The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029242	Escherichia coli strain ECCRA-119 chromosome, complete genome	4893130	54108	129167	4893130	integrase,transposase,tRNA	Escherichia_phage(50.0%)	57	114128:114142	117554:117568
WP_001067855.1|54108_54813_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839980.1|55198_55615_+	fosfomycin resistance glutathione transferase FosA3	NA	NA	NA	NA	NA
WP_014839979.1|55619_56138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839978.1|56137_56926_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_049824851.1|56945_57416_-	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.7	5.3e-10
WP_001067855.1|57425_58130_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000147567.1|58447_59008_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_015344976.1|59010_61962_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_046788546.1|61970_62372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|62456_63161_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_001447541.1|64085_64970_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|65186_66401_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|66428_66734_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_109138224.1|66845_68339_+|transposase	IS91-like element ISVsa3 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|68369_68621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|68514_68817_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|68903_69719_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_085940648.1|69808_70898_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_006581703.1|71095_71581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000602738.1|73391_74144_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000742814.1|74565_75591_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_001199192.1|75819_76596_-	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_001067855.1|76709_77414_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001336345.1|78060_78351_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|78462_78960_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001067855.1|79364_80069_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|80258_81074_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|81224_81929_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013362812.1|83752_84721_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_013188475.1|84755_85631_-	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_014342101.1|85610_85733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|86584_87289_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032177942.1|89529_90402_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000241617.1|90500_91373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001387788.1|93960_94563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072153745.1|94657_94936_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000453334.1|95571_95784_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000148641.1|96527_97097_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_023278068.1|98347_99127_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	2.2e-138
WP_032178008.1|99126_100149_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.3e-199
WP_001322394.1|101390_102407_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	1.1e-185
WP_001618954.1|103451_105482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001618955.1|105487_106678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032170707.1|106698_108816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001618957.1|108820_110230_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_024190230.1|110219_111032_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001618959.1|111037_112183_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_087526051.1|112411_113216_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	38.9	6.4e-32
114128:114142	attL	CATCATCAGAACCGT	NA	NA	NA	NA
WP_001218908.1|115196_116381_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	3.4e-162
WP_000834439.1|117067_118450_+	glycoside-pentoside-hexuronide family transporter	NA	NA	NA	NA	NA
117554:117568	attR	ACGGTTCTGATGATG	NA	NA	NA	NA
WP_000702946.1|118459_120778_+	alpha-xylosidase	NA	NA	NA	NA	NA
WP_001330987.1|120830_122540_-	AsmA family protein	NA	NA	NA	NA	NA
WP_001330986.1|122660_124052_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
WP_000468836.1|124331_125537_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000747329.1|125539_126406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000678441.1|126390_128472_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_001070177.1|128477_129167_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP029242	Escherichia coli strain ECCRA-119 chromosome, complete genome	4893130	823387	878974	4893130	transposase,protease	Escherichia_phage(27.27%)	50	NA	NA
WP_001034518.1|823387_827956_+|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
WP_001331203.1|828095_828905_+	prepilin peptidase PppA	NA	NA	NA	NA	NA
WP_001324279.1|828970_829381_+	GspS/AspS pilotin family protein	NA	NA	NA	NA	NA
WP_000135062.1|829398_830358_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_000498839.1|830387_832448_+	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_000249348.1|832447_833941_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173453.1|833940_835164_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001087296.1|835180_835636_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001115137.1|835639_836203_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000820098.1|836199_836571_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_001255040.1|836567_837167_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000633222.1|837169_838147_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_000094974.1|838143_839322_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000942786.1|839323_839860_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_001290246.1|840140_840713_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839281.1|840809_841007_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000777545.1|841018_841507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854753.1|841503_841878_-	toxin	NA	NA	NA	NA	NA
WP_001278232.1|841967_842336_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692329.1|842498_842720_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186726.1|842782_843259_-	RadC family protein	NA	NA	NA	NA	NA
