The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	11426	53873	4999360	transposase	Leptospira_phage(25.0%)	41	NA	NA
WP_109182097.1|11426_12528_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.5e-42
WP_011407778.1|13958_14582_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_011257965.1|14605_14845_+	rubredoxin	NA	NA	NA	NA	NA
WP_011257966.1|14894_15776_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011407780.1|15925_16375_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_109181886.1|16525_17173_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_011257969.1|17264_17735_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_011407783.1|17731_18322_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_011257971.1|18930_19230_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_011407784.1|19226_19448_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_011407785.1|19683_20226_+	YecA family protein	NA	NA	NA	NA	NA
WP_011257974.1|20236_21577_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_162013040.1|22094_22253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181887.1|22284_23048_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257975.1|23280_24606_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_011257976.1|24804_25152_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011407789.1|25148_27557_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_011257978.1|27735_28893_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_011257979.1|28908_29508_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C6K8R3	Cassava_brown_streak_virus	34.8	3.8e-13
WP_011257980.1|29504_29900_-	glyoxalase	NA	NA	NA	NA	NA
WP_011257981.1|29896_30622_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_011257982.1|30731_31592_+	YicC family protein	NA	NA	NA	NA	NA
WP_011257983.1|31708_32320_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	30.9	3.1e-10
WP_099051298.1|32500_33298_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407791.1|33446_33746_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_011257986.1|33874_36046_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_011257987.1|36125_36506_+	RidA family protein	NA	NA	NA	NA	NA
WP_011407792.1|36526_38680_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011257989.1|38805_39744_+	inosine-uridine preferring nucleoside hydrolase	NA	NA	NA	NA	NA
WP_005911911.1|39815_40058_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011407793.1|40271_41561_+	citrate synthase	NA	NA	NA	NA	NA
WP_011407794.1|41938_42589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257992.1|42898_45328_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_011407795.1|45543_46602_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011257994.1|46601_47360_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011257995.1|47356_48022_+	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_011257996.1|48018_48552_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011407796.1|48571_50521_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_094187763.1|50591_51390_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407713.1|51532_52768_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407799.1|52838_53873_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	93089	125076	4999360	transposase	Hokovirus(14.29%)	25	NA	NA
WP_094187715.1|93089_93852_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182098.1|93941_94907_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181889.1|95016_96342_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	25.9	9.0e-07
WP_011407833.1|96804_97482_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_027704066.1|97561_97951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182099.1|98163_99051_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	33.1	2.4e-32
WP_041182001.1|99484_100468_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	2.2e-98
WP_011407838.1|100641_102729_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011407839.1|102880_103540_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_094187758.1|103620_104418_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407841.1|104440_104620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258045.1|104638_105043_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258046.1|105076_105436_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258047.1|105679_106552_-	ion transporter	NA	NA	NA	NA	NA
WP_011258048.1|106624_107851_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
WP_011407842.1|108095_108713_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_042464589.1|110249_111857_+	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
WP_011258050.1|111853_112279_+	cytochrome c	NA	NA	NA	NA	NA
WP_011407846.1|112303_112807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407850.1|114249_114699_+	azurin	NA	NA	NA	NA	NA
WP_027703881.1|118089_119379_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_044757054.1|119664_122844_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258055.1|123340_124210_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.4e-29
WP_011258056.1|124231_124903_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_012444927.1|124899_125076_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	206710	300467	4999360	tRNA,transposase	Acinetobacter_phage(33.33%)	60	NA	NA
WP_109181890.1|206710_207767_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011407897.1|208087_209581_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_162597425.1|209780_210092_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_128896923.1|211823_212921_+	HutD family protein	NA	NA	NA	NA	NA
WP_011258133.1|215074_216658_-	alpha-L-arabinofuranosidase	NA	NA	NA	NA	NA
WP_027704032.1|216905_217955_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_011407903.1|218242_219034_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_109181891.1|219221_220187_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407905.1|220488_221865_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_011407907.1|223437_224508_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_011407908.1|224498_225296_+	aminotransferase class IV family protein	NA	NA	NA	NA	NA
WP_011258141.1|225405_225663_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_011407909.1|225706_226219_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_011407910.1|226284_227064_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_005989873.1|227187_227595_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_011407911.1|228220_229711_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011407912.1|230051_230459_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_011407913.1|230878_232093_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_011407915.1|233418_233694_-	glutathione transferase	NA	NA	NA	NA	NA
WP_011258151.1|233723_234029_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_011407916.1|234474_237060_+	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.4	3.8e-126
WP_041182015.1|237184_238096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181892.1|238126_238276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258158.1|241339_243217_+	TonB-dependent vitamin B12 receptor	NA	A0A0P0I887	Acinetobacter_phage	29.5	4.9e-06
WP_011258160.1|244989_245583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703819.1|245582_246182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258162.1|246178_246790_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_011258163.1|247303_247825_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_011407923.1|247821_248868_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258165.1|248864_249455_+	fructose 2,6-bisphosphatase	NA	NA	NA	NA	NA
WP_011258166.1|249451_250186_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_011407924.1|250360_251557_-	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_011407925.1|251553_253323_-	iron transporter	NA	NA	NA	NA	NA
WP_011258170.1|254492_256295_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_011258171.1|256291_257518_-	siderophore biosynthesis protein PvsA	NA	NA	NA	NA	NA
WP_011407927.1|257753_259895_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_011258173.1|259895_260657_-	4-hydroxy-2-oxovalerate aldolase	NA	NA	NA	NA	NA
WP_162013048.1|260801_261902_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	4.7e-41
WP_109181893.1|262066_263764_-	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_069964950.1|264862_267262_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	33.3	6.4e-11
WP_011258178.1|267594_269982_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.9	9.2e-10
WP_069959771.1|270255_270696_-	VOC family protein	NA	NA	NA	NA	NA
WP_011407931.1|271159_273547_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.7	7.1e-10
WP_011407932.1|273722_275639_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.5	1.2e-65
WP_011407933.1|275910_276336_+	YcxB family protein	NA	NA	NA	NA	NA
WP_011407934.1|276359_277235_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.4	2.0e-15
WP_042464613.1|278343_279162_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_125168742.1|281271_281553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407938.1|281770_282562_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011258190.1|283323_284754_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011407939.1|284966_286835_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.0	9.7e-15
WP_011407940.1|286859_289184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407609.1|291973_293158_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_075239694.1|293249_294602_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_011407945.1|294667_295603_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_011407946.1|295669_296269_-	LysE family translocator	NA	NA	NA	NA	NA
WP_011407947.1|296303_297164_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_011407948.1|297181_298222_-	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_109181894.1|298248_299496_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_011258802.1|299498_300467_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 4
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	345820	491793	4999360	tRNA,transposase	Ralstonia_phage(19.23%)	109	NA	NA
WP_109181897.1|345820_346786_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182392.1|347138_347843_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_005926176.1|348380_348605_-	putative selenoprotein	NA	NA	NA	NA	NA
