1|3630033_3630375_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_032212666.1|3630374_3631073_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_032212700.1|3631083_3631827_+|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	98.0	2.3e-148
WP_122994351.1|3631772_3632405_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	94.3	1.2e-97
WP_000649829.1|3632592_3633120_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_109024236.1|3633253_3636727_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	98.2	0.0e+00
WP_001023386.1|3638769_3639039_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	95.5	6.0e-43
WP_115801847.1|3639145_3639235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001370516.1|3639254_3641603_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001370486.1|3642194_3645596_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.3e-219
WP_000938111.1|3645972_3647334_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_000162574.1|3649088_3649571_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|3649702_3650179_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|3650168_3650459_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|3650520_3650862_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|3651010_3652672_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|3652757_3653636_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001307957.1|3653758_3654352_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_024026167.1|3654406_3655693_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|3655713_3656505_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|3656671_3658033_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|3658170_3658419_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|3658437_3658986_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|3659016_3659784_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|3659825_3660173_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|3660249_3660732_-	OmpA family protein	NA	NA	NA	NA	NA
WP_001212391.1|3661963_3662482_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001370532.1|3662631_3662997_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168045.1|3663205_3664276_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225221.1|3664286_3665408_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200116.1|3665450_3666611_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|3666709_3666757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|3666860_3667202_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197674.1|3667472_3668210_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079092.1|3668344_3669325_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040122.1|3669321_3670053_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|3670182_3672756_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841103.1|3678529_3679828_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|3679824_3680148_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|3680193_3681549_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082964.1|3681662_3684323_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001370531.1|3684354_3685053_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|3685121_3685541_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|3685747_3686785_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 14
NZ_CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	3914461	3980289	5391064	transposase,protease,holin,capsid,integrase,tail	Escherichia_phage(57.32%)	82	3914243:3914267	3979258:3979282
3914243:3914267	attL	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
WP_001218308.1|3914461_3915631_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000453637.1|3915614_3915797_-	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_000994804.1|3915875_3916262_-	DUF1627 domain-containing protein	NA	A0A2L1IV77	Escherichia_phage	100.0	4.6e-52
WP_001291844.1|3916297_3916510_-	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000609349.1|3916750_3917419_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	95.2	1.1e-104
WP_000002101.1|3917467_3917752_-	ASCH domain-containing protein	NA	A0A0P0ZDM1	Stx2-converting_phage	97.9	7.7e-49
WP_000969524.1|3917751_3918012_-	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	98.8	1.9e-41
WP_000628763.1|3918008_3918884_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	86.1	5.4e-141
WP_000224734.1|3919397_3919595_-	hypothetical protein	NA	A0A222YWL3	Escherichia_phage	93.4	3.2e-25
WP_085948186.1|3919679_3920835_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000206781.1|3920876_3921326_-	hypothetical protein	NA	V5UT79	Shigella_phage	54.5	7.0e-20
WP_001014298.1|3921328_3921520_-	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000034212.1|3921521_3921929_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_000812196.1|3921925_3922534_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	93.6	1.0e-82
WP_001370500.1|3922530_3922695_-	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	9.3e-23
WP_001111288.1|3922705_3923002_-	DUF2856 family protein	NA	G9L665	Escherichia_phage	100.0	9.5e-50
WP_000073097.1|3923025_3923613_-	hypothetical protein	NA	G9L666	Escherichia_phage	100.0	9.9e-107
WP_000536228.1|3923609_3924290_-	AAA family ATPase	NA	G9L667	Escherichia_phage	100.0	3.4e-127
WP_000613346.1|3924298_3924487_-	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
WP_000361831.1|3924483_3924597_-	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	100.0	2.7e-13
WP_001198858.1|3924589_3924730_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000065353.1|3924802_3925171_-	DUF2528 family protein	NA	A0A1U9AJB3	Stx1_converting_phage	99.2	2.6e-65