WP_000849582.1|843274_843760_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
WP_001234620.1|843814_844633_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_001119729.1|844732_844966_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_072645706.1|845044_845500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072645707.1|845575_848092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072645708.1|848212_851332_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_072645709.1|851704_852577_-	GTPase family protein	NA	NA	NA	NA	NA
WP_001297234.1|853806_855291_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000804452.1|855612_856215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001323667.1|856301_856580_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_052318419.1|857266_857416_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_000221569.1|858230_858800_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271038.1|858965_859322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061092452.1|859354_859789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001315617.1|860990_861089_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_104770134.1|861540_861867_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.8	8.6e-28
WP_000255944.1|861919_862942_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|862941_863721_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_139352251.1|863730_863850_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024250704.1|863846_864281_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	57.7	6.3e-18
WP_001272449.1|864547_865417_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_063118193.1|865413_868164_-	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	24.9	4.0e-25
WP_063118192.1|868264_871267_-	DUF1156 domain-containing protein	NA	NA	NA	NA	NA
WP_001029733.1|871367_872468_-	DUF3780 and DUF4357 domain-containing protein	NA	A0A1P8DTE9	Proteus_phage	97.6	7.6e-92
WP_024250705.1|872513_875639_-	DUF499 domain-containing protein	NA	A0A1P8DTE5	Proteus_phage	93.1	4.6e-86
WP_000201157.1|875622_875832_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_153674500.1|875919_876093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000227969.1|876509_877586_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_085949010.1|877760_878974_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.0	1.4e-168
>prophage 3
NZ_CP029242	Escherichia coli strain ECCRA-119 chromosome, complete genome	4893130	1135759	1142899	4893130		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1135759_1136398_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590388.1|1136394_1137657_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	5.7e-136
WP_000847985.1|1137653_1138562_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|1138727_1139525_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141330.1|1139575_1140232_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272894.1|1140337_1142899_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.3e-30
>prophage 4
NZ_CP029242	Escherichia coli strain ECCRA-119 chromosome, complete genome	4893130	1724058	1733500	4893130		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569361.1|1724058_1724985_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1724989_1725721_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1725701_1725809_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|1725868_1726600_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|1726821_1728507_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1728503_1729223_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1729269_1729740_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1729780_1730242_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001331478.1|1730366_1732367_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001292767.1|1732363_1733500_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
>prophage 5
NZ_CP029242	Escherichia coli strain ECCRA-119 chromosome, complete genome	4893130	1825064	1833337	4893130		Enterobacteria_phage(28.57%)	9	NA	NA
WP_072645686.1|1825064_1826459_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	3.7e-19
WP_000183060.1|1826633_1827527_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_072645688.1|1827899_1828985_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	6.7e-101
WP_072645689.1|1828984_1829884_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	6.3e-28
WP_072645690.1|1829941_1830820_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	2.5e-106
WP_072645691.1|1830824_1831373_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	52.5	2.6e-48
WP_072645692.1|1831376_1831796_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_072645693.1|1831770_1832241_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_072645694.1|1832230_1833337_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	33.5	1.1e-45
>prophage 6
NZ_CP029242	Escherichia coli strain ECCRA-119 chromosome, complete genome	4893130	2296432	2363583	4893130	integrase,protease,lysis,portal,capsid,tail,terminase,head	Enterobacteria_phage(45.1%)	76	2293531:2293545	2344643:2344657
2293531:2293545	attL	CTGGGCGGCTGCGGC	NA	NA	NA	NA
WP_001260840.1|2296432_2297254_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2297353_2297437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743960.1|2297529_2297865_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091838.1|2298261_2299515_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2299621_2300515_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2300649_2301870_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2301994_2302690_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2302642_2303935_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2304093_2304708_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|2304750_2305605_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2305606_2306224_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|2306234_2308658_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041535.1|2308718_2311145_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.9e-213