WP_011407979.1|348604_350677_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_011407980.1|350908_351766_+	pirin family protein	NA	NA	NA	NA	NA
WP_082323236.1|352801_355204_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.2	4.6e-41
WP_027704078.1|355258_356119_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_075241467.1|356187_356766_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_044757488.1|356755_358168_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_109181898.1|358177_360601_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	3.1e-37
WP_011258248.1|360597_361545_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_158645225.1|361760_362144_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_041182394.1|362538_363087_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_075245366.1|363481_364039_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407990.1|364088_366197_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_069959782.1|366218_368120_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.2e-30
WP_027704078.1|368174_369035_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_075251795.1|369103_369682_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011258251.1|370145_370379_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407995.1|371367_371955_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_162013049.1|372307_372742_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_069959784.1|372738_375147_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011407999.1|375491_375953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408000.1|376199_377090_-	pirin family protein	NA	NA	NA	NA	NA
WP_125168744.1|377267_377786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444354.1|377857_378571_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_011258259.1|378674_379424_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_042465485.1|379784_380036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408003.1|380368_382426_+	M13 family peptidase	NA	A0A1V0SHG2	Klosneuvirus	28.6	1.2e-79
WP_069960076.1|384373_385495_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_012444362.1|385509_386316_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_069959785.1|386320_387604_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011408007.1|387630_388146_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_069959786.1|388156_390313_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.1	2.9e-10
WP_011408009.1|390380_392378_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258268.1|392396_392726_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_125168745.1|392765_392984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181899.1|393215_396680_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_014502625.1|397082_397625_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408011.1|398036_398945_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_094187763.1|399290_400089_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042464653.1|400232_400952_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_109181900.1|401107_402142_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258276.1|402162_402975_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408014.1|403710_404094_+	membrane protein	NA	NA	NA	NA	NA
WP_011408015.1|404252_405422_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
WP_011408016.1|405416_406475_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	4.1e-71
WP_011408017.1|406535_407348_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408018.1|407863_408247_+	membrane protein	NA	NA	NA	NA	NA
WP_011408019.1|408432_409596_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
WP_011258803.1|409685_410654_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011408020.1|410786_411599_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408021.1|411829_412417_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_011407237.1|412715_413672_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_075242217.1|413745_414477_+	nitrilase	NA	NA	NA	NA	NA
WP_069960180.1|414498_415602_+	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_011258289.1|415670_417074_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408024.1|417087_417594_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408025.1|417999_418458_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|419235_419439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258293.1|421000_421486_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|421713_421929_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_011408030.1|422179_422659_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_109181901.1|422790_423171_-	cytochrome c	NA	NA	NA	NA	NA
WP_011258297.1|423290_424121_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_011408032.1|424182_424950_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011258299.1|424949_425165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408033.1|425310_426102_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258301.1|426247_427423_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011408036.1|429656_430295_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011258305.1|430470_432411_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_011258306.1|432627_433182_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011408037.1|433403_434834_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_012444398.1|434936_436355_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	3.3e-47
WP_011258309.1|436771_437497_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_011408038.1|437595_438006_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041182034.1|438057_439014_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	1.0e-39
WP_011408040.1|439257_441639_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258314.1|444292_444703_+	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_011408042.1|445002_445185_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_011258316.1|445317_446358_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011258317.1|446430_447876_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_011257031.1|449406_450375_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181902.1|450587_451907_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109181903.1|452202_452748_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_011408047.1|452744_454208_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011258323.1|455668_455923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075242210.1|456325_456859_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_014502654.1|456884_457286_+	membrane protein	NA	NA	NA	NA	NA
WP_011258326.1|457634_457877_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_069964510.1|459238_461143_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
WP_075243271.1|461406_463803_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_011258331.1|463952_464675_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_011258334.1|467594_468095_+	putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase	NA	NA	NA	NA	NA
WP_075241746.1|468036_469713_+	serine hydrolase	NA	NA	NA	NA	NA
WP_011258336.1|469859_471125_+	potassium transporter	NA	NA	NA	NA	NA
WP_011258337.1|471183_472377_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.3	4.0e-22
WP_012444424.1|472373_473063_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_033013597.1|473168_474638_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011258340.1|474657_475494_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011258341.1|475519_476623_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_044756980.1|476619_479676_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_069960188.1|479741_480332_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_069959790.1|480463_482296_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
WP_094187715.1|482371_483135_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181904.1|483177_484497_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408063.1|485794_490285_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_125168746.1|490281_490773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|490824_491793_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 5
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	623198	689043	4999360	tRNA,transposase	Bacillus_phage(20.0%)	42	NA	NA
WP_011260830.1|623198_624434_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|624484_625248_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069959795.1|625314_626691_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	1.1e-58
WP_008578058.1|627069_627744_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_011408164.1|628374_628779_-	response regulator	NA	NA	NA	NA	NA
WP_011408165.1|628857_629355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959808.1|629493_631290_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	2.6e-81
WP_011408166.1|631844_632390_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_069959809.1|632491_636613_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
WP_011408167.1|636833_639476_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182063.1|640917_642432_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_094187715.1|642602_643365_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408171.1|643676_644189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408172.1|644251_645370_-	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_011408173.1|645366_645645_-	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_011408174.1|645641_646394_-	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_109181911.1|646390_647290_-	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_002812057.1|647373_647454_-	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_042464698.1|647743_649930_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_042465507.1|650212_651655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756949.1|651987_654090_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_069959810.1|654331_656776_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_011408178.1|656789_657314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408179.1|657513_659541_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	4.6e-95
WP_011408180.1|659554_660274_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_011258505.1|660270_661185_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	48.5	1.2e-63