WP_157910050.1|3925351_3925888_-	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	94.8	1.1e-88
WP_001370067.1|3927298_3927640_-	hypothetical protein	NA	F1C5C1	Cronobacter_phage	66.4	2.5e-30
WP_001189994.1|3928088_3928907_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	46.2	3.3e-36
WP_000885926.1|3929093_3929435_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
WP_000250472.1|3929495_3930203_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	99.6	1.5e-133
WP_001180318.1|3930281_3930509_+	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438537.1|3930615_3930915_+	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	100.0	1.3e-49
WP_001244621.1|3930937_3931210_+	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000431329.1|3931272_3932160_+	hypothetical protein	NA	G9L680	Escherichia_phage	99.7	2.8e-145
WP_001248397.1|3932156_3934550_+	DNA helicase	NA	G9L681	Escherichia_phage	99.7	0.0e+00
WP_001036028.1|3934546_3934816_+	hypothetical protein	NA	G9L682	Escherichia_phage	100.0	2.9e-45
WP_000818843.1|3934888_3935095_+	hypothetical protein	NA	G9L683	Escherichia_phage	100.0	2.7e-27
WP_000103680.1|3935239_3935455_+	hypothetical protein	NA	G9L684	Escherichia_phage	100.0	2.2e-32
WP_001229012.1|3935628_3936045_+	NinB protein	NA	G9L686	Escherichia_phage	100.0	3.9e-73
WP_000573864.1|3936037_3936640_+	endonuclease	NA	G9L687	Escherichia_phage	100.0	1.7e-114
WP_000153293.1|3936636_3937164_+	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	100.0	9.5e-101
WP_001254258.1|3937160_3937355_+	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	2.9e-31
WP_000201604.1|3937611_3937977_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	96.7	3.7e-43
WP_000178727.1|3938242_3938917_+	phage antirepressor Ant	NA	A0A0P0ZDQ5	Stx2-converting_phage	88.8	6.2e-113
WP_001004008.1|3938991_3939714_+	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.6	3.9e-129
WP_001108009.1|3939713_3940319_+	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	98.0	2.4e-95
WP_000144767.1|3940315_3940510_+	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_001204859.1|3940502_3940937_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_001356551.1|3941185_3941338_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000649753.1|3941720_3942680_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|3942691_3942961_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874429.1|3943447_3945385_+	SASA family carbohydrate esterase	NA	G9L6J1	Escherichia_phage	99.7	0.0e+00
WP_000143462.1|3945520_3945700_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290216.1|3945740_3946013_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	98.9	3.1e-23
WP_000284510.1|3946089_3946305_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000087714.1|3946309_3946843_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001056887.1|3947117_3947687_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	98.9	2.6e-104
WP_000455406.1|3947686_3947836_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_012816791.1|3948063_3948249_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001109019.1|3948476_3949028_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_001086087.1|3949320_3950127_+	hypothetical protein	NA	A0A1U9AJA9	Stx1_converting_phage	99.3	1.1e-132
WP_000143998.1|3950107_3951814_+	hypothetical protein	NA	A0A1U9AJA6	Stx1_converting_phage	99.1	0.0e+00
WP_000787524.1|3951813_3953958_+	hypothetical protein	NA	A0A2R2Z346	Escherichia_phage	99.9	0.0e+00
WP_000345010.1|3954115_3955123_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214470.1|3955146_3956361_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	99.5	1.1e-232
WP_001140444.1|3956415_3956805_+	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_001370499.1|3956855_3957317_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	94.8	3.3e-73
WP_000829203.1|3957300_3957864_+	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	99.5	7.0e-102
WP_000207919.1|3957863_3958514_+	hypothetical protein	NA	A0A0H4J3F2	Shigella_phage	99.5	3.9e-120
WP_000117996.1|3958510_3960349_+|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.0e-64
WP_001023433.1|3960350_3960620_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	6.4e-45
WP_001370566.1|3960757_3960937_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	2.8e-28
WP_001146329.1|3961240_3962866_+	hypothetical protein	NA	A0A088CBK0	Shigella_phage	99.8	0.0e+00
WP_000162956.1|3962862_3964131_+	host specificity protein J	NA	Q08J79	Stx2-converting_phage	100.0	9.9e-221
WP_001369201.1|3964145_3964427_+	hypothetical protein	NA	Q08J78	Stx2-converting_phage	100.0	3.1e-50
WP_001399382.1|3964432_3964990_+	hypothetical protein	NA	Q08J77	Stx2-converting_phage	98.9	5.5e-107
WP_000682942.1|3965136_3965859_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	76.7	9.0e-102
WP_000035554.1|3966288_3966690_+	hypothetical protein	NA	A0A2L1IV61	Escherichia_phage	97.0	3.9e-70
WP_000509480.1|3966783_3967437_+	hypothetical protein	NA	Q08J74	Stx2-converting_phage	96.8	1.1e-109
WP_000455646.1|3967439_3967886_+	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	97.3	1.3e-74
WP_000540396.1|3967895_3968147_+	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	97.4	5.1e-12
WP_085948186.1|3968468_3969624_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001370495.1|3969697_3970690_+	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	90.0	3.3e-163
WP_000885695.1|3970758_3979134_+	hypothetical protein	NA	A0A0P0ZCC7	Stx2-converting_phage	97.0	0.0e+00
WP_000368131.1|3979356_3980289_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
3979258:3979282	attR	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
>prophage 15
