The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	601768	670639	5648177	lysis,protease,transposase,portal,tRNA,terminase,integrase,capsid,tail,head	Enterobacteria_phage(57.89%)	78	611929:611975	662113:662159
WP_000912342.1|601768_603154_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_001143540.1|603189_603711_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|603818_604031_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|604032_604899_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|605379_605922_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988363.1|606141_606834_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000701359.1|606864_609474_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|609452_610493_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255226.1|610503_611019_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|611021_611654_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
611929:611975	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|611988_613152_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000446905.1|613007_613379_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|613350_613629_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763390.1|613676_613895_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_001443983.1|613993_614275_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|614285_614477_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|614449_614632_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|614628_615309_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000100847.1|615305_616091_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|616096_616393_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000206913.1|616468_616759_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	82.4	2.5e-26
WP_001444023.1|617225_617546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000066829.1|617681_617945_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
WP_000259990.1|618026_618782_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_001067458.1|618820_619051_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182773.1|619120_619660_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001342088.1|619746_620676_+	replication protein	NA	M1FN81	Enterobacteria_phage	67.0	4.4e-109
WP_000788789.1|620672_621374_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
WP_000152742.1|621578_621926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001415151.1|622678_623287_+	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_001038620.1|623586_624003_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_000520500.1|623981_624383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097617.1|624506_624608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053023.1|624604_625060_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_000224914.1|625059_625230_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774477.1|625222_625513_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_001099712.1|625509_625872_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971074.1|625868_626009_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204791.1|626094_626478_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737278.1|626666_627749_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
WP_000839596.1|628337_628553_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135274.1|628552_629050_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_000738423.1|629538_629832_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001427981.1|631502_631697_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000453558.1|632085_632631_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027297.1|632605_634531_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000198149.1|634527_634734_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001375452.1|634730_636332_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.0e-310
WP_000381395.1|636804_638376_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|638395_638743_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|638742_639420_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000088640.1|639460_640339_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.0	1.7e-147
WP_001345004.1|640348_640681_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063244.1|640736_641762_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_000158868.1|641803_642199_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752961.1|642210_642585_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
WP_000985132.1|642575_643154_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683110.1|643150_643546_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_001342267.1|643553_644294_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|644309_644732_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|644713_645148_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840236.1|645140_647702_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
WP_000847347.1|647698_648028_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_001152557.1|648027_648726_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	3.4e-130
WP_000090884.1|649411_650044_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_000515439.1|650104_653518_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_001230523.1|653588_654188_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
WP_000268807.1|654252_657213_+	membrane protein	NA	A0A2D1UII2	Escherichia_phage	97.4	6.6e-58
WP_000885569.1|657212_657797_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_000239881.1|657851_658520_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|658576_658882_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226384.1|659065_660550_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|660736_661690_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177453.1|662202_662964_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
662113:662159	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|663146_664037_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001375368.1|664037_667010_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383941.1|666996_669234_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420938.1|669502_670639_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	890167	940674	5648177	lysis,protease,transposase,portal,holin,terminase,integrase,tail,head	Enterobacteria_phage(51.61%)	67	885915:885930	892986:893001
885915:885930	attL	ATGGCGGCGCGGCAGG	NA	NA	NA	NA
WP_000533654.1|890167_891238_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
WP_001303849.1|891215_891434_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001281774.1|891540_891885_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_000545733.1|891913_892081_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000002107.1|892153_892438_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_012817743.1|892430_892733_-	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	97.0	9.4e-53
WP_000104414.1|892729_893347_-	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
892986:893001	attR	ATGGCGGCGCGGCAGG	NA	NA	NA	NA
WP_000034231.1|893348_893906_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
WP_000812206.1|893902_894460_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
WP_001214436.1|894456_894621_-	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
WP_001111278.1|894631_894925_-	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_000951334.1|894948_895332_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_000031370.1|895331_895937_-	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_000088311.1|896126_896429_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000336726.1|896464_897283_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_001243354.1|897460_897613_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
WP_000638547.1|897597_897729_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_085947969.1|898155_899369_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
WP_000788880.1|901671_902373_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	3.8e-129
WP_000145926.1|902369_902660_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000344573.1|902956_903313_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_000814611.1|903284_903695_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_001254255.1|903691_903868_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_032341936.1|903870_904269_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	99.2	2.9e-70
WP_001341811.1|904228_904438_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.6e-30
WP_001003989.1|904430_905153_+	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
WP_000002261.1|905152_905443_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_001008193.1|905439_905802_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_000994516.1|905798_905987_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000750155.1|906198_907158_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|907496_907619_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|907633_908323_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|908507_909251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|909336_909495_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000411802.1|912105_912312_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|912311_912809_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092330.1|912805_913243_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.2	1.1e-70
WP_000881326.1|913392_914010_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001307652.1|914197_914392_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000235451.1|914787_915297_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_009442816.1|915268_917197_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
WP_000259002.1|917180_917387_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001432013.1|917383_918976_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.2e-184
WP_001254029.1|918965_919142_+	hypothetical protein	NA	E4WL22	Enterobacteria_phage	56.4	1.1e-08
WP_000839179.1|919219_919624_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612622.1|919620_919968_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	9.7e-62
WP_000099160.1|920016_921555_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_032284507.1|921551_921920_+	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	88.0	2.4e-50
WP_001143027.1|921927_922680_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	94.0	2.0e-128
WP_000479086.1|922693_923125_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533431.1|923151_923565_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000082320.1|923545_926125_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
WP_000847304.1|926121_926451_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001375577.1|926450_927149_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
WP_001429308.1|927154_927898_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_096844540.1|927843_928476_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_000515142.1|928721_932198_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
WP_001230449.1|932265_932865_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_000268998.1|932929_934144_+	short-chain dehydrogenase	NA	B6DZB7	Enterobacteria_phage	95.8	6.6e-81
WP_001023459.1|934145_934415_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000950982.1|934520_935402_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_000652081.1|935625_936453_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.2	3.1e-154
WP_021351651.1|936576_936948_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_000381395.1|937422_938994_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|939013_939361_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|939360_940038_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001448642.1|940098_940674_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
>prophage 3
NZ_CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	1155779	1293594	5648177	protease,transposase,portal,holin,terminase,integrase,capsid,tail,head	Escherichia_phage(36.28%)	163	1200540:1200555	1299948:1299963
WP_000156528.1|1155779_1157540_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877167.1|1157725_1158178_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1158252_1159293_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1159649_1160159_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|1160377_1161007_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1160969_1163132_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1163141_1163588_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001297106.1|1163710_1165765_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
WP_000424181.1|1165796_1166255_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1166350_1167013_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1167185_1167599_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1167643_1167961_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116301.1|1168018_1169209_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048244.1|1169303_1169582_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1169578_1169908_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375138.1|1169998_1170658_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
WP_001299351.1|1171066_1172086_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1172063_1172306_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_106875240.1|1172373_1174824_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_001098307.1|1174917_1175109_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1175105_1175294_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|1175861_1176071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394543.1|1176071_1176710_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	3.3e-07
WP_000380316.1|1176721_1176874_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001303876.1|1177150_1177438_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1177437_1177629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1177656_1178058_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1178166_1178439_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1178422_1178848_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1179054_1179510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205821.1|1179588_1180704_+	hypothetical protein	NA	V5URT9	Shigella_phage	68.4	3.4e-132
WP_000788742.1|1180710_1181457_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.6	5.6e-115
WP_000451007.1|1181478_1182249_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151233.1|1182264_1182678_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_106875241.1|1183268_1184482_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000955173.1|1185480_1185618_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013636.1|1185662_1185875_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_001341388.1|1186042_1186321_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265141.1|1186322_1187372_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.5e-110
WP_001217436.1|1187384_1187756_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|1187745_1188117_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|1188268_1189087_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|1189373_1189571_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000261902.1|1189708_1190422_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874350.1|1191189_1193040_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000411814.1|1193487_1193694_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000138558.1|1193949_1194222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|1194381_1194915_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|1195135_1195249_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|1195470_1195656_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1196182_1196497_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|1196578_1196803_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000453587.1|1197199_1197745_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027379.1|1197719_1199645_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|1199641_1199848_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001415980.1|1199844_1201446_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.3e-307