WP_001295396.1|2311343_2311649_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2311756_2312467_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2312469_2313030_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2313064_2313406_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2313540_2313867_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001370501.1|2314072_2315287_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|2315298_2316318_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001389342.1|2316375_2316504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876986.1|2316505_2317786_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_001296941.1|2317820_2318057_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048286.1|2318144_2320616_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	1.5e-58
WP_001083273.1|2320709_2320901_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001331023.1|2320897_2321086_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331024.1|2321486_2321639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171928.1|2321625_2321841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|2322000_2322156_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000362155.1|2322421_2322841_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391949.1|2322941_2323223_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693836.1|2323206_2323632_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262352.1|2323703_2324774_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_001151151.1|2324814_2325237_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001676522.1|2325577_2327575_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_000625668.1|2327638_2328916_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000019008.1|2329046_2329928_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000957771.1|2329924_2330617_-	calcium transporter ChaC	NA	NA	NA	NA	NA
WP_001117226.1|2330628_2331828_-	MFS transporter	NA	NA	NA	NA	NA
WP_122083109.1|2332339_2332447_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013637.1|2332491_2332704_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	98.5	3.1e-26
WP_064055607.1|2332871_2333150_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001265040.1|2333151_2334201_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.1e-108
WP_000904112.1|2334213_2334588_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762868.1|2334584_2335406_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	2.1e-78
WP_000562553.1|2336306_2336438_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000506937.1|2336804_2337233_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|2337404_2337779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839561.1|2338030_2338246_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_001135280.1|2338245_2338743_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_001228695.1|2338959_2339142_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|2339232_2339526_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_032195597.1|2339888_2340083_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	93.8	2.2e-26
WP_000453566.1|2340471_2341017_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001609942.1|2340991_2342917_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198150.1|2342913_2343120_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	4.9e-29
WP_001331248.1|2343116_2344718_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	3.6e-308
2344643:2344657	attR	CTGGGCGGCTGCGGC	NA	NA	NA	NA
WP_000123295.1|2344698_2346018_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.5	3.4e-232
WP_001513196.1|2346027_2346360_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063218.1|2346415_2347441_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
WP_000158868.1|2347482_2347878_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000753019.1|2347889_2348243_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000975054.1|2348254_2348833_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
WP_000683105.1|2348829_2349225_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001609944.1|2349232_2349973_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	1.7e-132
WP_000479169.1|2349988_2350411_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459488.1|2350392_2350827_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000840326.1|2350819_2353381_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
WP_000847345.1|2353377_2353707_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152538.1|2353706_2354405_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.1e-131
WP_001746230.1|2354410_2355154_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.3e-148
WP_071596891.1|2355090_2355723_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	87.1	7.4e-92
WP_047656194.1|2355783_2359197_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.8	0.0e+00
WP_001230353.1|2359266_2359866_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	95.5	3.5e-107
WP_072005420.1|2359930_2363002_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	1.6e-67
WP_001593356.1|2363001_2363583_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
>prophage 7
NZ_CP029242	Escherichia coli strain ECCRA-119 chromosome, complete genome	4893130	2657732	2722618	4893130	holin,integrase,portal,protease,capsid,tail,terminase,head	Enterobacteria_phage(65.45%)	81	2675491:2675507	2722805:2722821
WP_000422045.1|2657732_2658782_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559280.1|2659001_2659760_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_001278904.1|2659756_2660347_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2660386_2661259_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|2661359_2661980_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285659.1|2661976_2662858_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2662995_2663040_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194590.1|2663131_2664694_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|2664693_2666289_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|2666292_2667651_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|2667662_2668856_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443056.1|2668855_2669662_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2670042_2670222_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2670307_2670808_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|2670853_2671360_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000737226.1|2671419_2672058_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000028540.1|2672414_2673158_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000808667.1|2673187_2673727_+	septation protein A	NA	NA	NA	NA	NA
WP_000108160.1|2673831_2674230_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000171274.1|2674269_2674989_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000967595.1|2675212_2675509_+	YciI family protein	NA	NA	NA	NA	NA