WP_011258506.1|661478_662354_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_044756943.1|662350_663301_-	glutathione synthase	NA	NA	NA	NA	NA
WP_005913706.1|663550_663952_+	response regulator	NA	NA	NA	NA	NA
WP_011258508.1|663969_664332_+	response regulator	NA	A0A220YL79	Alteromonas_virus	26.8	9.0e-10
WP_003482487.1|664331_664862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258510.1|664901_666938_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.1	2.1e-23
WP_109181912.1|667051_673978_+	response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.9e-11
WP_011408184.1|673985_675188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258512.1|675221_675698_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011258513.1|675948_676572_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408185.1|676583_677666_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258518.1|682287_683352_+	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
WP_011258519.1|683348_684080_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_011408189.1|684104_686063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258521.1|686204_687308_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_011408191.1|687807_689043_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	780835	841651	4999360	protease,transposase	Tupanvirus(18.18%)	50	NA	NA
WP_094187715.1|780835_781599_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408239.1|782547_783354_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_011408242.1|785386_786772_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011408243.1|786910_788416_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011408244.1|788426_789608_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011258591.1|789604_790402_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_027703337.1|791732_792635_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_011408247.1|792873_793839_+	cation transporter	NA	NA	NA	NA	NA
WP_011258595.1|794055_796137_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_041182077.1|796373_796994_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_011258597.1|796990_797890_+	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_011408249.1|797999_799586_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	6.5e-28
WP_041182078.1|799766_801557_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	40.5	3.5e-22
WP_011258600.1|801663_802464_+	signal peptidase I	NA	NA	NA	NA	NA
WP_011258601.1|802494_802872_+	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011258602.1|802861_803542_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.4	1.7e-17
WP_011258603.1|803538_804438_+	GTPase Era	NA	NA	NA	NA	NA
WP_011258604.1|804661_805384_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_011408250.1|805532_806255_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011408251.1|806413_807748_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	27.2	1.0e-29
WP_011258607.1|807922_808420_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_011258607.1|808765_809263_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_011257310.1|809358_810594_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011408252.1|810822_812199_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_041182416.1|812318_813002_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_011408254.1|813018_814053_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011408255.1|814233_815811_+	cryptochrome/photolyase family protein	NA	A0A1V0SE91	Indivirus	25.6	2.2e-44
WP_011408256.1|815928_816933_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_011408257.1|816932_817487_+	hypoxanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011408258.1|817572_818325_+	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_003488188.1|818411_818618_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	9.3e-20
WP_014504008.1|820128_820773_-	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_011408263.1|820762_823264_-	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_011408264.1|823260_824865_-	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	36.6	4.9e-15
WP_011258619.1|824861_825095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408265.1|825091_826114_-	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_011258621.1|826450_826816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408267.1|826812_827403_-	cell shape determination protein CcmA	NA	NA	NA	NA	NA
WP_011408268.1|827500_829210_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	2.1e-16
WP_011258624.1|829318_829645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408269.1|829874_830219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408270.1|830341_831517_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011258626.1|831672_834501_+|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
WP_011258627.1|834561_835662_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_041182081.1|836128_836656_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258629.1|837057_837231_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_011258630.1|837391_837646_-	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258631.1|837820_838087_+	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_041182418.1|838277_838844_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_109181915.1|840331_841651_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	857474	929691	4999360	coat,tRNA,protease,transposase	Emiliania_huxleyi_virus(20.0%)	57	NA	NA
WP_109181916.1|857474_858237_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069964915.1|858628_861193_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_011408290.1|862173_862521_+	RidA family protein	NA	NA	NA	NA	NA
WP_012445221.1|862683_863754_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_044756918.1|863771_864554_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_011258654.1|864550_865096_-	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_109181917.1|865092_866388_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	32.4	1.5e-38
WP_044756917.1|866384_867269_-	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_027704227.1|867268_868519_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011408297.1|868515_869514_-	acyl-CoA desaturase	NA	G4YAW5	Emiliania_huxleyi_virus	30.6	2.3e-18
WP_012445217.1|869739_870573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258659.1|870569_871133_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012445216.1|871191_871560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258660.1|871645_872428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445213.1|873046_873475_-	Rnf electron transport complex subunit RnfB	NA	NA	NA	NA	NA
WP_012445212.1|873476_874073_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_109181918.1|874262_876347_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012445211.1|876571_877021_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_109181919.1|877784_878837_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408305.1|879113_880511_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_011258667.1|880507_881485_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_011258668.1|881666_883604_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258669.1|884024_884801_-	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258670.1|884805_885480_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_082323429.1|887110_888487_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.0e-78
WP_011408311.1|888526_888922_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_069959817.1|888964_890440_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.5	2.2e-102
WP_011408313.1|891237_891654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256646.1|891667_891838_-	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_011258676.1|895526_896090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445197.1|896562_897906_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_011408316.1|898046_898649_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408317.1|898722_899169_+	membrane protein	NA	NA	NA	NA	NA
WP_012445196.1|899246_899513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181921.1|901614_903027_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011258682.1|903023_903761_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
WP_042464756.1|903760_905941_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258685.1|906780_907740_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_011408321.1|907915_911506_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	4.4e-181
WP_011408322.1|911963_912704_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.6e-24
WP_027703356.1|912700_913957_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011258689.1|913995_914787_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_011258690.1|914810_915272_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_069959820.1|915268_916282_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_012445188.1|916681_919048_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_011408324.1|919131_920478_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_011258694.1|920504_921695_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_011258695.1|921697_922525_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027703358.1|922521_923283_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_011258697.1|923300_923858_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011258698.1|924038_924761_-	UMP kinase	NA	NA	NA	NA	NA
WP_011408325.1|924817_925195_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258700.1|925322_926201_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_011258701.1|926370_927174_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011408326.1|927549_928275_-	molecular chaperone	NA	NA	NA	NA	NA
WP_041182086.1|928277_928610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258703.1|928656_929691_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 8
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	984519	1114763	4999360	tRNA,transposase	Ralstonia_phage(20.83%)	93	NA	NA
WP_109181923.1|984519_985839_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408358.1|986173_987100_-	TolC family protein	NA	NA	NA	NA	NA
WP_011258748.1|987229_987835_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_109181924.1|988173_989943_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.5	3.0e-58