1200540:1200555	attL	GTTCATTCACGTCTTT	NA	NA	NA	NA
WP_000123251.1|1201426_1202746_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001365129.1|1202755_1203088_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|1203143_1204169_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|1204209_1204605_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|1204616_1204970_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975098.1|1204981_1205560_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
WP_000683137.1|1205556_1205952_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235067.1|1205959_1206712_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479045.1|1206725_1207148_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533442.1|1207174_1207588_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000847298.1|1210175_1210505_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001443841.1|1210504_1211203_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	97.4	4.4e-130
WP_000194707.1|1211213_1211957_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.2	1.2e-149
WP_159032312.1|1211902_1212535_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.8	1.4e-103
WP_106875222.1|1212780_1216257_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.9	0.0e+00
WP_106875243.1|1216325_1216949_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	2.3e-69
WP_001023445.1|1218327_1218597_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_012817749.1|1218721_1219474_-	type III effector	NA	NA	NA	NA	NA
WP_077630526.1|1220277_1220904_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	55.0	8.2e-59
WP_085947969.1|1220979_1222192_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
WP_001232849.1|1222232_1222493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000273151.1|1222587_1222830_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000048500.1|1222897_1225348_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000199475.1|1225442_1225631_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|1225627_1225816_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001331716.1|1226216_1226381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171921.1|1226384_1226603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024182289.1|1226695_1226896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000692026.1|1227309_1227612_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_001022415.1|1227614_1227974_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
WP_000578360.1|1228020_1228413_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_001172789.1|1228539_1228800_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
WP_000693932.1|1228796_1229234_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
WP_000729535.1|1229320_1230331_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.8	4.9e-170
WP_072096947.1|1230242_1230785_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	1.8e-78
WP_000450641.1|1230818_1231544_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.2e-77
WP_001040234.1|1231559_1231952_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
WP_001266133.1|1231948_1232245_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_001209480.1|1232241_1232703_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403783.1|1232680_1233037_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_000935422.1|1233087_1233300_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_001224662.1|1233333_1233516_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_001289353.1|1233681_1234317_+	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_000209152.1|1234404_1234623_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
WP_001229296.1|1234624_1234990_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000206830.1|1234986_1235331_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	1.7e-58
WP_000220601.1|1235535_1235835_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_001260977.1|1235840_1236098_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_001342259.1|1236233_1236506_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_001265113.1|1236507_1237554_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_000904103.1|1237566_1237926_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_000640048.1|1237934_1238465_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917770.1|1238706_1238904_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301785.1|1239038_1239752_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|1240201_1240633_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_032361126.1|1241110_1243048_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	97.1	0.0e+00
WP_000143463.1|1243183_1243363_+	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_001290230.1|1243403_1243649_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|1243726_1243942_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087714.1|1243946_1244480_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001056882.1|1244754_1245324_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	98.9	3.4e-104
WP_000455402.1|1245323_1245473_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_001208680.1|1245700_1245886_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|1246411_1246726_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001448509.1|1246807_1247032_-	YlcI/YnfO family protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_000279807.1|1247073_1247439_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	5.4e-63
WP_000958380.1|1247729_1248293_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001399867.1|1248289_1249951_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_000173071.1|1250014_1251952_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.7	0.0e+00
WP_001063025.1|1251996_1252218_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|1254743_1255070_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007892.1|1255080_1255431_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	3.5e-59
WP_000573391.1|1255427_1255874_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1255870_1256215_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275459.1|1256280_1256997_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	9.5e-128
WP_001030063.1|1257002_1257377_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001513217.1|1257472_1257682_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212962.1|1257729_1260972_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.2	0.0e+00
WP_000807964.1|1260964_1261306_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001448747.1|1261305_1262004_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	99.1	1.6e-132
WP_001302649.1|1262020_1262341_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1262448_1262622_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001432327.1|1262692_1263616_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	98.0	6.6e-174
WP_001375566.1|1263670_1264408_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.8	7.2e-147
WP_064721023.1|1264353_1264986_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	2.6e-105
WP_032363152.1|1265231_1268708_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.3	0.0e+00
WP_001230400.1|1268774_1269374_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	1.3e-109
WP_001023986.1|1270751_1271021_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	96.6	4.2e-44
WP_122988840.1|1271131_1271209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001273658.1|1272576_1272750_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001240628.1|1272832_1274161_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
WP_001028095.1|1274181_1274676_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001001171.1|1274686_1275277_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001341462.1|1275286_1276087_-	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001126777.1|1276094_1276481_-	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001307708.1|1276492_1277185_-	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001297176.1|1277184_1278276_-	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_000191700.1|1278563_1279202_+	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001341463.1|1279241_1283204_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000979516.1|1283258_1283468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018496.1|1283626_1285135_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000497942.1|1285800_1286631_+	FTR1 family protein	NA	NA	NA	NA	NA
WP_000154411.1|1286688_1287816_+	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_001199164.1|1287821_1289093_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_001307105.1|1289576_1290500_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
WP_001297190.1|1291311_1291767_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000279869.1|1292391_1293594_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
1299948:1299963	attR	AAAGACGTGAATGAAC	NA	NA	NA	NA
>prophage 4
NZ_CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	1474492	1639742	5648177	protease,transposase,holin,tRNA,terminase,integrase,capsid,tail,head	Escherichia_phage(29.08%)	202	1591284:1591300	1626482:1626498
WP_001113310.1|1474492_1474960_+	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
WP_000074974.1|1475036_1476155_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	2.6e-84
WP_000003742.1|1476123_1476393_-	excisionase	NA	NA	NA	NA	NA
WP_000048520.1|1476454_1478926_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_001090200.1|1479018_1479210_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1479206_1479395_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000088311.1|1479748_1480051_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000336726.1|1480086_1480905_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000367376.1|1481151_1481304_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444615.1|1481579_1482224_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|1482321_1482549_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|1482545_1482971_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262408.1|1483039_1484077_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	67.1	1.7e-85
WP_000373320.1|1484108_1484531_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_000450612.1|1484565_1485264_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.1	4.7e-71
WP_000702797.1|1485285_1485510_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|1485506_1485863_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001375713.1|1485895_1486048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001273106.1|1486044_1486356_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137957.1|1486482_1487046_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	93.9	2.9e-47
WP_001278460.1|1487155_1487260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|1487446_1487659_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001341382.1|1487826_1488105_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001265089.1|1488106_1489162_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	1.5e-89
WP_000140011.1|1489162_1489528_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	6.7e-37
WP_000640023.1|1489536_1490079_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.3	1.4e-67
WP_000917767.1|1490391_1490589_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000611213.1|1490739_1491789_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	88.5	4.0e-183
WP_000466957.1|1492260_1492692_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000143031.1|1493262_1495113_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000411804.1|1495403_1495610_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_000138558.1|1495865_1496138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003112.1|1496297_1496831_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_001208682.1|1497477_1497684_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1497748_1497973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1498329_1498470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001341372.1|1498599_1498785_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	88.5	6.4e-20
WP_001303046.1|1498826_1499192_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958402.1|1499481_1500045_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_001341975.1|1500041_1501703_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
WP_000173033.1|1501766_1503704_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.5	0.0e+00
WP_001063025.1|1503748_1503970_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|1506496_1506823_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007892.1|1506833_1507184_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	3.5e-59
WP_000573391.1|1507180_1507627_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1507623_1507968_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275459.1|1508033_1508750_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	9.5e-128
WP_001030060.1|1508755_1509130_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001513217.1|1509225_1509435_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212983.1|1509482_1512725_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.6	0.0e+00
WP_000807940.1|1512717_1513059_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001335877.1|1513058_1513757_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_001429308.1|1513767_1514511_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_122993493.1|1514456_1515089_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	7.1e-103
WP_000515075.1|1515334_1518808_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.8	0.0e+00
WP_001230532.1|1518874_1519474_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
WP_000279108.1|1519538_1520852_+|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	96.3	1.2e-72
WP_001339397.1|1520907_1521585_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|1521584_1521932_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381371.1|1521951_1523523_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.4e-168
WP_001023483.1|1523560_1523830_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
WP_000938122.1|1524284_1525646_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	39.8	4.4e-49
WP_095585410.1|1526022_1526175_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