NZ_CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	4221612	4231054	5391064		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569358.1|4221612_4222539_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|4222543_4223275_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4223255_4223363_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|4223422_4224154_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|4224375_4226061_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4226057_4226777_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001370504.1|4226823_4227294_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.1e-81
WP_001295429.1|4227334_4227796_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001370558.1|4227920_4229921_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001370574.1|4229917_4231054_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 16
NZ_CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	4322525	4330815	5391064		Klebsiella_phage(14.29%)	7	NA	NA
WP_001115962.1|4322525_4323920_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
WP_000183035.1|4324094_4324988_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_000009507.1|4325409_4326690_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	A0A218MKK1	uncultured_virus	24.7	2.1e-08
WP_000875590.1|4326726_4327755_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	E3T4Y8	Cafeteria_roenbergensis_virus	45.1	4.5e-70
WP_000697837.1|4327757_4328846_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	50.3	2.5e-95
WP_086163603.1|4328812_4329712_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.7	1.8e-107
WP_000414659.1|4329711_4330815_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	32.1	2.7e-28
>prophage 17
NZ_CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	4477514	4511586	5391064	tail,holin,terminase,capsid,portal,integrase,plate,head	Enterobacteria_phage(87.18%)	46	4476449:4476508	4511693:4511816
4476449:4476508	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_000078920.1|4477514_4477655_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488108.1|4477845_4478106_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|4478148_4479258_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005425.1|4479415_4480600_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	4.4e-223
WP_000290450.1|4480599_4481112_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|4481166_4481532_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000333494.1|4481540_4481696_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_000853431.1|4481682_4484490_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.7	0.0e+00
WP_001447286.1|4485168_4485714_+	transferase	NA	NA	NA	NA	NA
WP_000885638.1|4485677_4486295_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	80.9	1.0e-85
WP_000108489.1|4486294_4488295_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	97.6	4.6e-111
WP_000071720.1|4488297_4488828_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_001111920.1|4488820_4489717_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	5.7e-154
WP_000213447.1|4489720_4490071_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271900.1|4490067_4490649_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.4e-100
WP_000356316.1|4490645_4491281_-|tail	tail protein	tail	A0A0A7NV60	Enterobacteria_phage	99.1	1.5e-113
WP_000920594.1|4491273_4491741_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000780572.1|4491878_4492286_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000072327.1|4492282_4492675_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104342.1|4492671_4492995_-|holin	phage holin, lambda family	holin	A0A0A7NRY9	Enterobacteria_phage	100.0	4.2e-51
WP_000864901.1|4492997_4493198_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063078.1|4493197_4493692_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.2	2.3e-88
WP_000632364.1|4493794_4494595_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	97.4	3.3e-137
WP_001055112.1|4494640_4495693_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	2.9e-194
WP_001262656.1|4495716_4496553_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.6	1.5e-148
WP_000613773.1|4496707_4498459_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_000087807.1|4498458_4499505_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.4	6.3e-205
WP_000711111.1|4500034_4500565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001289970.1|4500656_4501040_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.0	9.8e-31
WP_000211270.1|4501103_4501415_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	94.2	4.2e-48
WP_000686474.1|4501419_4502379_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	6.4e-180
WP_000564228.1|4505293_4505683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122985482.1|4505679_4506297_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	37.8	2.1e-06
WP_000108347.1|4506308_4506608_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	86.9	9.0e-40
WP_000153711.1|4506604_4506871_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	3.4e-30
WP_000985144.1|4506867_4507071_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	5.5e-25
WP_029594336.1|4507094_4507490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|4507604_4507718_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514274.1|4507714_4507957_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	6.8e-38
WP_000159467.1|4507968_4508247_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	5.3e-34
WP_000739029.1|4508257_4508608_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|4508629_4508833_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|4508904_4509042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|4509131_4509536_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000865386.1|4510231_4510579_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|4510584_4511586_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