WP_027703751.1|989939_990542_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	4.8e-16
WP_011258751.1|990800_991394_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
WP_011258752.1|991592_993029_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
WP_011258753.1|993270_994473_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_011258754.1|994515_997344_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_011408361.1|997524_998457_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408362.1|998453_999953_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_041182090.1|1000289_1000553_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_011258758.1|1000832_1001333_-	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_011258759.1|1001574_1002942_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
WP_109181925.1|1005965_1006728_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408367.1|1008180_1009584_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_042464794.1|1009706_1010129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258770.1|1010761_1011598_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_044756884.1|1011607_1012594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258772.1|1012590_1013466_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
WP_011408371.1|1013462_1013825_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042464800.1|1013827_1014076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408372.1|1014211_1014769_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_027703707.1|1014860_1015826_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408374.1|1015851_1017201_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	2.4e-79
WP_011258777.1|1017193_1017430_+	protein SlyX	NA	NA	NA	NA	NA
WP_042464803.1|1017430_1018183_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_042464805.1|1018516_1019362_+	transporter	NA	NA	NA	NA	NA
WP_109182102.1|1019502_1020678_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011408378.1|1020691_1022002_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011408379.1|1021998_1022985_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011408380.1|1022981_1024187_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_011408381.1|1024573_1027327_-	methionine synthase	NA	NA	NA	NA	NA
WP_011408382.1|1027469_1028609_-	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
WP_011258786.1|1028605_1029601_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
WP_011408383.1|1029689_1030871_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464808.1|1030870_1031011_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464810.1|1031382_1032828_+	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
WP_011258790.1|1033394_1035923_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	4.0e-64
WP_109181926.1|1036133_1036932_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181927.1|1038002_1038764_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_094187736.1|1038796_1039559_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408388.1|1039587_1039935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259046.1|1040093_1041062_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_109181928.1|1042414_1043380_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|1043824_1045009_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011408398.1|1045063_1046539_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.9e-99
WP_109181929.1|1046860_1047043_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_011258800.1|1047191_1048391_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_069960202.1|1049251_1050220_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_109181915.1|1050432_1051752_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258803.1|1051888_1052857_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_109181930.1|1053136_1053935_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181931.1|1054160_1055126_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181932.1|1057355_1058321_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1059352_1060321_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181933.1|1061497_1062600_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-36
WP_027704061.1|1062786_1063254_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408403.1|1063614_1064274_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011258822.1|1064385_1065735_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_094187763.1|1065884_1066683_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408404.1|1067122_1068442_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407175.1|1068654_1069623_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011408405.1|1069686_1070271_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_011258825.1|1070370_1071384_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153296780.1|1072074_1072341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408408.1|1076491_1076791_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_042464821.1|1076794_1076989_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_109181934.1|1077257_1080980_-	avirulence protein	NA	NA	NA	NA	NA
WP_109181935.1|1088662_1089982_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109181936.1|1091813_1092899_-	peptidase C13	NA	NA	NA	NA	NA
WP_011408416.1|1093226_1093925_-	acireductone synthase	NA	NA	NA	NA	NA
WP_011408417.1|1093927_1094494_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_011408418.1|1094505_1095183_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_069959832.1|1095271_1096702_-	amino acid permease	NA	NA	NA	NA	NA
WP_033013325.1|1096778_1098251_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258841.1|1098396_1098984_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011258842.1|1099139_1100381_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
WP_011258843.1|1100589_1102008_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011408424.1|1102042_1102342_+	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_011258845.1|1102338_1104210_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_041182103.1|1104499_1105513_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011258848.1|1105512_1105944_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011258849.1|1105940_1106543_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_011408426.1|1106535_1108473_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011258851.1|1108641_1109112_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011258852.1|1109108_1109279_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_109181937.1|1109275_1110028_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_011258853.1|1110122_1110818_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_011408428.1|1110814_1111459_-	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
WP_011408429.1|1111685_1112834_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011408430.1|1112973_1113777_+	amidohydrolase	NA	NA	NA	NA	NA
WP_109181928.1|1113797_1114763_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	1215410	1326843	4999360	transposase,tRNA	Xanthomonas_phage(61.11%)	96	NA	NA
WP_012444952.1|1215410_1216823_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.2	3.0e-40
WP_094187798.1|1217335_1218134_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258940.1|1218447_1218774_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258941.1|1218783_1219698_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258942.1|1219694_1220990_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_011408488.1|1220986_1222078_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_011258944.1|1222074_1223202_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_011258945.1|1223198_1223801_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011258946.1|1223797_1224532_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_011258947.1|1224525_1225302_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011258948.1|1225291_1225912_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_109181941.1|1226497_1230352_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408491.1|1230576_1230876_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_042464821.1|1230879_1231074_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011258951.1|1235175_1235955_-	pectate lyase	NA	NA	NA	NA	NA
WP_075239627.1|1235996_1236095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182117.1|1236848_1237034_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	93.4	8.6e-25
WP_012444935.1|1237033_1237237_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	70.3	6.1e-16
WP_011258952.1|1237372_1238446_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.9	5.0e-64
WP_011408494.1|1238550_1238850_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	54.2	3.4e-23
WP_011408495.1|1239213_1239453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057497.1|1239559_1241044_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.2	1.4e-40
WP_041182119.1|1241045_1241366_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_011408497.1|1241362_1242547_+	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.4	5.2e-54
WP_109181942.1|1242543_1242774_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	55.6	2.0e-10
WP_109181943.1|1243919_1244144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408500.1|1244343_1244727_+	hypothetical protein	NA	A0A1D6ZIV0	Xanthomonas_phage	100.0	1.7e-70
WP_011408501.1|1244898_1245546_-	conjugal transfer protein TrbP	NA	A0A1D6ZIU7	Xanthomonas_phage	100.0	3.0e-120
WP_011408502.1|1245547_1246735_-	hypothetical protein	NA	A0A1D6ZIU8	Xanthomonas_phage	100.0	2.8e-217
WP_011408503.1|1246734_1247064_-	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	100.0	3.8e-55
WP_042464851.1|1247063_1248470_-	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	100.0	6.4e-245
WP_011408505.1|1248606_1248837_-	hypothetical protein	NA	A0A1D6ZIT7	Xanthomonas_phage	100.0	1.7e-30
WP_042464854.1|1248848_1249052_-	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	100.0	9.8e-30
WP_011408506.1|1249055_1249352_-	DNA-binding protein	NA	A0A1D6ZIU6	Xanthomonas_phage	100.0	3.6e-49
WP_011408507.1|1249348_1250389_-	replication initiation protein	NA	A0A1D6ZIT9	Xanthomonas_phage	100.0	8.2e-205
WP_109181944.1|1250541_1250754_-	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	98.6	1.1e-26
WP_069970101.1|1251066_1251696_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	80.6	2.5e-71