WP_001058323.1|1526770_1527889_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107384.1|1527885_1529679_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186421.1|1529697_1530405_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|1530401_1530989_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063971.1|1530985_1531384_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004899.1|1531380_1532238_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000460810.1|1533928_1535065_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|1535077_1535170_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001300464.1|1535249_1536548_+	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000208650.1|1536662_1538843_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000057871.1|1538862_1539309_-	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_001295357.1|1539296_1540436_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000742348.1|1540481_1542578_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001038062.1|1542577_1543324_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001247610.1|1543320_1543965_-	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001295358.1|1544071_1544377_-	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_000087763.1|1544818_1545031_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|1545316_1545529_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1545539_1545728_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001316982.1|1545702_1545933_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|1545922_1546096_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818472.1|1546143_1547217_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001444338.1|1547288_1550033_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_001264955.1|1550115_1551144_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|1551116_1551809_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|1551938_1553111_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001062101.1|1553110_1555657_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_000209869.1|1555653_1556253_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024561.1|1556345_1556651_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420629.1|1556650_1557571_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
WP_000097601.1|1557830_1559090_+	YccE family protein	NA	NA	NA	NA	NA
WP_001044313.1|1559381_1560623_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_001143120.1|1560660_1560888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000607021.1|1560908_1561487_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000013656.1|1561483_1562794_-|integrase	site-specific integrase	integrase	A0A0P0ZGA8	Escherichia_phage	99.5	6.0e-253
WP_001208773.1|1562846_1563131_-	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000497812.1|1563176_1563428_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_021351637.1|1563415_1563649_-	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
WP_000994787.1|1563792_1564155_-	DUF1627 domain-containing protein	NA	A0A0P0ZH73	Escherichia_phage	96.7	1.7e-56
WP_042357761.1|1564190_1564406_-	DUF1382 family protein	NA	G3CFH1	Escherichia_phage	100.0	6.7e-29
WP_000628762.1|1564338_1565250_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	94.4	3.6e-164
WP_000224734.1|1565763_1565961_-	hypothetical protein	NA	A0A222YWL3	Escherichia_phage	93.4	3.2e-25
WP_000206782.1|1565966_1566425_-	hypothetical protein	NA	V5UT79	Shigella_phage	54.5	7.1e-20
WP_001014298.1|1566427_1566619_-	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000034212.1|1566620_1567028_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_000812200.1|1567024_1567654_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	73.9	3.1e-58
WP_001214439.1|1567650_1567815_-	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	9.3e-23
WP_001111290.1|1567825_1568122_-	DUF2856 family protein	NA	G9L665	Escherichia_phage	98.0	2.3e-48
WP_000073098.1|1568145_1568733_-	hypothetical protein	NA	G9L666	Escherichia_phage	99.5	4.9e-106
WP_000536228.1|1568729_1569410_-	AAA family ATPase	NA	G9L667	Escherichia_phage	100.0	3.4e-127
WP_000613346.1|1569418_1569607_-	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
WP_000361831.1|1569603_1569717_-	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	100.0	2.7e-13
WP_001198866.1|1569709_1569850_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q9AZ26	Salmonella_phage	100.0	3.3e-21
WP_000167595.1|1570043_1570514_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000198444.1|1570572_1570956_-	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000687675.1|1571463_1571868_-	hypothetical protein	NA	A0A0P0ZDD3	Stx2-converting_phage	100.0	1.6e-68
WP_001082382.1|1571864_1572521_-	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	100.0	2.6e-116
WP_000866443.1|1572517_1572805_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	100.0	1.6e-49
WP_000428098.1|1572941_1573646_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000064148.1|1573759_1573993_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_000438542.1|1574131_1574428_+	hypothetical protein	NA	Q6H9X8	Enterobacteria_phage	100.0	5.2e-48
WP_000788927.1|1575394_1576096_+	Replication protein P	NA	C1JJ58	Enterobacteria_phage	99.6	1.3e-129
WP_000145907.1|1576092_1576383_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	99.0	1.6e-46
WP_001000127.1|1576453_1576732_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103679.1|1576864_1577080_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|1577090_1577327_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|1577283_1577730_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153280.1|1577726_1578254_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254256.1|1578250_1578433_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211422.1|1578707_1579442_+	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001004024.1|1579516_1580239_+	DNA-binding protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_001107963.1|1580238_1580844_+	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_000144759.1|1580840_1581035_+	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_000088311.1|1581353_1581656_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000336726.1|1581691_1582510_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_106875221.1|1582537_1582729_+	Q protein	NA	Q777W5	Enterobacteria_phage	93.7	4.3e-27
WP_000691354.1|1583235_1584183_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1584192_1584462_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000142998.1|1584961_1586899_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	100.0	0.0e+00
WP_000143462.1|1587034_1587214_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290217.1|1587254_1587527_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000284518.1|1587603_1587819_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731236.1|1587823_1588168_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_001092890.1|1588218_1588752_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	100.0	1.6e-103
WP_001056806.1|1589022_1589592_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1589591_1589738_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1589965_1590151_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095749.1|1590575_1590803_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|1590844_1591210_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
1591284:1591300	attL	AAAATTCCTGTTTCAGG	NA	NA	NA	NA
WP_000958402.1|1591499_1592063_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_001341975.1|1592059_1593721_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
WP_000173033.1|1593784_1595722_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.5	0.0e+00
WP_001063025.1|1595766_1595988_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|1598514_1598841_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007892.1|1598851_1599202_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	3.5e-59
WP_000573391.1|1599198_1599645_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1599641_1599986_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275459.1|1600051_1600768_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	9.5e-128
WP_001030060.1|1600773_1601148_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001513217.1|1601243_1601453_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212983.1|1601500_1604743_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.6	0.0e+00
WP_000807940.1|1604735_1605077_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001429308.1|1605784_1606528_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_122993493.1|1606473_1607106_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	7.1e-103
WP_001216290.1|1610895_1611519_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_044723507.1|1611584_1612898_+|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	98.2	2.8e-77
WP_001023435.1|1612899_1613169_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	2.4e-44
WP_001131642.1|1613282_1613858_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001118085.1|1614148_1614730_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_012816780.1|1614797_1615433_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001299273.1|1615560_1616619_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144080.1|1616693_1617344_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132165.1|1617526_1618117_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_000799399.1|1618390_1619254_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|1619237_1620374_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359438.1|1620623_1621853_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1621998_1623120_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085258.1|1623368_1624598_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	8.4e-132
WP_000953272.1|1624963_1625152_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_012816761.1|1625209_1626238_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000336167.1|1626227_1626692_+	hypothetical protein	NA	NA	NA	NA	NA
1626482:1626498	attR	CCTGAAACAGGAATTTT	NA	NA	NA	NA
WP_001204981.1|1626684_1626918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770175.1|1626923_1627223_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833619.1|1627219_1628620_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	1.2e-115
WP_000192401.1|1628820_1629072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126687.1|1629068_1629479_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|1629489_1629762_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1629888_1630113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796958.1|1630364_1630571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907455.1|1630570_1631626_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.7	3.5e-70
WP_000380886.1|1631638_1631974_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224599.1|1631986_1632400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001432354.1|1632604_1633147_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	5.1e-33
WP_000133424.1|1633402_1633684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735412.1|1634285_1635746_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1635745_1636417_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1636584_1637955_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|1637958_1638600_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1638635_1639742_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	1743826	1792226	5648177	protease,transposase,holin,integrase,tail	Escherichia_phage(29.17%)	53	1743663:1743690	1778421:1778448
1743663:1743690	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|1743826_1744957_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1744934_1745183_-	excisionase	NA	NA	NA	NA	NA
WP_000199480.1|1747813_1748002_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|1747998_1748187_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001342117.1|1748586_1748754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|1748747_1748981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1748958_1749366_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1749388_1749607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1749679_1749979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1750243_1750651_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1750727_1750955_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705622.1|1750938_1751490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|1751461_1752502_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|1752413_1752956_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_001505071.1|1753719_1753884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1754582_1755341_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|1755619_1755832_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|1756052_1756310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1756379_1756658_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001265290.1|1756659_1757715_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	4.9e-88
WP_000140002.1|1757715_1758081_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|1758077_1758767_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000023141.1|1760291_1762145_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
WP_000284522.1|1762294_1762510_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|1762514_1762859_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992088.1|1762909_1763443_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_001056807.1|1763713_1764232_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	1.0e-94
WP_000088311.1|1764288_1764591_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000336726.1|1764626_1765445_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_001023357.1|1765547_1765817_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_106409364.1|1769762_1769885_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|1769991_1770903_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|1770968_1771538_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_001303943.1|1772705_1772984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1773411_1773558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|1773694_1774342_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|1774525_1775116_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_000147167.1|1777878_1778097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079509.1|1778598_1779105_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1778421:1778448	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|1779150_1779651_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1779736_1779916_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|1780296_1781103_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|1781102_1782296_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001342102.1|1782307_1783666_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	1.5e-36
WP_000763511.1|1783669_1785265_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194584.1|1785264_1786827_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1786918_1786963_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1787100_1787982_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001342101.1|1787978_1788599_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|1788699_1789572_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|1789611_1790202_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559253.1|1790198_1790957_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	2.2e-05
WP_000422045.1|1791176_1792226_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
NZ_CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	1868767	1924958	5648177	lysis,transposase,portal,holin,tRNA,terminase,integrase,capsid,tail,head	Escherichia_phage(44.62%)	67	1868401:1868416	1883888:1883903
1868401:1868416	attL	TGCTGGATAAGCTGCG	NA	NA	NA	NA
WP_000628065.1|1868767_1870000_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1870254_1871238_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|1871715_1873089_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|1873217_1874153_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040851.1|1874204_1875440_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	3.0e-238
WP_000079604.1|1875441_1875657_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|1875756_1875945_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|1875982_1876132_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|1876187_1876997_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105151.1|1876989_1879590_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.2	2.6e-247