4511693:4511816	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 18
NZ_CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	4540920	4547546	5391064	transposase,tRNA	Stx2-converting_phage(83.33%)	6	NA	NA
WP_000997984.1|4540920_4542459_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.0e-296
WP_000612591.1|4542508_4542856_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001066422.1|4543037_4544594_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
WP_000631725.1|4544613_4544961_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|4544957_4545632_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001025305.1|4545812_4547546_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	5.7e-86
>prophage 19
NZ_CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	4834423	4964045	5391064	protease,transposase,holin,terminase,head,portal,capsid,integrase,tRNA,tail	Escherichia_phage(34.23%)	147	4843695:4843710	4963942:4963957
WP_001260840.1|4834423_4835245_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|4835344_4835428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|4835520_4835856_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|4836252_4837506_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019555.1|4837612_4838506_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|4838640_4839861_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|4839985_4840681_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|4840633_4841926_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|4842084_4842699_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|4842741_4843596_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|4843597_4844215_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
4843695:4843710	attL	GCGCGCGGCAGTGGCG	NA	NA	NA	NA
WP_024025733.1|4844225_4846649_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.3	2.9e-205
WP_000041709.1|4846709_4849136_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.0e-214
WP_001295396.1|4849334_4849640_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_024025734.1|4849747_4850458_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|4850460_4851021_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705196.1|4851055_4851397_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001295395.1|4851531_4851858_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_001370501.1|4852063_4853278_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836078.1|4853289_4853856_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	30.2	1.5e-11
WP_001341423.1|4854097_4854772_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|4854768_4855116_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066422.1|4855135_4856692_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
WP_000612591.1|4856873_4857221_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000997984.1|4857270_4858809_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.0e-296
WP_001296941.1|4858966_4859203_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_096910863.1|4860476_4861690_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_012775982.1|4861962_4862241_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265275.1|4862242_4863292_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	2.5e-113
WP_001047121.1|4863305_4864058_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.8	2.1e-133
WP_000203370.1|4865218_4865404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795389.1|4866030_4866120_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|4866174_4866387_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066485.1|4866687_4866903_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	7.7e-25
WP_024025755.1|4867656_4867872_+|holin	holin	holin	A5LH82	Enterobacteria_phage	93.0	5.5e-31
WP_001092971.1|4868184_4868718_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|4868714_4869212_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|4869573_4869786_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|4869796_4869985_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|4869987_4870053_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|4870132_4870288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019140.1|4870459_4870633_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000035577.1|4870784_4871195_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001031431.1|4871495_4871702_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000421825.1|4872254_4872794_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001399690.1|4872868_4873840_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.7	3.1e-182
WP_000114064.1|4873957_4875196_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.1	6.6e-60
WP_000229066.1|4875188_4875413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038673.1|4875472_4876051_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	65.4	4.9e-58
WP_000130338.1|4876171_4876369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000179578.1|4876426_4876732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024200973.1|4876869_4877133_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001113138.1|4877125_4877446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261504.1|4877452_4877752_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833609.1|4877748_4879575_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.7	2.0e-129
WP_001399692.1|4879862_4880108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126660.1|4880104_4880527_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000860401.1|4881185_4883075_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