2675491:2675507	attL	ATTTAAGAAAGTGTTCT	NA	NA	NA	NA
WP_000639140.1|2675627_2676176_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	100.0	2.7e-98
WP_061350573.1|2676634_2676874_+	DinI family protein	NA	K7P6H1	Enterobacteria_phage	100.0	2.0e-37
WP_061350572.1|2676931_2677345_-|tail	tail assembly chaperone	tail	K7P7H0	Enterobacteria_phage	98.5	7.3e-72
WP_061350571.1|2677346_2678207_-	hypothetical protein	NA	K7P7B1	Enterobacteria_phage	91.6	1.1e-146
WP_001228569.1|2678270_2678504_-	hypothetical protein	NA	E4WL42	Enterobacteria_phage	100.0	2.3e-38
WP_016063419.1|2678615_2679290_-	hypothetical protein	NA	K7P7N1	Enterobacteria_phage	100.0	1.2e-124
WP_109138237.1|2679593_2682776_-	host specificity protein J	NA	K7P7G9	Enterobacteria_phage	98.5	0.0e+00
WP_044158363.1|2682829_2683417_-|tail	tail assembly protein	tail	K7P6V1	Enterobacteria_phage	99.5	2.2e-98
WP_016063415.1|2683404_2684136_-|tail	minor tail protein	tail	K7P7M8	Enterobacteria_phage	100.0	8.1e-151
WP_109138238.1|2684137_2684893_-|tail	phage minor tail protein L	tail	K7P6G9	Enterobacteria_phage	99.6	6.7e-148
WP_000151491.1|2684889_2685237_-|tail	phage tail protein	tail	K7P7G7	Enterobacteria_phage	100.0	4.8e-61
WP_109138239.1|2685242_2687759_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	92.5	0.0e+00
WP_045270143.1|2687736_2688057_-|tail	phage tail assembly protein T	tail	K7P6V0	Enterobacteria_phage	94.3	7.6e-53
WP_000479021.1|2688065_2688488_-|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	100.0	6.7e-57
WP_109138240.1|2688524_2689262_-|tail	phage tail protein	tail	O64327	Escherichia_phage	98.0	1.8e-129
WP_000682752.1|2689269_2689668_-|tail	tail protein	tail	K7PJT1	Enterobacteria_phage	100.0	1.0e-70
WP_000023111.1|2689664_2690219_-|tail	phage tail protein	tail	K7PKQ5	Enterobacteria_phage	100.0	1.8e-81
WP_000753023.1|2690228_2690582_-|tail	tail attachment protein	tail	K7PHD8	Enterobacteria_phage	100.0	1.7e-61
WP_023062982.1|2690592_2691027_-|capsid	phage capsid protein	capsid	K7PM13	Enterobacteria_phage	93.8	1.1e-41
WP_109138241.1|2691072_2692098_-|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	95.6	2.2e-186
WP_003826193.1|2692165_2692498_-|head	head decoration protein	head	E4WL24	Enterobacteria_phage	82.7	5.0e-47
WP_053263369.1|2692507_2693845_-	S49 family peptidase	NA	O64320	Escherichia_phage	84.1	1.2e-189
WP_003826190.1|2693825_2695418_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	92.1	9.7e-290
WP_003034782.1|2695414_2695621_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	95.5	3.2e-28
WP_053263367.1|2695620_2697543_-|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	98.4	0.0e+00
WP_000453624.1|2697517_2698063_-|terminase	terminase small subunit	terminase	E4WL18	Enterobacteria_phage	100.0	1.2e-95
WP_040092035.1|2698342_2698618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162542027.1|2698950_2699646_-	hypothetical protein	NA	G8C7W5	Escherichia_phage	97.0	2.1e-119
WP_109138243.1|2699651_2700020_-	hypothetical protein	NA	G8C7W5	Escherichia_phage	99.2	2.2e-64
WP_109138244.1|2700074_2700332_-	hypothetical protein	NA	K7PMB3	Enterobacterial_phage	91.8	4.0e-36
WP_016063372.1|2700334_2701063_-	KilA-domain protein	NA	K7PH51	Enterobacterial_phage	100.0	2.4e-142
WP_001568787.1|2701257_2702160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106474631.1|2702734_2703250_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	90.1	3.4e-79
WP_061351302.1|2703246_2703789_-	lysozyme	NA	K7PM52	Enterobacteria_phage	100.0	2.1e-103
WP_016066213.1|2703766_2704045_-|holin	holin	holin	K7PGZ9	Enterobacteria_phage	100.0	6.0e-46
WP_109138245.1|2704480_2704978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001548468.1|2705148_2705838_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	53.2	2.0e-58
WP_001548467.1|2705834_2705975_-	YlcG family protein	NA	NA	NA	NA	NA
WP_029363688.1|2705971_2706334_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	82.4	4.3e-52
WP_024194779.1|2706330_2706621_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	88.5	3.1e-45
WP_001548464.1|2706829_2707426_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.8	1.2e-56
WP_001548463.1|2707516_2707795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001548462.1|2707814_2708072_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	74.0	3.2e-25
WP_001548461.1|2708074_2708323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001548459.1|2708521_2708989_-	DUF551 domain-containing protein	NA	A0A193GYX5	Enterobacter_phage	35.5	1.6e-19
WP_012542626.1|2710177_2710471_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
WP_001548455.1|2710470_2711061_-	hypothetical protein	NA	I3PUZ9	Vibrio_phage	40.5	4.1e-36
WP_100040039.1|2711060_2712017_-	phage replication protein	NA	H6WRX7	Salmonella_phage	64.0	4.3e-59
WP_001548453.1|2712165_2712387_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_001548452.1|2712466_2712658_-	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	55.4	2.4e-09
WP_001548451.1|2712762_2713473_+	LexA family transcriptional regulator	NA	K7P7K3	Enterobacteria_phage	72.3	1.5e-93
WP_001548450.1|2713574_2714339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001548449.1|2714325_2715207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001548448.1|2715243_2715447_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	74.6	5.4e-20
WP_001548447.1|2715694_2715883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001548446.1|2715875_2716082_+	hypothetical protein	NA	A0A0M4S6W3	Salmonella_phage	92.5	2.6e-30
WP_109138246.1|2716394_2719784_+	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	93.9	0.0e+00
WP_000432226.1|2719795_2720908_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	100.0	3.9e-205
WP_001237029.1|2720946_2721189_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	100.0	4.0e-38
WP_000627155.1|2721424_2722618_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	100.0	1.3e-235
2722805:2722821	attR	ATTTAAGAAAGTGTTCT	NA	NA	NA	NA
>prophage 8
NZ_CP029242	Escherichia coli strain ECCRA-119 chromosome, complete genome	4893130	3075167	3162945	4893130	plate,transposase,integrase,tRNA,protease,lysis,portal,capsid,tail,terminase,head	Salmonella_phage(60.34%)	94	3068128:3068143	3165516:3165531