WP_000632297.1|1879691_1879967_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1880041_1880212_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|1880211_1880433_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001427316.1|1880853_1881006_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_000233320.1|1881304_1881724_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072343.1|1881803_1882058_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693802.1|1882054_1882477_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
WP_001432368.1|1882540_1883020_+	YdaU family protein	NA	A0A0U2RT81	Escherichia_phage	82.4	3.2e-63
WP_085947969.1|1883022_1884236_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
1883888:1883903	attR	CGCAGCTTATCCAGCA	NA	NA	NA	NA
WP_000788968.1|1884666_1885413_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_000450672.1|1885435_1886197_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	89.7	3.8e-119
WP_001151124.1|1886212_1886635_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.0e-64
WP_001266134.1|1886631_1886928_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001209480.1|1886924_1887386_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|1887363_1887720_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|1887770_1887983_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000224233.1|1888234_1888498_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|1888508_1889378_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|1889493_1889598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018421.1|1889787_1890000_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001265080.1|1890446_1891496_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	3.4e-110
WP_001217413.1|1891508_1891883_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_000762928.1|1891879_1892701_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000143049.1|1893870_1895721_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000411802.1|1896168_1896375_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|1896374_1896872_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092325.1|1896868_1897306_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000881326.1|1897455_1898073_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001307652.1|1898260_1898455_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|1898843_1899389_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027379.1|1899363_1901289_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|1901285_1901492_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001415980.1|1901488_1903090_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.3e-307
WP_000123251.1|1903070_1904390_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001365129.1|1904399_1904732_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|1904787_1905813_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|1905854_1906250_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|1906261_1906615_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975098.1|1906626_1907205_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
WP_000683137.1|1907201_1907597_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235067.1|1907604_1908357_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479086.1|1908370_1908802_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533431.1|1908828_1909242_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000082321.1|1909222_1911802_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.2	0.0e+00
WP_000847304.1|1911798_1912128_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001443841.1|1912127_1912826_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	97.4	4.4e-130
WP_000194707.1|1912836_1913580_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.2	1.2e-149
WP_141079530.1|1913525_1914158_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	90.9	4.2e-95
WP_000515144.1|1914403_1917880_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_001233130.1|1917947_1918547_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	97.5	1.8e-108
WP_000268927.1|1918611_1919925_+|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.3	2.8e-77
WP_001023379.1|1919926_1920196_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_001131657.1|1920308_1920884_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	1.8e-89
WP_001443810.1|1920956_1921586_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|1921667_1922309_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|1923249_1923684_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837943.1|1923824_1924958_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	4.1e-117
>prophage 7
NZ_CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	2126318	2226097	5648177	lysis,protease,transposase,portal,holin,head,terminase,integrase,capsid,tail	Enterobacteria_phage(46.32%)	126	2175579:2175598	2223161:2223180
WP_120795384.1|2126318_2126432_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2126500_2126734_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086514.1|2127050_2127641_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000885616.1|2127738_2128314_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001448491.1|2128313_2131274_-	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	54.1	4.0e-55
WP_001233114.1|2131338_2131938_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	2.5e-105
WP_000515505.1|2132008_2135422_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_000741589.1|2135482_2136130_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_000140707.1|2136027_2136771_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.9	1.8e-145
WP_001152371.1|2136775_2137474_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	1.9e-133
WP_000447251.1|2137483_2137813_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.0e-60
WP_000372024.1|2137812_2140878_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|2140849_2141179_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001341514.1|2141187_2141574_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_000211132.1|2141634_2142378_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001079398.1|2142388_2142790_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677128.1|2142786_2143365_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	98.4	3.0e-100
WP_001283148.1|2143376_2143652_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
WP_001097041.1|2143644_2143968_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	98.1	5.5e-51
WP_001136588.1|2144054_2146082_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_000985929.1|2146026_2147535_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	4.5e-289
WP_001072975.1|2147534_2147747_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000507036.1|2147743_2149843_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.6	0.0e+00
WP_000421825.1|2149851_2150391_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001031435.1|2150951_2151158_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	3.9e-26
WP_000035577.1|2151458_2151869_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001019606.1|2152020_2152194_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2152365_2152521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122134696.1|2152600_2152666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|2152668_2152857_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2152867_2153080_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2153442_2153940_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2153936_2154470_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189915.1|2154466_2154778_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2154782_2154998_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066483.1|2155751_2155967_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	4.5e-25
WP_106875218.1|2156267_2156480_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2156534_2156624_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047133.1|2156901_2157654_-	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	1.3e-130
WP_001265198.1|2157667_2158717_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|2158718_2158997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2159063_2159315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2159531_2159687_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2159758_2160046_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2160045_2160285_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2160309_2160615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317460.1|2160817_2161150_+	protein flxA	NA	NA	NA	NA	NA
WP_000589012.1|2161586_2162927_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001151195.1|2162960_2163380_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.3e-55
WP_000054507.1|2163420_2164386_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.3	6.5e-55
WP_000705349.1|2164366_2164888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|2164871_2165099_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|2165176_2165584_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379589.1|2165776_2165932_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000347171.1|2165933_2166509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2166995_2167184_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083280.1|2167180_2167372_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048369.1|2167465_2169937_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000381395.1|2170132_2171704_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2171723_2172071_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2172070_2172748_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000877010.1|2173002_2174067_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	60.1	8.6e-117
WP_000336726.1|2174063_2174882_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088311.1|2174917_2175220_-|transposase	transposase	transposase	NA	NA	NA	NA
2175579:2175598	attL	ATGACTCTTGAAATCCATAA	NA	NA	NA	NA
WP_016241229.1|2175655_2175970_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_122993102.1|2176340_2177354_-	peptidase M85	NA	NA	NA	NA	NA
WP_122988840.1|2177568_2177646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023433.1|2177756_2178026_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	6.4e-45
WP_000279009.1|2178027_2179341_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_001456919.1|2179405_2180029_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	5.1e-69
WP_000515131.1|2180097_2183574_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.9	0.0e+00
WP_133253573.1|2183819_2184452_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	95.2	3.1e-106
WP_000194802.1|2184397_2185141_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	2.4e-150
WP_001357740.1|2185151_2185850_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847298.1|2185849_2186179_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_106875217.1|2186175_2188788_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.1	0.0e+00
WP_000533440.1|2188768_2189182_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|2189208_2189631_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235099.1|2189644_2190397_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.6	3.8e-135
WP_000975020.1|2190795_2191329_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000752969.1|2191343_2191697_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	2.5e-57
WP_000158901.1|2191708_2192104_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	90.2	7.2e-53
WP_000063258.1|2192145_2193171_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001295978.1|2193226_2193559_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2193568_2194888_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2194868_2196470_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2196466_2196673_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|2196669_2198595_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|2198569_2199115_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001431375.1|2199501_2199726_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	5.9e-20
WP_001303878.1|2199807_2200122_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2200649_2200835_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000992045.1|2201386_2201920_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.6	8.1e-100
WP_001041949.1|2202431_2203223_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000411809.1|2203226_2203433_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000023191.1|2203880_2205731_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001299632.1|2206209_2206641_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	98.6	7.8e-69
WP_000498121.1|2206830_2207040_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.5e-20
WP_000735807.1|2207092_2207317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047111.1|2208161_2208914_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	2.6e-136
WP_001375683.1|2208927_2209977_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	4.6e-115
WP_012817785.1|2209978_2210248_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	3.0e-10
WP_001452497.1|2210301_2210529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217944.1|2210752_2211124_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000042395.1|2211116_2211434_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000882662.1|2211536_2211749_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000211993.1|2211963_2212515_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000215512.1|2212866_2213052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450895.1|2213111_2213873_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	63.6	2.4e-73
WP_000790460.1|2213902_2214643_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	4.7e-114
WP_000054520.1|2214649_2215615_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
WP_000705368.1|2215595_2216117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920571.1|2216100_2216331_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000379972.1|2216414_2216822_+	helix-turn-helix domain-containing protein	NA	B1B6L9	Salmonella_phage	58.7	3.1e-14
WP_000380321.1|2216988_2217141_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.9e-06
WP_000394548.1|2217152_2217791_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_032102321.1|2217791_2217974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2218564_2218753_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2218749_2218938_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102117.1|2219030_2221493_+	exonuclease	NA	V5UQJ3	Shigella_phage	47.7	4.0e-125
WP_001368608.1|2221580_2221817_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001206147.1|2221836_2223132_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.2	1.3e-154
WP_072095801.1|2223151_2223262_-	transporter	NA	NA	NA	NA	NA
2223161:2223180	attR	ATGACTCTTGAAATCCATAA	NA	NA	NA	NA
WP_000836079.1|2223319_2224339_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|2224350_2225565_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|2225770_2226097_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
>prophage 8
NZ_CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	2242382	2255555	5648177	protease,portal,terminase,capsid,head	uncultured_Caudovirales_phage(88.89%)	17	NA	NA
WP_001260840.1|2242382_2243204_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000046661.1|2243242_2243572_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000276149.1|2243558_2243924_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000133423.1|2245237_2245519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127891.1|2245532_2247194_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	2.0e-277
WP_000113645.1|2247177_2247534_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001145905.1|2247822_2248263_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000134113.1|2248262_2248559_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020674.1|2248555_2248894_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