WP_000133409.1|4883332_4883614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001072975.1|4885096_4885309_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_077633710.1|4885236_4886817_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	1.1e-288
WP_001097046.1|4888875_4889199_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
WP_001283147.1|4889191_4889467_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
WP_000677106.1|4889478_4890057_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001079398.1|4890053_4890455_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211089.1|4890466_4891210_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	96.8	4.0e-129
WP_001370402.1|4891270_4891657_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
WP_001161009.1|4891665_4891995_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372036.1|4891966_4895032_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.7	0.0e+00
WP_000447255.1|4895031_4895361_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	8.6e-60
WP_001152409.1|4895370_4896069_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	2.3e-134
WP_000140752.1|4896074_4896818_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.5e-147
WP_001399694.1|4896715_4897363_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	1.2e-110
WP_000515486.1|4897423_4900822_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.6	0.0e+00
WP_001230525.1|4900888_4901488_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	8.8e-111
WP_072004194.1|4901552_4904507_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.7	6.0e-67
WP_001370405.1|4904506_4905028_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.9	2.3e-91
WP_085948186.1|4905084_4906240_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000086528.1|4906446_4907034_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	6.1e-24
WP_000836768.1|4907350_4907584_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|4907652_4907766_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001206148.1|4908416_4909712_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_044788941.1|4909731_4909926_-	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	53.7	6.3e-10
WP_087661054.1|4910023_4911237_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_085948186.1|4911300_4912457_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000102122.1|4912635_4915098_-	exonuclease	NA	V5UQJ3	Shigella_phage	47.7	2.3e-125
WP_000199475.1|4915190_4915379_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|4915375_4915564_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|4916128_4916338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|4916338_4916977_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|4916988_4917141_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|4917433_4917772_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|4918163_4918406_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|4918389_4918815_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262401.1|4918883_4919951_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	85.3	1.9e-84
WP_000139447.1|4919943_4920405_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|4920438_4921155_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|4921187_4921469_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|4921465_4921693_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|4921685_4921997_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|4922124_4922343_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104475.1|4922344_4922902_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.3	2.4e-33
WP_000935259.1|4923135_4923348_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|4923467_4923812_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|4923933_4924206_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|4924207_4925257_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217447.1|4925269_4925629_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_000640035.1|4925637_4926192_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917748.1|4926416_4926614_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	95.4	1.5e-27
WP_000301797.1|4926749_4927463_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|4927913_4928345_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000411802.1|4931119_4931326_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000731236.1|4931330_4931675_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992167.1|4931725_4932259_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_001056805.1|4932529_4933084_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	1.4e-102
WP_000539795.1|4933097_4933244_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|4933466_4933652_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|4934176_4934491_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|4934572_4934797_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|4935182_4935728_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|4935702_4937628_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|4937624_4937831_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_109024242.1|4937827_4938235_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	90.7	1.4e-51
WP_109024243.1|4939713_4939863_+	peptidase, S49 family protein	NA	A0A2I6TC87	Escherichia_phage	96.9	3.7e-10
WP_001299443.1|4940731_4941064_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_024025845.1|4941119_4942145_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	9.9e-187
WP_000158899.1|4942186_4942582_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_000753019.1|4942593_4942947_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_024025847.1|4942958_4943537_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	6.6e-79