3068128:3068143	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|3075167_3076460_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3076550_3077894_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3077904_3078516_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077012.1|3078670_3082738_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3082872_3083367_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3083911_3084877_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043618.1|3084999_3086766_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202188.1|3086766_3088488_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|3088529_3089234_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3089518_3089737_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3090420_3092697_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3092727_3093048_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3093370_3093595_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188194.1|3093667_3095614_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000746460.1|3095610_3096726_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001355621.1|3096876_3097833_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599806.1|3097829_3099488_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001297311.1|3099913_3100609_+	aquaporin Z	NA	NA	NA	NA	NA
WP_001614291.1|3101103_3102003_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458832.1|3102146_3103799_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|3103810_3104779_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|3104911_3106630_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000566372.1|3106666_3107668_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|3107678_3109109_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|3109207_3110221_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_109138248.1|3110217_3111048_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3111044_3111368_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|3111493_3112009_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3112226_3112955_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|3112972_3113704_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3113710_3114427_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3114426_3115095_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3115386_3116118_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149734.1|3116292_3117420_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	4.6e-28
WP_000389260.1|3117460_3117949_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|3118008_3118854_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093858.1|3118850_3119804_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000995994.1|3119813_3120947_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_000126065.1|3121041_3122154_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3122505_3122982_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3123069_3123972_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189152.1|3124032_3124755_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|3124738_3125026_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|3125185_3125443_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|3125472_3125850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|3126119_3127805_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|3128040_3128259_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_109138249.1|3128349_3129450_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	1.1e-175
WP_000980413.1|3129446_3129932_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_001282787.1|3129928_3133006_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000763311.1|3132998_3133118_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3133132_3133435_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|3133489_3134005_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046120.1|3134014_3135187_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_000905010.1|3135329_3135896_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_044077513.1|3135926_3136433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032316.1|3136435_3136846_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.3	2.2e-20
WP_001340317.1|3136826_3137060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109138250.1|3137062_3138547_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.1	5.1e-152
WP_032318555.1|3138543_3139149_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
WP_089538685.1|3139141_3140050_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	2.3e-142
WP_000177580.1|3140036_3140396_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_089538687.1|3140392_3140971_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	4.7e-93
WP_085452384.1|3141039_3141486_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	3.0e-63
WP_001039943.1|3141478_3141910_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	7.6e-72
WP_109138252.1|3142005_3142434_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.1	6.4e-47
WP_000727853.1|3142430_3142808_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001069905.1|3142809_3143322_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000171568.1|3143302_3143518_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3143521_3143725_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673523.1|3143724_3144189_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_085461584.1|3144284_3144935_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	2.5e-111
WP_000742510.1|3144938_3145997_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_088555854.1|3146013_3146847_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	89.9	1.2e-121
WP_109138253.1|3146989_3148756_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
WP_089615159.1|3148755_3149790_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	88.9	6.3e-173
WP_021548667.1|3149834_3150380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021556032.1|3150605_3151448_-	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.1	1.1e-58
WP_000094764.1|3151447_3151663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3151933_3152167_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3152178_3152367_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_109138254.1|3152519_3154934_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
WP_000104165.1|3154930_3155788_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.0e-160
WP_000752621.1|3155784_3156012_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	4.6e-36
WP_001244227.1|3156011_3156245_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	3.2e-32
WP_001352070.1|3156312_3156654_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	96.5	4.3e-54