WP_000267608.1|2248890_2250102_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
WP_000504055.1|2250103_2250676_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	4.7e-61
WP_001137345.1|2250715_2251873_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_001132080.1|2252164_2252389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233310.1|2252514_2252787_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126691.1|2252797_2253208_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000125509.1|2253204_2253450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000710169.1|2253737_2255555_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	48.3	7.5e-129
>prophage 9
NZ_CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	2377922	2422782	5648177	portal,holin,tRNA,terminase,integrase,plate,capsid,tail,head	Enterobacteria_phage(86.36%)	57	2380325:2380349	2415423:2415447
WP_000029479.1|2377922_2378672_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	1.6e-08
WP_001154187.1|2378671_2379223_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956529.1|2379285_2380266_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2380325:2380349	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_005142454.1|2380458_2380896_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
WP_000403440.1|2380996_2381497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247212.1|2381499_2382438_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	5.1e-81
WP_000021112.1|2382526_2382838_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	49.5	8.3e-20
WP_001151412.1|2382933_2383212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917795.1|2383226_2383565_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	86.2	8.9e-52
WP_044711780.1|2383575_2383863_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	2.3e-32
WP_000514277.1|2383874_2384117_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021668.1|2384113_2384227_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.2e-08
WP_000985159.1|2384313_2384517_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000153690.1|2384513_2384759_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	86.4	1.0e-33
WP_000599382.1|2384900_2385266_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_136748941.1|2385272_2388095_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.2	0.0e+00
WP_000686521.1|2388171_2389131_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.9e-180
WP_000211274.1|2389135_2389447_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	94.2	1.0e-46
WP_001080493.1|2389545_2389953_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	91.7	4.0e-22
WP_000236497.1|2390512_2391037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087814.1|2391051_2392098_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000613766.1|2392097_2393849_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	99.5	0.0e+00
WP_001262673.1|2394003_2394840_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_106875224.1|2394862_2395915_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	98.3	5.4e-196
WP_000632311.1|2395960_2396761_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	1.5e-126
WP_000063100.1|2396862_2397357_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864911.1|2397356_2397557_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
WP_000104350.1|2397559_2397883_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|2397879_2398272_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780572.1|2398268_2398676_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000920603.1|2398813_2399281_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.7	2.9e-85
WP_000356339.1|2399273_2399909_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001271894.1|2399905_2400487_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.0e-100
WP_000213447.1|2400483_2400834_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111942.1|2400837_2401734_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
WP_000071739.1|2401726_2402257_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_106875225.1|2402259_2404392_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.7	4.2e-131
WP_000144023.1|2404391_2404970_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	5.9e-96
WP_000954196.1|2405013_2405586_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979950.1|2405742_2406231_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.1	7.5e-84
WP_000853434.1|2406243_2409051_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.9	0.0e+00
WP_000333503.1|2409037_2409193_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|2409201_2409576_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000290462.1|2409631_2410144_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005384.1|2410143_2411328_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	4.7e-225
WP_106875226.1|2411485_2412595_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	5.7e-204
WP_106875227.1|2412820_2414323_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000488103.1|2414566_2414827_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078923.1|2415017_2415158_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
WP_001229265.1|2415464_2415764_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2415423:2415447	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000672359.1|2415768_2418156_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|2418170_2419154_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|2419437_2419482_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2419604_2419961_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2420013_2420211_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2420307_2420850_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|2420853_2422782_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 10
NZ_CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	2491906	2589153	5648177	lysis,protease,transposase,portal,holin,tRNA,head,terminase,integrase,capsid,tail	Escherichia_phage(30.3%)	111	2531470:2531484	2590600:2590614
WP_000088311.1|2491906_2492209_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000336726.1|2492244_2493063_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000604932.1|2493179_2493611_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	4.8e-42
WP_000513743.1|2493626_2493815_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_000939317.1|2493818_2494178_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457202.1|2494350_2494989_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_001061578.1|2495115_2496039_-	DNA-binding transcriptional regulator DmlR	NA	NA	NA	NA	NA
WP_000978494.1|2496141_2497227_+	multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase	NA	NA	NA	NA	NA
WP_000987525.1|2497477_2499088_+	BCCT family transporter YeaV	NA	NA	NA	NA	NA
WP_032341932.1|2499119_2500244_+	carnitine monooxygenase subunit YeaW	NA	NA	NA	NA	NA
WP_001287005.1|2500299_2501265_+	carnitine monooxygenase subunit YeaX	NA	NA	NA	NA	NA
WP_001342154.1|2501318_2502434_-	ribonuclease D	NA	NA	NA	NA	NA
WP_000758422.1|2502515_2504201_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|2504405_2504987_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001221003.1|2505026_2505722_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|2505779_2507690_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|2507821_2508166_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|2508528_2508888_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|2509007_2509187_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854972.1|2509260_2510622_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000456725.1|2510625_2511204_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624298.1|2511387_2512752_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001295494.1|2512882_2514481_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000394983.1|2514484_2516041_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_000150551.1|2516503_2517475_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406926.1|2517537_2518338_+	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000228655.1|2518350_2519202_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156255.1|2519256_2519715_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001296134.1|2520143_2520710_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010107.1|2520706_2521516_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001062678.1|2521681_2521891_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001295496.1|2521903_2522047_-	YobF family protein	NA	NA	NA	NA	NA
WP_001006866.1|2522715_2523003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|2523077_2523221_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001211011.1|2523379_2523619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262174.1|2523761_2524553_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001127210.1|2524729_2526103_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984517.1|2526148_2527030_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001431407.1|2527221_2529270_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.4e-86
WP_000431370.1|2529289_2529988_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|2530084_2530582_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207284.1|2530711_2531995_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
2531470:2531484	attL	CCCGCTACGCCTGCG	NA	NA	NA	NA
WP_001299674.1|2531963_2534597_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057024.1|2534676_2536116_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|2536233_2536470_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000929530.1|2536490_2536766_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812724.1|2536766_2537423_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_001121225.1|2538377_2539028_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491545.1|2539252_2540128_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
WP_001023379.1|2540268_2540538_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_000268926.1|2540539_2541853_-|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.3	2.8e-77
WP_000099160.1|2542571_2544110_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|2544158_2544506_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839165.1|2544502_2544907_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.5e-69
WP_000514713.1|2545045_2548441_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	83.6	0.0e+00
WP_050439450.1|2548783_2549416_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194723.1|2549361_2550105_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_001357740.1|2550115_2550814_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847298.1|2550813_2551143_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081762.1|2551139_2553752_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	91.9	0.0e+00
WP_000533440.1|2553732_2554146_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|2554172_2554595_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235098.1|2554608_2555361_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000683137.1|2555368_2555764_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000975096.1|2555760_2556339_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000752994.1|2556350_2556704_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|2556715_2557111_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|2557152_2558178_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|2558233_2558566_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123251.1|2558575_2559895_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001443752.1|2559875_2561477_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000198153.1|2561473_2561680_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027379.1|2561676_2563602_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453587.1|2563576_2564122_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001307652.1|2564510_2564705_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881326.1|2564892_2565510_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092325.1|2565659_2566097_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000075132.1|2566093_2566591_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|2566590_2566797_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000143049.1|2567244_2569095_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000762928.1|2570265_2571087_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217413.1|2571083_2571458_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_001265229.1|2571470_2572520_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2572521_2572794_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2572915_2573260_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2573379_2573592_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2573825_2574383_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2574384_2574603_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2574730_2575042_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2575034_2575262_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2575258_2575540_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_001444941.1|2577106_2578069_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.5	2.7e-69
WP_000693943.1|2578091_2578517_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|2578513_2578816_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_001169687.1|2578913_2579285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302048.1|2579305_2579497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001448501.1|2579498_2579777_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001427316.1|2580063_2580216_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_000560218.1|2580636_2580858_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
WP_000245534.1|2580851_2581028_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.7	4.1e-24
WP_001307773.1|2581101_2581377_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	3.0e-42
WP_000105101.1|2581475_2584127_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.6	0.0e+00
WP_000166317.1|2584119_2584929_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_042853000.1|2584985_2585180_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_001356607.1|2585172_2585361_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_001443927.1|2585467_2585749_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001189089.1|2585714_2586830_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.8	4.6e-97
WP_000976492.1|2587182_2587524_-	YebY family protein	NA	NA	NA	NA	NA
WP_032341845.1|2587536_2588406_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|2588409_2588784_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2588922_2589153_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
2590600:2590614	attR	CGCAGGCGTAGCGGG	NA	NA	NA	NA
>prophage 11
NZ_CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	2791739	2797057	5648177	transposase	Stx2-converting_phage(50.0%)	9	NA	NA
WP_000099148.1|2791739_2793278_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.6	3.3e-295
WP_000612626.1|2793326_2793674_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|2793670_2794075_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000378676.1|2794073_2794505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001119729.1|2794583_2794817_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234620.1|2794916_2795735_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_000849582.1|2795789_2796275_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
WP_001186725.1|2796290_2796767_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|2796835_2797057_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 12