WP_011408511.1|1251820_1252003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168751.1|1252124_1252436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187780.1|1252505_1253268_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|1253601_1254570_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_125168752.1|1254932_1255256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408516.1|1255869_1256382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181945.1|1256511_1257274_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182100.1|1262560_1262755_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_011408491.1|1262758_1263058_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_069964534.1|1263281_1267037_+	avirulence protein	NA	NA	NA	NA	NA
WP_109181946.1|1267126_1267889_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042464821.1|1268120_1268315_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011408491.1|1268318_1268618_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_109181947.1|1268758_1272859_+	avirulence protein	NA	NA	NA	NA	NA
WP_012444927.1|1273077_1273254_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011408520.1|1273250_1273922_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_125168753.1|1274947_1275193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|1275176_1276133_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011409456.1|1276896_1277859_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_041182129.1|1278740_1279706_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182130.1|1279683_1283784_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_011408397.1|1284092_1285277_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_041182131.1|1285327_1286227_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.8e-36
WP_011408524.1|1286393_1286900_+	glyoxalase	NA	NA	NA	NA	NA
WP_011258968.1|1287374_1288007_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011258969.1|1288006_1289863_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011258970.1|1289859_1291278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258971.1|1291301_1291766_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_109182104.1|1291762_1292563_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258973.1|1292832_1293873_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011258974.1|1293869_1295639_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258975.1|1295635_1296100_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011408526.1|1296103_1296766_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011408527.1|1296794_1299203_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_109181948.1|1299456_1300422_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258980.1|1301815_1302550_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_010378794.1|1302542_1303784_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014503500.1|1303807_1304260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408531.1|1304210_1304459_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_011408532.1|1304569_1305352_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_012444910.1|1305368_1305578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258983.1|1305581_1307372_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_011258984.1|1307406_1307793_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_011258985.1|1307789_1308185_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_012444907.1|1308244_1308511_-	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_109181949.1|1308454_1309327_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_011258986.1|1309455_1310553_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
WP_011408534.1|1310985_1312416_+	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
WP_011258988.1|1312412_1313420_+	glucokinase	NA	NA	NA	NA	NA
WP_011258989.1|1313416_1314136_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_011258990.1|1314238_1316155_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011408535.1|1316210_1316870_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_044756829.1|1317090_1318467_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	1.3e-77
WP_094187715.1|1318500_1319264_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703995.1|1319306_1319510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444899.1|1320081_1320258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258994.1|1320525_1320906_+	response regulator	NA	NA	NA	NA	NA
WP_044756830.1|1321119_1324515_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
WP_094187715.1|1326080_1326843_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	1440916	1489016	4999360	transposase,tRNA	Moumouvirus(16.67%)	44	NA	NA
WP_011408598.1|1440916_1442311_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	7.6e-81
WP_011259080.1|1442312_1442570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408599.1|1442566_1442872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408600.1|1442868_1443195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408603.1|1443920_1444583_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_024744799.1|1444671_1445202_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
WP_011408606.1|1447425_1448697_+	kynureninase	NA	NA	NA	NA	NA
WP_011408607.1|1448868_1450236_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_011259089.1|1450539_1451985_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_011259090.1|1451981_1452668_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_011259091.1|1452640_1453660_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011259092.1|1453701_1454262_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_011259093.1|1454282_1455239_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_011408609.1|1455406_1456183_-	NAD kinase	NA	NA	NA	NA	NA
WP_011408610.1|1456666_1458802_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_027703372.1|1458798_1458990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259098.1|1460764_1461271_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259099.1|1461311_1461839_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408612.1|1461835_1462327_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_011408613.1|1462350_1462926_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011259101.1|1463002_1463956_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259102.1|1464044_1464917_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011408616.1|1464913_1465759_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_011408617.1|1465871_1466570_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408618.1|1466733_1467516_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011408619.1|1467524_1467905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259107.1|1467901_1468612_+	endonuclease III	NA	NA	NA	NA	NA
WP_011408621.1|1469921_1470470_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_011258802.1|1470641_1471610_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_044756431.1|1472214_1473450_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_041182144.1|1474013_1474334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259109.1|1474673_1475924_+	porin	NA	NA	NA	NA	NA
WP_011408625.1|1476112_1477132_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.7	1.6e-48
WP_011408626.1|1477319_1478411_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_069959864.1|1478523_1479498_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_069959865.1|1479497_1480367_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011259114.1|1480389_1481220_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011408630.1|1481348_1482059_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_109181952.1|1482191_1482605_+	RcnB family protein	NA	NA	NA	NA	NA
WP_011259117.1|1482888_1483524_+	ribonuclease T	NA	NA	NA	NA	NA
WP_109181953.1|1483594_1484914_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464912.1|1485150_1486212_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|1486262_1487447_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109181954.1|1487696_1489016_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	1495735	1566859	4999360	transposase,protease,tRNA	uncultured_Mediterranean_phage(35.71%)	52	NA	NA
WP_011259125.1|1495735_1496881_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_027703908.1|1496950_1498021_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259127.1|1498207_1498639_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408638.1|1498762_1500259_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011408639.1|1500218_1500533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259129.1|1500603_1501311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259140.1|1504644_1505766_-	phytase	NA	NA	NA	NA	NA
WP_041182147.1|1508038_1508506_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011259142.1|1508656_1509289_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_109181946.1|1509685_1510448_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259143.1|1510728_1511760_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408648.1|1511766_1513560_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_012444765.1|1513556_1513841_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_027703974.1|1514072_1514570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259147.1|1514616_1515123_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_011259148.1|1515119_1515740_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011408651.1|1515980_1517885_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_109181955.1|1517972_1519030_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_109181956.1|1519127_1520447_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239722.1|1520680_1521838_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_109181957.1|1522114_1523080_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181958.1|1523057_1524533_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.2e-76