WP_000956184.1|3156617_3156818_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	2.1e-32
WP_016529334.1|3156825_3157335_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	97.6	2.9e-86
WP_000188448.1|3157367_3157589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109138255.1|3157677_3158613_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.0	2.7e-34
WP_109138256.1|3158632_3160105_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001310555.1|3160114_3161131_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_109138258.1|3161379_3161814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290937.1|3161892_3162945_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
3165516:3165531	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 9
NZ_CP029242	Escherichia coli strain ECCRA-119 chromosome, complete genome	4893130	3744504	3824817	4893130	integrase,plate	Enterobacteria_phage(47.62%)	71	3759508:3759551	3785440:3785483
WP_000667026.1|3744504_3746703_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121326.1|3746712_3747669_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111349.1|3747647_3748058_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000783650.1|3748676_3751010_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
WP_000856729.1|3751024_3751345_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459302.1|3751480_3751936_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244665.1|3751928_3752216_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000980231.1|3752208_3752808_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	80.3	1.9e-49
WP_001149160.1|3752804_3753071_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283027.1|3753622_3754357_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	1.4e-129
WP_000638629.1|3754353_3754854_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446152.1|3754927_3755500_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	6.5e-95
WP_000622599.1|3755802_3756543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064054.1|3756539_3758168_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_001130497.1|3758160_3759345_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.4	3.2e-144
3759508:3759551	attL	GATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTAC	NA	NA	NA	NA
WP_000908078.1|3760053_3761235_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_001330891.1|3761265_3761727_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001609345.1|3761966_3762464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032195564.1|3762600_3764307_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_001273463.1|3764574_3765240_-	recombinase family protein	NA	A0A0F7L6S1	uncultured_marine_virus	41.1	1.5e-31
WP_001609341.1|3765522_3765867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067395.1|3766216_3767143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000068781.1|3770202_3772140_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_032195659.1|3772331_3773666_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001240681.1|3773746_3774424_-	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	51.8	1.7e-46
WP_001609339.1|3774471_3776313_-	hypothetical protein	NA	A0A140G5Z0	Enterobacteria_phage	27.5	4.2e-18
WP_000990803.1|3776347_3776545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999103.1|3776700_3777732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013184.1|3777746_3778130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807036.1|3778134_3778332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390656.1|3779313_3779616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000580787.1|3779615_3779819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000532782.1|3779876_3780257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000606591.1|3780391_3780961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000873433.1|3781204_3781405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001323651.1|3783511_3784063_-	hypothetical protein	NA	A0A1L5C2A2	Pseudoalteromonas_phage	60.0	1.2e-05
WP_000893255.1|3785631_3786885_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
3785440:3785483	attR	GATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTAC	NA	NA	NA	NA
WP_001285288.1|3786896_3788000_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749865.1|3788287_3789343_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
WP_000174677.1|3789381_3789783_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189543.1|3789840_3791085_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3791176_3791635_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293016.1|3791895_3793353_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602134.1|3793409_3794024_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_000528870.1|3794020_3795160_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	32.0	5.3e-32
WP_001059855.1|3795405_3795858_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226182.1|3795854_3796910_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207575.1|3796980_3797766_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001298878.1|3797710_3799450_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000598760.1|3799554_3799833_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001030484.1|3799825_3800182_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_000543899.1|3800238_3801012_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|3801197_3801458_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615982.1|3801460_3801739_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|3801894_3802635_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|3802605_3803373_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3803578_3804157_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973081.1|3804396_3806841_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|3806883_3807357_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118029.1|3807510_3808281_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_122985282.1|3810768_3810954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939262.1|3810868_3811351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000508710.1|3811334_3815570_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	1.5e-23
WP_000103361.1|3815645_3817787_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	8.2e-26