NZ_CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	2830693	2836995	5648177		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001100797.1|2830693_2831236_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	1.9e-51
WP_000857547.1|2831240_2832119_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.5e-106
WP_001023633.1|2832176_2833076_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	5.7e-29
WP_000699427.1|2833075_2834161_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	1.4e-101
WP_000183038.1|2834532_2835426_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_001116073.1|2835600_2836995_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	2.2e-19
>prophage 13
NZ_CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	2928437	2938365	5648177	transposase	Enterobacteria_phage(62.5%)	9	NA	NA
WP_001292774.1|2928437_2929574_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001342301.1|2929570_2931571_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001171523.1|2931902_2932283_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2932279_2932627_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998019.1|2932676_2934062_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000950404.1|2934493_2934964_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_000598641.1|2935010_2935730_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2935726_2937412_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2937633_2938365_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
>prophage 14
NZ_CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	3009192	3111372	5648177	lysis,protease,transposase,holin,head,terminase,integrase,tail	Enterobacteria_phage(35.44%)	114	3046338:3046356	3120588:3120606
WP_000101718.1|3009192_3010434_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.2e-98
WP_000387479.1|3010930_3011137_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001443784.1|3011820_3012381_+	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	45.5	9.0e-17
WP_001342316.1|3012370_3012613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204070.1|3012585_3012807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204970.1|3012808_3013042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|3013047_3013347_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833625.1|3013343_3014744_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
WP_001080641.1|3014943_3015189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391151.1|3015319_3015514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018604.1|3015517_3015679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229487.1|3015806_3016295_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	4.6e-25
WP_000624042.1|3016457_3017381_+	hypothetical protein	NA	A0A0R6PHC6	Moraxella_phage	24.9	6.9e-14
WP_001113637.1|3020757_3021405_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001211567.1|3021439_3022492_-	cytochrome c-type biogenesis thiol:disulfide oxidoreductase CcmH	NA	NA	NA	NA	NA
WP_000824439.1|3022488_3023046_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_032344719.1|3023042_3024986_-	cytochrome c-type biogenesis heme lyase CcmF	NA	NA	NA	NA	NA
WP_001026418.1|3024982_3025462_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000186540.1|3025458_3025668_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001295447.1|3025664_3026402_-	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000971723.1|3026443_3027106_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000888560.1|3027102_3027720_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000528376.1|3027738_3028341_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000835177.1|3028350_3028800_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000013509.1|3028796_3029660_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091291.1|3029646_3030342_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000778069.1|3030348_3032835_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000557378.1|3032831_3033095_-	chaperone NapD	NA	NA	NA	NA	NA
WP_000686723.1|3033084_3033579_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000849214.1|3033987_3034476_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000758074.1|3034624_3036271_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000422231.1|3036488_3038132_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|3038207_3038858_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786386.1|3038857_3039922_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|3039995_3041051_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|3041162_3042254_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_001249127.1|3042992_3045665_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061917.1|3045681_3046332_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
3046338:3046356	attL	TGTAGGCCAGATAAGACGC	NA	NA	NA	NA
WP_000876007.1|3046417_3049267_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.0	1.7e-42
WP_001225855.1|3049541_3050318_-	YfaP family protein	NA	NA	NA	NA	NA
WP_001104541.1|3050322_3051972_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_001676637.1|3051972_3056367_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001025664.1|3057168_3058491_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.7	2.5e-227
WP_001448330.1|3059184_3059832_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.3	2.4e-37
WP_001023380.1|3060041_3060311_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	7.3e-41
WP_000279018.1|3060312_3061626_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	2.8e-77
WP_001228241.1|3061690_3062290_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_001230644.1|3062357_3062573_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	95.8	2.9e-32
WP_000099160.1|3062635_3064174_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|3064222_3064570_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839165.1|3064566_3064971_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.5e-69
WP_001375477.1|3064999_3068299_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	95.2	0.0e+00
WP_000090884.1|3068359_3068992_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_012817801.1|3068928_3069672_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	5.2e-145
WP_001152619.1|3069677_3070376_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000847413.1|3070375_3070705_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
WP_000082375.1|3070701_3073263_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.0	0.0e+00
WP_000533403.1|3073243_3073657_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479086.1|3073683_3074115_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000683071.1|3074887_3075283_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_000975037.1|3075279_3075855_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_001204544.1|3075869_3076223_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201528.1|3076215_3076590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522643.1|3076641_3077526_-	hypothetical protein	NA	C6ZCY2	Enterobacteria_phage	54.1	6.5e-94
WP_000256849.1|3077583_3077931_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
WP_001254039.1|3077967_3079473_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000258991.1|3081050_3081257_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_001238637.1|3081240_3081447_-|terminase	terminase	terminase	A0A2I6TC92	Escherichia_phage	59.4	1.1e-12
WP_024262528.1|3081459_3083169_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.3	4.9e-239
WP_000235436.1|3083140_3083650_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001427981.1|3084044_3084239_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000738423.1|3084598_3084892_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|3084982_3085165_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000075153.1|3085381_3085879_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	96.4	1.6e-89
WP_000284524.1|3085878_3086094_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3086236_3086635_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3086715_3086874_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001235460.1|3087954_3088578_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001028854.1|3088574_3089240_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223927.1|3089236_3089839_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001108084.1|3089813_3090380_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001429269.1|3090909_3092745_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
WP_001254228.1|3093248_3093431_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_000153270.1|3093427_3093955_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_000810176.1|3093951_3094398_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000229807.1|3094405_3094612_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	97.1	1.8e-26
WP_000145926.1|3094684_3094975_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788878.1|3094971_3095673_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_000185462.1|3095669_3096608_-	replication protein	NA	C1JJ53	Enterobacteria_phage	99.4	1.1e-171
WP_000035947.1|3096640_3096937_-	hypothetical protein	NA	A0A0N7C1W0	Escherichia_phage	96.9	1.3e-46
WP_000276885.1|3097046_3097232_-	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_001095982.1|3097312_3097963_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_000256573.1|3098277_3098583_+	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
WP_000930321.1|3098585_3098924_+	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
WP_000167595.1|3099057_3099528_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065385.1|3099677_3100046_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
WP_001198860.1|3100118_3100283_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372926.1|3100251_3100416_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.1	3.2e-23
WP_000995439.1|3100470_3100767_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3100772_3101558_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|3101554_3102232_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|3102231_3102414_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|3102386_3102578_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|3102588_3102870_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763358.1|3102968_3103190_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_001289868.1|3103186_3103792_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	96.9	1.7e-45
WP_001345188.1|3103788_3104139_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	80.2	3.3e-33
WP_000457736.1|3104213_3104456_+	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	96.2	3.7e-36
WP_001281192.1|3104574_3104919_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001444001.1|3105024_3105243_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_000533670.1|3105220_3106291_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001215756.1|3106305_3106911_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000012302.1|3106907_3108596_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001281242.1|3108744_3111372_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
3120588:3120606	attR	GCGTCTTATCTGGCCTACA	NA	NA	NA	NA
>prophage 15
NZ_CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	3200045	3273559	5648177	lysis,transposase,portal,holin,tRNA,terminase,integrase,capsid,head	Enterobacteria_phage(50.0%)	90	3225898:3225913	3246058:3246073
WP_001283577.1|3200045_3200858_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|3200857_3201871_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|3201936_3203073_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615813.1|3203171_3204167_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127749.1|3204163_3205342_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|3205625_3206846_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683823.1|3207004_3209011_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|3209131_3209410_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089232.1|3209443_3209992_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447359.1|3209991_3210801_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_032341809.1|3210800_3211625_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|3211628_3212714_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|3212748_3213681_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|3213846_3214398_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001315753.1|3214470_3215322_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000844750.1|3215323_3215863_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000714139.1|3215859_3216348_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000018471.1|3216344_3216854_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000482751.1|3216869_3217622_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001375769.1|3217641_3220287_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|3220368_3220932_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|3221615_3222101_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426169.1|3222303_3224448_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|3224447_3225758_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
3225898:3225913	attL	CCTGCCAGCAACTGAC	NA	NA	NA	NA
WP_001296869.1|3225937_3226222_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|3226593_3227934_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937833.1|3228298_3229357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|3229538_3230294_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|3230587_3231520_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958687.1|3231831_3232989_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	1.1e-221
WP_000440209.1|3233233_3234376_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.9	9.2e-24
WP_001280420.1|3234446_3236570_-	hypothetical protein	NA	A0A2D1GLP5	Escherichia_phage	36.7	2.5e-59
WP_000287055.1|3236691_3236958_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	90.5	9.5e-33
WP_000749290.1|3237028_3237514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868968.1|3237528_3239373_-	hypothetical protein	NA	A0A192Y934	Salmonella_phage	72.1	4.0e-239
WP_000246938.1|3239372_3240779_-	phage DNA ejection protein	NA	I6RSG0	Salmonella_phage	55.8	1.1e-127
WP_000964882.1|3240788_3241481_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000614047.1|3241483_3241939_-	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.0	3.3e-86
WP_000785546.1|3241938_3242787_-	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	97.9	1.5e-100
WP_001122374.1|3242786_3244205_-	Packaged DNA stabilization protein gp10	NA	Q716G7	Shigella_phage	99.2	2.3e-274
WP_000246750.1|3244213_3244696_-	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
WP_000375639.1|3244670_3244856_-	hypothetical protein	NA	Q716G9	Shigella_phage	98.4	4.6e-26
WP_001133481.1|3244898_3246170_-|head	head protein	head	Q716H0	Shigella_phage	99.8	6.6e-241
3246058:3246073	attR	CCTGCCAGCAACTGAC	NA	NA	NA	NA
WP_032341807.1|3246181_3247066_-|capsid	phage capsid scaffolding protein	capsid	Q716H1	Shigella_phage	98.3	9.9e-143
WP_000852339.1|3247079_3249206_-|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.3	0.0e+00
WP_000200776.1|3249208_3250621_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.6	2.2e-277
WP_000179910.1|3250617_3251043_-	hypothetical protein	NA	Q716H4	Shigella_phage	87.9	1.8e-65
WP_000807788.1|3251122_3251365_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000999682.1|3251468_3251840_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	88.6	3.2e-55
WP_085947969.1|3252229_3253443_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
WP_106875231.1|3253448_3253955_-	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	100.0	1.1e-82
WP_000092296.1|3254160_3254598_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	97.2	1.1e-70