WP_000235098.1|4943935_4944688_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479045.1|4944701_4945124_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|4945150_4945564_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000847401.1|4948147_4948477_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_001370115.1|4949179_4949923_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	5.0e-148
WP_000246279.1|4949820_4950504_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.8	1.8e-107
WP_106902971.1|4950738_4954131_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	87.7	0.0e+00
WP_001230379.1|4954197_4954797_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_032212803.1|4954861_4956175_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	3.9e-79
WP_024174195.1|4956176_4956440_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	97.2	2.5e-33
WP_087661054.1|4956445_4957658_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_077633690.1|4957624_4957759_+|tail	phage tail protein	tail	A0A0N7BTS3	Escherichia_phage	100.0	2.6e-07
WP_001370116.1|4958170_4958776_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.5	1.8e-111
WP_001121225.1|4959000_4959651_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_085948186.1|4959907_4961064_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001217539.1|4961511_4961760_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000332271.1|4961821_4962919_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.7	9.5e-212
WP_000543822.1|4963007_4964045_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
4963942:4963957	attR	GCGCGCGGCAGTGGCG	NA	NA	NA	NA
>prophage 20
NZ_CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	5325883	5363026	5391064	transposase,holin,terminase,integrase,tail	Enterobacteria_phage(40.0%)	44	5322851:5322864	5332747:5332760
5322851:5322864	attL	TTCTTCGCCTGGCG	NA	NA	NA	NA
WP_001218283.1|5325883_5327101_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	99.5	1.7e-238
WP_000206721.1|5329667_5330288_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	92.7	3.6e-115
WP_001242716.1|5330287_5330650_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	98.3	5.8e-65
WP_000008189.1|5330640_5331177_-	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.9	4.8e-100
WP_001311077.1|5332097_5332790_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
5332747:5332760	attR	TTCTTCGCCTGGCG	NA	NA	NA	NA
WP_001191671.1|5332887_5333148_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	1.2e-40
WP_000515839.1|5333140_5333692_+	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	98.9	2.2e-100
WP_001087356.1|5333688_5334837_+	peptidase	NA	K7PLX4	Enterobacteria_phage	86.9	7.2e-178
WP_000620698.1|5334833_5335058_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	2.8e-38
WP_024025783.1|5335868_5336363_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.8	4.3e-87
WP_000066917.1|5336362_5337016_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210170.1|5337012_5337339_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767113.1|5337335_5337725_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061444.1|5337744_5338554_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001223334.1|5338569_5339085_+	hypothetical protein	NA	V5URU3	Shigella_phage	28.7	4.6e-15
WP_001299344.1|5339094_5340084_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.2e-194
WP_001205460.1|5340101_5340443_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131907.1|5340455_5341004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868396.1|5340990_5341917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917724.1|5342181_5342385_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799669.1|5342535_5343594_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	86.7	2.9e-181
WP_001370417.1|5344036_5344468_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	99.3	3.5e-69
WP_000216636.1|5344464_5344632_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	74.5	1.1e-10
WP_032212796.1|5345039_5346890_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.8	0.0e+00
WP_085948186.1|5347012_5348168_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000411802.1|5348603_5348810_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_096910863.1|5349296_5350510_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_001208681.1|5350836_5351022_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|5351549_5351864_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|5351945_5352170_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303046.1|5352211_5352577_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_077760350.1|5352867_5353269_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	97.7	5.6e-61
WP_085947772.1|5353261_5354475_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001130973.1|5354500_5355196_+	hypothetical protein	NA	Q6H9T2	Enterobacteria_phage	99.6	8.6e-126
WP_001216289.1|5355263_5355887_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	2.5e-68
WP_032212792.1|5355951_5357142_+|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	95.5	4.8e-76
WP_001023428.1|5357143_5357413_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	2.4e-44
WP_001118085.1|5357523_5358105_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_077633702.1|5358172_5358802_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	8.7e-77
WP_001143789.1|5358883_5359525_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	98.6	1.4e-106
WP_001217539.1|5359685_5359934_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000202564.1|5360153_5361740_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|5362132_5362738_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|5362864_5363026_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