WP_001142958.1|3817996_3818515_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037391.1|3819211_3819712_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_097340388.1|3819746_3819971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056975.1|3820021_3821497_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611738.1|3821503_3821917_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393845.1|3821920_3823771_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348806.1|3823734_3824817_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 10
NZ_CP029242	Escherichia coli strain ECCRA-119 chromosome, complete genome	4893130	4189071	4222880	4893130	integrase,transposase	uncultured_marine_virus(27.27%)	35	4189058:4189117	4222835:4224164
4189058:4189117	attL	ACTGAGAGATCCCCTCATAATTTCCCCAAAACGTAACCATGTGTGAATAGATTTTGAGTA	NA	NA	NA	NA
WP_001352368.1|4189071_4190280_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001325745.1|4191978_4192719_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000169527.1|4193243_4193543_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|4193539_4194406_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000902464.1|4194542_4195334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000900255.1|4195404_4196226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001609859.1|4196263_4196713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387046.1|4196961_4197513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001609855.1|4197698_4198502_-	hypothetical protein	NA	A0A0F7L9X0	Escherichia_phage	51.3	4.1e-79
WP_001617303.1|4199152_4199500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218942.1|4199778_4200555_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001072164.1|4200557_4201061_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_000538703.1|4201264_4201747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123906543.1|4201691_4202186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001611347.1|4203221_4204001_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.3e-138
WP_001075491.1|4204216_4204948_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000778605.1|4205617_4206148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001499035.1|4207752_4208622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126799.1|4208618_4209581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000010383.1|4209686_4210571_+	GTPase	NA	NA	NA	NA	NA
WP_001282919.1|4210773_4211454_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001097301.1|4211601_4212279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278287.1|4212284_4212518_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001352368.1|4212715_4213924_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001175163.1|4213945_4214764_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.1	1.9e-47
WP_000206664.1|4214855_4215341_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	1.2e-12
WP_001186165.1|4215355_4215832_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692350.1|4215918_4216140_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001285607.1|4216219_4216588_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_001094443.1|4216677_4217055_+	toxin	NA	NA	NA	NA	NA
WP_000761685.1|4217051_4217540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001327226.1|4217559_4217757_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001218329.1|4218449_4219715_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.1	1.1e-81
WP_001022619.1|4219915_4221385_-	serine/threonine protein kinase	NA	A0A2K9L5Y0	Tupanvirus	26.5	1.4e-11
WP_001352368.1|4221671_4222880_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
4222835:4224164	attR	TACTCAAAATCTATTCACACATGGTTACGTTTTGGGGAAATTATGAGGGGATCTCTCAGTGCTCAGCATGTTTGAGTGCTTTACTCGCCGCGGGTTGAGAAATATGTAAAACTTCAGCCGCACGCGTTAAGGAACCACAAGTCATTACAGCATAAAAGATATCGAGATGTCTTAATTTCATTCCATGTAGCCTACTGATTATTTATTTCTACGGACTATTCTAACGAATAAAGTATAAATAATCAGATATACTCGTCATAATTCAAATTTTGGTTTAGTTGTCACGAGAATTAATTCGTAAACGTGCAAGCTAAATAGATTGACTAGGGGAATATACGGGGTAAGAAAGCGGCTCGGCATACTGCCCTATAATAAATTGTTAGGAGAAGTACGCCGAGTAGTGTGTAGCTATTAGGTAAAGTATGTACCAATTTCAATAAATATTTTAATTAAGATACTGTTTGAAATATCAACAATAAAGGCACCGACCATAGGAACGACAAGGAAAGCTTTATGTGATGGTCCAAATGCTTTTGTGACTGTTTGCATATTCGCAATTGCTGTTGGTGTTGCTCCCATACCAAAGCCACAGTGACCCGCGCTGATCACGACAGCATCATAATCTTTGCCCATCATTTTGAAGGTGACAAAGCAGGCAAATAGCACCATGACAACAGTTTGTACAGCAATGATAATTAATACTGGCCCTGCCATGCTTGCCAATTGACCAAATTTTAATGACATTAACGCCATTGCCAAGAAAAGCGATAAAGCAACGCTACCTAATACATCGACGGTCGGCTCAAACACTTCGTGTTTAAATACATGAGTCAGTGTATTACGGATAATAATACCGACAAATAAACACCAGACAAAAGTAGGCAGTTGCAGAAAAGTATCTTTAAACAATGCACTGATATAGCCACCAACAACAATACAGATAATCAGCATTGAAATGGTTTCAATAACGTTATTTGCATTGATTTTTCTTTTGACGCTTGGTTGCTCAAAAGCTTCAACGATAGTGTCGCGCTCTTGCTCGGTTGTTTTAGGAATAGAGACCTTTTTCAAAAGATGACGGGCAACAGGGCCGCCAACTAAACCACCCAACACTAATCCAAGTGTTGCACAAGCCATCGCTAATTCAACGGCGCCTGTTACACCATATTTATCAGCGAGAATAGGGCCCCATGCTCCGGCATTACCATGACCACCTGTTAGAGTAATTGAACCTGCAATTAAGCCAATAAATGGACTTTCATTCATCATGACAGCCATACTCATGCCGACAGTATTTTGAATGGCGATTAGGATCGTTACTGCAATAGTT	NA	NA	NA	NA
>prophage 1
NZ_CP029243	Escherichia coli strain ECCRA-119 plasmid pTB201, complete sequence	146268	66073	94758	146268	protease,integrase,transposase	Macacine_betaherpesvirus(33.33%)	19	73133:73147	89220:89234
WP_000082154.1|66073_67045_+|transposase	IS110-like element ISEc32 family transposase	transposase	Q75QL1	Wolbachia_phage	32.1	1.1e-25
WP_000817028.1|69399_70371_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
WP_001238646.1|70370_71537_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
WP_000715078.1|72689_74192_-	hypothetical protein	NA	NA	NA	NA	NA
73133:73147	attL	ACTTCCAGTCATGAT	NA	NA	NA	NA
WP_109138270.1|74809_75259_-	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	67.1	8.5e-42
WP_000190053.1|75376_75856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968140.1|77139_77997_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000992806.1|77993_78851_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983710.1|78847_79675_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_000949004.1|79674_80589_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_109138276.1|84042_85234_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.2e-100
WP_000361611.1|85779_86757_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_001066954.1|87041_87782_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_014640565.1|87902_88091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175738.1|88464_89373_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
89220:89234	attR	ACTTCCAGTCATGAT	NA	NA	NA	NA