WP_162013043.1|1524568_1524775_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1527072_1528041_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_075245207.1|1528308_1528542_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011259163.1|1530422_1531643_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011259164.1|1531957_1533355_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011408657.1|1533365_1534583_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011259166.1|1534582_1535221_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011259167.1|1535291_1536152_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011408658.1|1536148_1536937_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_011259169.1|1536947_1538153_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_002812972.1|1538171_1538597_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_011259170.1|1538816_1539449_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259171.1|1539473_1541846_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259172.1|1542003_1543209_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011259173.1|1543529_1544861_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
WP_011408659.1|1544857_1545208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408660.1|1545239_1545647_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_011259175.1|1545643_1545970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182106.1|1546001_1547378_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.1	8.9e-74
WP_011259177.1|1547614_1551781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703232.1|1551893_1552565_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011259180.1|1554719_1557080_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_011259181.1|1557363_1558332_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_011408662.1|1558389_1559511_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_042465566.1|1560938_1561691_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002813418.1|1561771_1561990_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_011259186.1|1562270_1564553_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	8.7e-175
WP_005914463.1|1564696_1565017_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_011408665.1|1565267_1565726_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011259189.1|1565722_1566859_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	1648603	1718939	4999360	tRNA,transposase	Ralstonia_phage(46.15%)	46	NA	NA
WP_109181960.1|1648603_1649923_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|1650072_1651041_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_162597426.1|1651135_1651531_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_011409456.1|1651583_1652546_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109181962.1|1652784_1658025_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	39.8	1.6e-09
WP_011258802.1|1658955_1659924_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407175.1|1661987_1662956_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_125168757.1|1664580_1665060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259260.1|1673184_1673577_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259261.1|1673585_1674047_+	cytochrome c	NA	NA	NA	NA	NA
WP_041182155.1|1674551_1674812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181963.1|1676569_1677535_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181964.1|1677541_1678687_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_069959881.1|1678811_1679780_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	9.6e-99
WP_075239109.1|1681848_1683585_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	1.8e-15
WP_069960108.1|1684101_1685058_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.8e-41
WP_011257031.1|1685217_1686186_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011259269.1|1686942_1687053_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_012444741.1|1687273_1688539_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259272.1|1688519_1690433_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_011408714.1|1690800_1692045_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	2.5e-91
WP_011408715.1|1692209_1693364_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.8	1.2e-47
WP_011259275.1|1693377_1693638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408716.1|1693637_1694003_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408717.1|1694002_1695298_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_041182650.1|1695421_1696372_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_011259279.1|1696984_1698328_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_011259280.1|1698367_1699468_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_011408722.1|1699473_1699926_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259282.1|1700166_1701408_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_011259283.1|1701479_1702505_-	N-acetylornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_027703614.1|1702817_1703312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444736.1|1703488_1704913_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_011408724.1|1705410_1705848_+	SufE family protein	NA	NA	NA	NA	NA
WP_011259287.1|1705844_1707095_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259288.1|1707162_1708224_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_075242610.1|1708366_1709407_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_011408727.1|1709491_1709779_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_011408728.1|1709775_1711125_+	dihydroorotase	NA	NA	NA	NA	NA
WP_011408729.1|1711124_1711964_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.4e-13
WP_094187715.1|1712862_1713625_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259294.1|1713651_1713915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444728.1|1714286_1714775_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_011408734.1|1714998_1716318_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1716454_1717423_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_069964543.1|1717622_1718939_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	1750770	1811859	4999360	transposase,protease,tRNA	Bacillus_virus(22.22%)	47	NA	NA
WP_011259328.1|1750770_1751649_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_011259329.1|1751746_1752646_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_011408747.1|1752733_1753474_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011259331.1|1753633_1754209_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408749.1|1754382_1755354_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_109181965.1|1755387_1756329_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259334.1|1756328_1758206_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_012444702.1|1758343_1760077_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
WP_011259336.1|1760129_1760630_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_075243426.1|1760626_1762114_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_069959886.1|1762138_1763206_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_094187715.1|1763320_1764084_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182164.1|1764167_1765505_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	36.2	1.3e-37
WP_069959887.1|1765800_1767063_-	virulence factor	NA	NA	NA	NA	NA
WP_094187754.1|1767279_1768027_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181966.1|1768343_1770179_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	32.9	5.6e-23
WP_041182166.1|1770450_1771542_+	ribonuclease D	NA	NA	NA	NA	NA
WP_011259345.1|1772634_1773036_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_015463309.1|1773899_1774079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703932.1|1774680_1774971_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011408759.1|1774958_1775237_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_080256628.1|1775721_1775910_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011408760.1|1776682_1777867_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_109181928.1|1778447_1779413_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042465594.1|1783977_1784322_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_011408764.1|1784532_1784859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259352.1|1784891_1785332_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
WP_011259353.1|1785410_1786046_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_027703625.1|1786438_1787197_-	cytochrome c1	NA	NA	NA	NA	NA
WP_011259356.1|1788447_1789092_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011259357.1|1789621_1790608_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_011408766.1|1792543_1793998_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011408767.1|1794421_1795408_+	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
WP_011259362.1|1795819_1796482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259363.1|1796536_1797022_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011408769.1|1797021_1797540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408770.1|1797634_1798513_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011259366.1|1798509_1799790_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011259367.1|1799805_1800807_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_011408772.1|1800958_1802323_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011408773.1|1802577_1802988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408774.1|1803143_1803974_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_075240820.1|1804287_1805535_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
WP_011408777.1|1805680_1807174_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011408778.1|1807178_1808765_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011408779.1|1808761_1809964_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_109181967.1|1810470_1811859_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	1838501	1921877	4999360	transposase	Ralstonia_phage(30.0%)	53	NA	NA
WP_069959890.1|1838501_1839485_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	1.5e-99