WP_000229392.1|3254594_3255071_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_000783734.1|3255054_3255378_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_032344729.1|3256450_3257074_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.5	2.0e-113
WP_001271146.1|3257070_3257736_-	serine/threonine protein phosphatase	NA	K7P721	Enterobacteria_phage	97.7	1.6e-129
WP_000144614.1|3257713_3257920_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001107956.1|3257916_3258522_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	98.0	5.6e-97
WP_072189684.1|3258514_3258724_-	protein ninF	NA	G9L691	Escherichia_phage	95.6	2.2e-29
WP_000924601.1|3258683_3259085_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001254255.1|3259087_3259264_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000814611.1|3259260_3259671_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_000344573.1|3259642_3259999_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_000103674.1|3260464_3260680_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	98.6	2.2e-32
WP_001248395.1|3260766_3262143_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.1	5.3e-252
WP_000539347.1|3262139_3262961_-	replication protein	NA	K7PJZ3	Enterobacterial_phage	99.3	1.7e-152
WP_001375758.1|3263144_3263423_-	transcriptional regulator	NA	K7P7A2	Enterobacteria_phage	96.7	1.5e-41
WP_001054987.1|3263532_3263757_-	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	86.3	1.4e-29
WP_000092874.1|3263901_3264576_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	83.9	1.2e-103
WP_000394868.1|3264616_3264913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012817806.1|3265346_3265619_+	hypothetical protein	NA	K7PH69	Enterobacterial_phage	98.9	1.0e-26
WP_001430488.1|3265621_3265984_+	hypothetical protein	NA	K7P6R2	Enterobacteria_phage	100.0	6.2e-59
WP_000382838.1|3266014_3266509_-	hypothetical protein	NA	K7PK22	Enterobacteria_phage	99.4	1.6e-89
WP_000167585.1|3266709_3267180_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.1e-87
WP_000776959.1|3267323_3267635_+	superinfection exclusion protein	NA	O48416	Enterobacteria_phage	99.0	9.3e-56
WP_000972063.1|3267710_3267845_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_001243355.1|3267829_3267982_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000050554.1|3268057_3268228_+	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_000031004.1|3268238_3268844_+	ERF family protein	NA	O48415	Enterobacteria_phage	100.0	2.4e-108
WP_000951323.1|3268843_3269227_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	99.2	8.5e-67
WP_001111303.1|3269250_3269544_+	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	100.0	5.0e-51
WP_000812180.1|3269715_3270303_+	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	97.5	5.0e-58
WP_000052365.1|3270299_3270968_+	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	79.7	9.3e-69
WP_000060377.1|3270969_3271158_+	hypothetical protein	NA	Q9G079	Enterobacteria_phage	100.0	1.7e-28
WP_001375782.1|3271161_3271779_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	100.0	3.7e-112
WP_000156090.1|3271775_3272363_+	DUF551 domain-containing protein	NA	Q9G077	Enterobacteria_phage	100.0	7.5e-115
WP_000376716.1|3272362_3272641_+	DUF4752 family protein	NA	K7P6P7	Enterobacteria_phage	98.9	5.4e-47
WP_001368678.1|3272798_3273098_+	hypothetical protein	NA	Q9G076	Enterobacteria_phage	100.0	2.4e-53
WP_000545713.1|3273133_3273301_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.2e-25
WP_001163428.1|3273358_3273559_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
>prophage 16
NZ_CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	3528273	3633146	5648177	transposase,holin,tRNA,terminase,integrase,capsid,tail,head	Stx2-converting_phage(27.69%)	101	3609630:3609645	3639898:3639913
WP_001298974.1|3528273_3529011_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|3529142_3530477_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001341633.1|3530685_3531567_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|3531669_3532257_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3532312_3532696_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|3533000_3533690_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|3533737_3534775_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3534981_3535401_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001341635.1|3535469_3536168_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000083007.1|3536199_3538860_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3538973_3540329_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000464877.1|3540353_3540698_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|3540694_3541993_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|3547846_3550420_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_032344751.1|3550549_3551281_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079094.1|3551277_3552258_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3552392_3553130_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3553400_3553742_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3553845_3553893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|3553991_3555152_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|3555194_3556316_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|3556326_3557397_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000976004.1|3557606_3557972_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3558121_3558640_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969036.1|3558629_3559856_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|3559871_3560354_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3560430_3560778_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3560819_3561587_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3561617_3562166_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3562184_3562433_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460032.1|3562681_3564043_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001189257.1|3564134_3565001_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|3565021_3566308_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3566362_3566956_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|3567078_3567957_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|3568042_3569704_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_032344749.1|3569852_3570194_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3570255_3570546_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3570535_3571012_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3571143_3571626_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000938109.1|3573380_3574742_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	1.2e-51
WP_001370486.1|3575118_3578520_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.3e-219
WP_001301673.1|3579111_3581460_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3581479_3581569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023420.1|3581675_3581945_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_000268987.1|3581946_3583260_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
WP_001427270.1|3583324_3583924_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.7e-109
WP_000514836.1|3583991_3587465_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.4	0.0e+00
WP_122996338.1|3587703_3588336_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.1	4.9e-104
WP_001341641.1|3589034_3589733_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	97.4	7.6e-130
WP_000807927.1|3589732_3590074_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_106875234.1|3590066_3593309_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.8	0.0e+00
WP_001513217.1|3593356_3593566_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030067.1|3593661_3594036_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	1.7e-64
WP_001275471.1|3594041_3594758_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_000133388.1|3594823_3595168_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3595164_3595611_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3595607_3595958_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|3595968_3596295_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|3598821_3599043_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173032.1|3599087_3601025_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.5	0.0e+00
WP_001341975.1|3601088_3602750_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
WP_000958402.1|3602746_3603310_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_001375434.1|3603601_3603967_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.3e-66
WP_032321890.1|3604008_3604233_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	7.8e-20
WP_001303878.1|3604314_3604629_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208681.1|3605156_3605342_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_000075132.1|3605558_3606056_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|3606055_3606262_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000874350.1|3606709_3608560_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_001339373.1|3609377_3609530_-	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
3609630:3609645	attL	TTTTTAAGATTTTGTT	NA	NA	NA	NA
WP_001047129.1|3609839_3610592_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	7.6e-136
WP_001428967.1|3610605_3611595_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	1.2e-192
WP_001061413.1|3611602_3612400_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
WP_000767136.1|3612419_3612809_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	1.6e-68
WP_000210170.1|3612805_3613132_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001341555.1|3613128_3613782_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_001447903.1|3613781_3614276_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.3	1.3e-83
WP_000061518.1|3614272_3615091_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.3	1.1e-122
WP_000620696.1|3615087_3615312_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_001087342.1|3615308_3616460_-	peptidase	NA	K7PLX4	Enterobacteria_phage	96.3	6.9e-205
WP_000521508.1|3616456_3617008_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_000649477.1|3617051_3617252_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859462.1|3617342_3618017_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000135680.1|3618683_3619046_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081319.1|3619111_3619936_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	5.0e-149
WP_000008174.1|3620064_3620601_+	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
WP_000335005.1|3620591_3621470_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	94.9	1.9e-170
WP_000158004.1|3621466_3621670_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
WP_000476199.1|3621662_3621902_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	3.7e-36
WP_000034210.1|3621898_3622228_+	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	37.5	1.1e-25
WP_000206753.1|3622229_3623093_+	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	53.6	3.2e-69
WP_000457722.1|3623177_3623420_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	82.5	1.8e-30
WP_000557643.1|3623423_3623570_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	90.9	1.7e-20
WP_000516611.1|3623742_3624918_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	91.2	4.6e-204
WP_001431537.1|3625400_3626309_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	100.0	2.3e-171
WP_001341819.1|3626607_3627837_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|3627875_3628292_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214985.1|3628363_3630112_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	100.0	0.0e+00
WP_000577251.1|3630113_3631832_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	100.0	6.5e-308
WP_000169527.1|3632846_3633146_-|transposase	transposase	transposase	NA	NA	NA	NA
3639898:3639913	attR	TTTTTAAGATTTTGTT	NA	NA	NA	NA
>prophage 17
NZ_CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	3704623	3711763	5648177		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|3704623_3707185_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141347.1|3707290_3707947_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001272549.1|3707997_3708795_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_000847985.1|3708960_3709869_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|3709865_3711128_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3711124_3711763_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 18
NZ_CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	3863817	3871766	5648177	integrase,transposase	Stx2-converting_phage(42.86%)	7	3861774:3861790	3870859:3870875
3861774:3861790	attL	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
WP_000381395.1|3863817_3865389_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|3865408_3865756_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|3865755_3866433_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000082600.1|3866827_3867556_-	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	41.2	7.1e-14
WP_000852869.1|3868464_3869124_-	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	33.9	3.6e-33
WP_000935135.1|3869116_3870724_-|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	28.0	4.3e-11
WP_001272558.1|3871010_3871766_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
3870859:3870875	attR	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
>prophage 19
NZ_CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	4920371	4933704	5648177	integrase,transposase	Enterobacteria_phage(66.67%)	15	4919865:4919887	4933865:4933887
4919865:4919887	attL	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
WP_000783645.1|4920371_4922705_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
WP_000856729.1|4922719_4923040_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001339397.1|4923195_4923873_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4923872_4924220_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|4924239_4925811_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000459320.1|4925886_4926342_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	6.1e-64
WP_001244665.1|4926334_4926622_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000980227.1|4926614_4927214_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
WP_001149160.1|4927210_4927477_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283024.1|4928028_4928763_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.0	5.7e-128
WP_000638629.1|4928759_4929260_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446132.1|4929333_4929906_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000186475.1|4930233_4930659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119815.1|4930655_4932515_-	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
WP_001218979.1|4932534_4933704_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.1	1.7e-198
4933865:4933887	attR	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
>prophage 20
NZ_CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	5350068	5397991	5648177	integrase,tRNA,transposase,protease	Vibrio_phage(20.0%)	45	5331039:5331053	5357385:5357399
5331039:5331053	attL	TATGGATGATGAGAC	NA	NA	NA	NA
WP_001375513.1|5350068_5351688_+|transposase	ISL3-like element ISEc38 family transposase	transposase	NA	NA	NA	NA
WP_000704132.1|5351684_5353256_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.6	5.8e-295
WP_001218841.1|5353372_5354638_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_001188520.1|5355017_5355593_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068905.1|5355629_5357327_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883338.1|5357302_5357641_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
5357385:5357399	attR	TATGGATGATGAGAC	NA	NA	NA	NA