WP_000771475.1|89435_90545_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000280980.1|90977_91931_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001312823.1|93203_93362_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_085949156.1|93545_94758_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	6.0e-167
>prophage 1
NZ_CP029244	Escherichia coli strain ECCRA-119 plasmid pTB202, complete sequence	139629	14337	72729	139629	transposase,integrase	Escherichia_phage(45.95%)	53	57136:57195	74581:74647
WP_094888184.1|14337_15610_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	6.8e-169
WP_000578338.1|15913_16648_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_072647222.1|18340_19438_+	hypothetical protein	NA	Q71TI8	Escherichia_phage	97.5	4.9e-200
WP_032203676.1|19510_20017_+	3'-phosphatase 5'-polynucleotide kinase phage-associated protein	NA	A0A1B0VAK0	Salmonella_phage	98.8	2.7e-92
WP_072647223.1|20283_23400_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	1.3e-27
WP_072731919.1|23521_24754_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_001568002.1|24750_26307_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	3.8e-105
WP_072731917.1|26489_26711_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	98.6	3.3e-31
WP_072731915.1|26710_27091_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	99.2	2.5e-63
WP_000113018.1|27095_27275_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
WP_001376634.1|29183_29303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072019028.1|29321_29543_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	79.7	1.8e-24
WP_033551397.1|29539_30655_+	antirepressor	NA	A0A077SLR9	Escherichia_phage	92.7	3.6e-190
WP_000611664.1|30687_31539_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	100.0	1.2e-158
WP_000874156.1|31649_31859_-	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_000019445.1|32046_33027_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_000542338.1|33663_33885_+	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	97.3	4.2e-34
WP_000067537.1|33892_34924_+|integrase	site-specific integrase	integrase	A0A077SLE7	Escherichia_phage	99.1	1.9e-193
WP_001224232.1|34974_35286_+	hypothetical protein	NA	A0A077SK03	Escherichia_phage	97.1	8.8e-46
WP_000848370.1|35531_36092_+	Ref family protein	NA	Q5QBN4	Enterobacteria_phage	95.7	2.8e-95
WP_104692568.1|36178_36928_+	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	48.6	8.3e-66
WP_109138278.1|37083_37725_+	maturation control protein	NA	A0A077SK30	Escherichia_phage	95.3	2.0e-108
WP_071447930.1|37827_38955_+	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	74.4	2.0e-156
WP_000747845.1|38991_39240_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	98.8	4.0e-41
WP_000224043.1|39236_39677_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_000169527.1|39796_40096_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878219.1|40092_40959_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_024175649.1|41213_41771_-	lysozyme	NA	Q71TF3	Escherichia_phage	98.9	6.1e-106
WP_000068862.1|41940_42429_+	single-stranded DNA-binding protein	NA	Q1MVN2	Enterobacteria_phage	98.8	2.5e-87
WP_089571554.1|42662_43775_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	98.4	3.4e-201
WP_001165933.1|44516_44828_-	hypothetical protein	NA	A0A077SLG5	Escherichia_phage	100.0	1.8e-46
WP_104692586.1|44817_46095_-	ddrB domain protein	NA	Q1MVM9	Enterobacteria_phage	98.6	1.1e-235
WP_089571546.1|47540_51056_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	36.1	2.7e-98
WP_000896262.1|51425_51626_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_000222771.1|51915_52203_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	4.5e-20
WP_001139206.1|52199_52451_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_001352029.1|52537_52705_-	hypothetical protein	NA	NA	NA	NA	NA
57136:57195	attL	GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATC	NA	NA	NA	NA
WP_001351729.1|58988_59381_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|59518_60403_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|60434_61634_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_038989485.1|61739_62390_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_109138279.1|62418_63018_-	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	85.1	4.7e-64
WP_001161490.1|63021_63582_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001323888.1|63570_63738_+	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_000454193.1|63757_64108_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|64310_65324_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|65468_65966_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|66077_66368_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|66373_67165_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|67328_67676_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|67669_68509_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|68636_68840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001143760.1|69723_72729_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
74581:74647	attR	GATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGATTCCT	NA	NA	NA	NA
>prophage 2
NZ_CP029244	Escherichia coli strain ECCRA-119 plasmid pTB202, complete sequence	139629	115201	128940	139629	transposase	Escherichia_phage(64.29%)	14	NA	NA
WP_104692574.1|115201_115522_-	hypothetical protein	NA	Q71TB4	Escherichia_phage	99.0	4.6e-50
WP_000041769.1|115800_116616_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.5	5.4e-111
WP_000459149.1|116625_117897_-	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	97.9	3.0e-241
WP_094888184.1|117921_119195_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	6.8e-169
WP_000067707.1|119610_121317_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
WP_000038866.1|121542_122544_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_001285362.1|122560_123757_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_001154687.1|123925_124735_-	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	97.8	7.1e-156
WP_001113742.1|125027_125912_-	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
WP_001281115.1|126247_126640_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
WP_000336812.1|126649_126790_-	hypothetical protein	NA	Q71TL6	Escherichia_phage	100.0	6.3e-20
WP_000007769.1|126815_127238_-	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
WP_089586239.1|127277_127631_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	94.9	2.0e-38
WP_088491938.1|127726_128940_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	1.6e-167