WP_011408793.1|1845234_1845894_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408794.1|1845908_1847213_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259395.1|1847225_1850396_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_109181969.1|1851371_1852337_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408798.1|1853043_1854039_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_059317461.1|1854199_1856716_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_011259401.1|1856712_1857669_+	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_069963855.1|1857827_1859570_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_012444645.1|1859747_1861025_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_011258802.1|1861691_1862660_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_155296181.1|1862774_1862930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445230.1|1863020_1864256_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_069959892.1|1864274_1866620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182891.1|1866637_1867369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325293.1|1867400_1869743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503414.1|1869767_1870496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959894.1|1870524_1872867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465604.1|1872891_1873635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325294.1|1873665_1876500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964550.1|1876496_1877426_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069964551.1|1877434_1880197_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.2	1.5e-43
WP_041182637.1|1885079_1885469_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_082325566.1|1886995_1889485_-	avirulence protein	NA	NA	NA	NA	NA
WP_041182637.1|1889524_1889914_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_157724569.1|1890074_1891028_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|1890960_1891275_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_011408815.1|1891502_1892822_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259409.1|1893926_1894343_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_011259410.1|1894339_1894786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259411.1|1895028_1895664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|1896163_1897132_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_125168758.1|1897788_1898289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465618.1|1898597_1901699_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042465003.1|1902688_1903141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756758.1|1903395_1905201_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_125168759.1|1905202_1905550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756757.1|1905625_1906333_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	8.4e-52
WP_011408825.1|1906484_1906877_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011408826.1|1906923_1907415_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703781.1|1907411_1907765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259417.1|1907853_1908594_+	flagellar motor protein	NA	NA	NA	NA	NA
WP_011408827.1|1908600_1909575_+	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_011259419.1|1909576_1910359_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_042465006.1|1910355_1911378_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259421.1|1911478_1911787_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_002806565.1|1911783_1912149_+	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_011408829.1|1912182_1914192_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011408830.1|1914359_1914614_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_103073514.1|1916295_1916982_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.2	2.8e-12
WP_011408833.1|1917297_1918059_+	transporter	NA	NA	NA	NA	NA
WP_011408834.1|1918072_1920415_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	4.5e-09
WP_109181970.1|1920911_1921877_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	2018662	2030437	4999360	tRNA	Escherichia_phage(22.22%)	12	NA	NA
WP_011259503.1|2018662_2018962_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
WP_011259504.1|2019004_2019235_-	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259505.1|2019478_2020228_-	isopentenyl transferase	NA	NA	NA	NA	NA
WP_011408881.1|2020232_2020928_-	hypothetical protein	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_012444559.1|2021113_2021413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057240.1|2021800_2022205_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	56.6	1.1e-32
WP_003481884.1|2022930_2023143_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_011259507.1|2023282_2025931_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_012444556.1|2026032_2026521_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011408884.1|2026823_2027858_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_011408885.1|2028030_2028672_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408886.1|2028760_2030437_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 16
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	2123368	2224496	4999360	plate,transposase	Ralstonia_phage(66.67%)	72	NA	NA
WP_069959920.1|2123368_2124466_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465048.1|2124882_2127963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033013236.1|2130998_2131706_+	response regulator	NA	NA	NA	NA	NA
WP_011408941.1|2131702_2132695_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259589.1|2132691_2135151_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_011259590.1|2135264_2136245_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408942.1|2136253_2137282_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_109181977.1|2137448_2138246_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181978.1|2138308_2139106_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444504.1|2139166_2139493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703483.1|2139489_2142393_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
WP_011259593.1|2142389_2143112_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011408946.1|2143108_2143756_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_011408947.1|2143752_2147211_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011408948.1|2147214_2148531_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_011408949.1|2148532_2149870_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_069959924.1|2149866_2151258_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_011408951.1|2151254_2151794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444497.1|2151802_2153740_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
WP_011408952.1|2154004_2154463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168760.1|2154849_2155344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703476.1|2155409_2155907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408953.1|2156095_2158801_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	4.3e-80
WP_011408954.1|2158833_2159844_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011259602.1|2159807_2161685_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259603.1|2161688_2162192_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011259604.1|2162179_2163013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259605.1|2163048_2163552_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_027703472.1|2163651_2165166_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_024711387.1|2165158_2165665_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_109181902.1|2166968_2168288_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2168500_2169469_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181979.1|2169604_2170921_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257310.1|2171091_2172327_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2172512_2173481_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109181980.1|2173532_2175449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259611.1|2175473_2176211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408961.1|2176241_2178584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465640.1|2178601_2179348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465052.1|2179376_2182211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465054.1|2182868_2184698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445381.1|2184711_2185311_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_012445382.1|2185398_2185755_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_012445383.1|2185751_2186174_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408967.1|2186189_2186423_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_069960235.1|2186449_2186710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181981.1|2188874_2189810_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_042465057.1|2190270_2193984_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_094187765.1|2194509_2195273_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445389.1|2195376_2196024_-	response regulator	NA	NA	NA	NA	NA
WP_011408973.1|2196245_2197007_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011258802.1|2197164_2198133_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408974.1|2198266_2198632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408975.1|2198690_2199122_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011259625.1|2199133_2200396_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011408976.1|2200379_2201672_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011408977.1|2202041_2202812_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011408979.1|2206084_2206342_-	stress-induced protein	NA	NA	NA	NA	NA
WP_011408980.1|2206781_2207765_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011258802.1|2208080_2209049_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408981.1|2209177_2210140_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_153296740.1|2210389_2210548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182195.1|2210579_2210759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|2211123_2212089_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408985.1|2213296_2214274_+	siroheme synthase	NA	NA	NA	NA	NA
WP_042465070.1|2215082_2215277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408987.1|2216670_2217033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408988.1|2217016_2217586_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_011259640.1|2217623_2218877_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011408989.1|2219082_2219460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408991.1|2221388_2222624_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|2223461_2224496_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 17
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	2365604	2426056	4999360	tRNA,protease,transposase	Burkholderia_virus(14.29%)	50	NA	NA