WP_000961959.1|5357756_5359058_-	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000069437.1|5359175_5360612_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|5360948_5361425_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015837.1|5361440_5362697_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|5362972_5363266_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|5363309_5364956_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|5365093_5365447_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000399685.1|5365699_5366680_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001008073.1|5366928_5367798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940530.1|5368187_5369216_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|5369257_5369824_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|5369875_5370001_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|5370111_5370258_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|5370439_5370757_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238378.1|5370753_5371287_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001299193.1|5371375_5372509_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001299198.1|5372571_5372931_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|5372941_5373337_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|5373347_5374082_-	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_001192991.1|5374074_5375883_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|5376207_5377185_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001346081.1|5377403_5378906_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000342867.1|5378957_5379272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276180.1|5379268_5379583_+	YjeO family protein	NA	NA	NA	NA	NA
WP_001236850.1|5379611_5382935_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934920.1|5382956_5383925_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041970.1|5384021_5385074_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|5385168_5385714_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_100699686.1|5386577_5386631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294203.1|5386613_5387753_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001307537.1|5387751_5389299_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|5389270_5389732_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990321.1|5389750_5391088_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122519.1|5391097_5392945_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_001280349.1|5392937_5393888_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|5393973_5394282_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460361.1|5394358_5395639_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|5395724_5396984_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|5396986_5397991_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 21
NZ_CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	5409703	5470142	5648177	transposase,protease	Stx2-converting_phage(25.0%)	57	NA	NA
WP_000811566.1|5409703_5409979_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254642.1|5410127_5410457_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569731.1|5410638_5411388_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|5411384_5412140_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|5412247_5413312_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001341647.1|5413666_5415064_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218360.1|5415079_5415385_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000056760.1|5415872_5416523_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|5416532_5417387_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|5417386_5418073_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|5418201_5418477_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|5418803_5419199_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|5419205_5419520_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|5419524_5419752_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|5419793_5420243_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001341645.1|5420313_5421108_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_072097616.1|5421547_5422162_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	1.8e-42
WP_000440544.1|5422169_5423378_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	6.4e-209
WP_001119478.1|5423512_5424151_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|5424369_5424990_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228344.1|5425298_5426702_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_001062220.1|5426968_5427403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001345317.1|5427501_5428569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000331456.1|5428815_5429478_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001296686.1|5429585_5430551_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560553.1|5430658_5431519_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|5431607_5431988_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589460.1|5432116_5434060_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886909.1|5434249_5434990_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000175289.1|5434979_5435537_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|5435861_5436068_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|5436129_5437473_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001295196.1|5437795_5438434_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|5438639_5440373_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060926.1|5440369_5444149_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|5444151_5444493_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223208.1|5444704_5444956_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|5444949_5445300_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|5445379_5445910_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265933.1|5446219_5447176_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205813.1|5447315_5448818_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001296689.1|5448831_5449854_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|5449840_5450836_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|5450868_5451867_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219792.1|5452042_5453416_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166267.1|5453503_5454055_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|5454148_5455501_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000099148.1|5455805_5457344_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.6	3.3e-295
WP_000612626.1|5457392_5457740_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|5457736_5458141_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001106238.1|5458576_5459041_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000187778.1|5459199_5461338_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001341327.1|5461731_5463387_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001181312.1|5464911_5465859_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|5466043_5466097_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471889.1|5466237_5468934_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000399685.1|5469161_5470142_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	5480591	5526961	5648177	integrase,tRNA,transposase	Stx2-converting_phage(28.57%)	41	5477949:5477964	5515664:5515679
5477949:5477964	attL	TGCAGCAGGCTGTTGA	NA	NA	NA	NA
WP_000416407.1|5480591_5483447_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786398.1|5483446_5483890_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|5484244_5485756_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584109.1|5486022_5487123_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|5487122_5488205_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001332879.1|5488323_5489826_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_000061768.1|5489955_5490975_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
WP_000772685.1|5491418_5492681_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	2.8e-74
WP_000356577.1|5492924_5493764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032344740.1|5493902_5495489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|5495778_5496456_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|5496455_5496803_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|5496822_5498394_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001185332.1|5498703_5498976_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	46.9	8.3e-08
WP_000991130.1|5498977_5499532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214377.1|5499528_5500281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001084853.1|5501195_5501456_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	67.5	4.6e-24
WP_000761643.1|5501452_5502001_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.8	5.9e-29
WP_001014979.1|5502000_5502225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000842358.1|5502221_5502545_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_000016235.1|5502559_5504893_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.8	0.0e+00
WP_000594911.1|5505798_5506623_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_000916596.1|5506671_5507052_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	60.8	1.1e-37
WP_000336726.1|5507185_5508004_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088311.1|5508039_5508342_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000177060.1|5509864_5510122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|5510679_5511447_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|5511447_5512404_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125190.1|5512400_5513399_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879164.1|5513395_5514298_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188267.1|5514342_5516667_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
5515664:5515679	attR	TGCAGCAGGCTGTTGA	NA	NA	NA	NA
WP_001068910.1|5516753_5517707_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|5517703_5518225_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555341.1|5519975_5520233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823243.1|5520965_5522324_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000998019.1|5522562_5523948_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|5523997_5524345_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|5524341_5524722_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001221615.1|5525076_5525511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088311.1|5525804_5526107_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000336726.1|5526142_5526961_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
>prophage 1
NZ_CP028115	Escherichia coli O26 str. RM8426 plasmid pRM8426, complete sequence	90123	8065	82357	90123	integrase,protease,transposase	Stx2-converting_phage(44.44%)	65	NA	NA
WP_001164205.1|8065_8848_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_000465041.1|8849_9263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261287.1|9822_10053_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044768.1|10049_10466_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001165114.1|10627_11173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088311.1|11240_11543_+|transposase	transposase	transposase	Q716C1	Shigella_phage	31.3	1.1e-05
WP_000336726.1|11578_12397_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000704534.1|13201_14062_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
WP_001066949.1|14189_14576_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001341423.1|14629_15304_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|15300_15648_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_012917687.1|15651_17220_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000154135.1|17879_18545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335839.1|18685_19327_-	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_000907857.1|20035_21067_+	replication initiation protein	NA	NA	NA	NA	NA
WP_000581688.1|22026_31527_-	toxin B	NA	NA	NA	NA	NA
WP_001443774.1|31641_31872_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000422675.1|34998_35475_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.7	3.0e-45
WP_000937603.1|39454_40642_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|40641_41007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012917687.1|41830_43399_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000631725.1|43402_43750_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|43746_44421_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001341442.1|44474_44702_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	6.2e-33
WP_000361610.1|44864_45842_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_085953785.1|46647_47860_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	2.5e-168
WP_086163899.1|47826_47925_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.5e-07
WP_101981703.1|48033_48246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000387727.1|48233_50243_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|50286_50676_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_000445934.1|51636_52032_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000921957.1|52031_52991_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.9	5.4e-62
WP_077249722.1|53263_54166_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_012680995.1|54162_54474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086167.1|54549_55233_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.3e-28
WP_001443814.1|55232_55451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274418.1|55462_55897_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001341455.1|55941_56424_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276261.1|56420_57140_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_032313270.1|57416_57734_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.8	4.5e-05
WP_000117628.1|58195_58696_+	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_162137195.1|58697_59318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218854.1|59423_59858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247865.1|59950_60217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038351.1|60281_61172_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	4.4e-66
WP_077776889.1|61195_61417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148286.1|61447_61699_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001341408.1|62277_63126_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000157095.1|63211_63547_-	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
WP_001291056.1|63778_64111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991399.1|64122_66843_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_001341409.1|67063_67384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088311.1|67422_67725_+|transposase	transposase	transposase	Q716C1	Shigella_phage	31.3	1.1e-05
WP_106875247.1|68151_69365_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.0	4.6e-167
WP_136138333.1|69363_69777_+	DUF1449 family protein	NA	NA	NA	NA	NA
WP_000114001.1|70075_70333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001034100.1|70580_74483_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_136139077.1|75420_75840_-	DUF1449 family protein	NA	NA	NA	NA	NA
WP_001341423.1|75770_76445_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|76441_76789_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_012917687.1|76792_78361_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000937603.1|78639_79827_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001344870.1|79777_80191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612591.1|80427_80775_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000997978.1|80824_82357_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	4.6e-297