WP_094187736.1|2365604_2366368_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259756.1|2367391_2369758_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011409066.1|2369754_2370429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259758.1|2370638_2371577_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_011259759.1|2371699_2373049_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011259760.1|2373045_2373933_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011409067.1|2374250_2375057_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011259762.1|2375502_2376720_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011409068.1|2376825_2377794_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.2e-09
WP_011259764.1|2378178_2378847_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_011259765.1|2378843_2379617_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_075241401.1|2380190_2382143_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|2382823_2383849_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409070.1|2383933_2385007_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
WP_011259771.1|2384999_2386103_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_011259772.1|2386113_2387040_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011259773.1|2387120_2387771_+	SCO family protein	NA	NA	NA	NA	NA
WP_011409071.1|2387767_2388616_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_041182211.1|2389166_2390750_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
WP_103057205.1|2392172_2393390_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_153296738.1|2393350_2393638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409076.1|2393748_2394255_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_011259780.1|2394376_2395777_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_012445553.1|2396039_2396615_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011409078.1|2396611_2397046_+	HIT family protein	NA	NA	NA	NA	NA
WP_011259783.1|2397990_2398176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259784.1|2398210_2398780_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_011259785.1|2398872_2399724_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259787.1|2401111_2403127_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_012445555.1|2403397_2404096_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409081.1|2404136_2404544_-	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_011409082.1|2404981_2405944_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409084.1|2407227_2408478_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011409085.1|2408485_2409730_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011259794.1|2409957_2410437_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027704197.1|2410547_2411084_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259796.1|2411193_2411943_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_011259797.1|2412150_2412642_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_125168763.1|2412654_2412882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409088.1|2413755_2415075_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_109181983.1|2415217_2416924_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011409090.1|2416957_2418262_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011259802.1|2418293_2418554_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011409091.1|2418555_2419431_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_027704198.1|2421265_2421730_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_012445570.1|2421781_2421970_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_069963878.1|2421942_2422263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465665.1|2422259_2423627_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011409095.1|2423772_2424354_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_011259808.1|2424610_2426056_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 18
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	2445156	2495304	4999360	transposase,integrase,tRNA	Ralstonia_phage(33.33%)	37	2469421:2469480	2486091:2486754
WP_011259825.1|2445156_2447799_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_011259826.1|2447871_2448483_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011409107.1|2448687_2449545_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_011409108.1|2449800_2450250_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_109181928.1|2450549_2451515_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|2451639_2452402_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704065.1|2453012_2453306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407489.1|2453900_2455220_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109181985.1|2455289_2455490_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_011409111.1|2455523_2456537_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259831.1|2456504_2456696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181986.1|2456786_2458106_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182217.1|2458193_2459408_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_011259834.1|2459553_2460081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181987.1|2460077_2461043_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187771.1|2461283_2462046_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409116.1|2462348_2464481_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011258529.1|2465031_2466000_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011258803.1|2466160_2467129_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_052285784.1|2468285_2468618_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|2468614_2469378_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
2469421:2469480	attL	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTC	NA	NA	NA	NA
WP_094187763.1|2470249_2471047_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409118.1|2471080_2471473_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_027704094.1|2471563_2471956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239728.1|2474294_2474714_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
WP_012445601.1|2476430_2478215_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_011259851.1|2478405_2478606_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011409125.1|2479141_2479936_+	thiazole synthase	NA	NA	NA	NA	NA
WP_011259853.1|2480237_2480996_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011259854.1|2481071_2482934_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_011409127.1|2482991_2483333_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259856.1|2483592_2483868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409129.1|2486914_2487628_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
2486091:2486754	attR	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTCAGCACAAGCCCAAACGCGGATGACGGCGTACAACGGCGGCCACACGCAGCTGGGTGCCGGAGGAGTTGCGGATTGTGCATCGCCCCGAAGAAGTGCAGACGCGCTTGGTCCCAGGTCATTGGGAAGGCGACTTGATCAAGGGCGCATTCAATCGTTCTTGCGTGGGCACGTTGGTGGAACGCAAGACGCGCTTTGTCGTGCTGTGCCGCATGGATGGCTGCACGGCCGCAGATGCGCTGGAAGGGTTTACCCGGCAAATGAAGAAACTGCCGGCCTCAATGCGGACAAGTCTGACCTACGATCGCGGTACCGAGCTCACGTGCTACGCCGAGCTGATGCAAGGATTGAACATCGACGTGTGGTTCGCTGATCCACATGCGCCGTGGCAGCGGGGAAGTAACGAGAACACCAACGGCCTGCTGCGCCAATTCCTGCCCAAGGGCGCCGACCTGTCCACTGTCAGCCAAGAGTATCTCAATCACATCGCACTGCTGATGAATACCCGCCCTCGTCAGACGCTCGGATGGAAGACACCAAGCGAGGCAATGGAGGAAGAAATCGCAGCACTCAAATCACGTGTTGCACTTGAATCTTGAGACTGCCC	NA	NA	NA	NA
WP_012445603.1|2487688_2488111_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_094187715.1|2488242_2489006_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409134.1|2492079_2492991_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_109181988.1|2494338_2495304_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	2542754	2613663	4999360	plate,transposase	Ralstonia_phage(15.38%)	48	NA	NA
WP_011407175.1|2542754_2543723_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407587.1|2544743_2545778_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011259895.1|2546161_2546887_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409154.1|2547018_2547480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704153.1|2550646_2552767_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_027704154.1|2553033_2553879_-	transporter	NA	NA	NA	NA	NA
WP_011257031.1|2554870_2555839_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011259903.1|2556163_2558134_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_011259904.1|2558562_2559960_+	endoproteinase ArgC	NA	NA	NA	NA	NA
WP_027704156.1|2560072_2560891_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011259907.1|2561201_2564453_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	6.1e-81
WP_011259908.1|2564634_2566053_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_011259909.1|2566062_2566713_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_011409164.1|2566714_2567320_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
WP_011259911.1|2567469_2567691_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409165.1|2567700_2568126_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	48.5	5.8e-08
WP_094187731.1|2568617_2569415_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075240009.1|2570492_2571239_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011409168.1|2571485_2572115_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027704159.1|2572175_2572931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069963882.1|2573259_2574036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182229.1|2574444_2576019_+	protein kinase	NA	NA	NA	NA	NA
WP_011409172.1|2576267_2576534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964578.1|2576812_2579992_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.3	4.6e-73
WP_069963885.1|2579991_2580666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959956.1|2580665_2581412_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_075242182.1|2581408_2582920_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_011409179.1|2582912_2583347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182476.1|2583357_2584887_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	29.3	2.5e-45
WP_011409181.1|2585189_2586182_-	restriction endonuclease	NA	A0A1B1IUE7	uncultured_Mediterranean_phage	29.2	1.5e-30
WP_044756557.1|2586234_2586543_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_109182111.1|2587123_2590597_+	type I restriction-modification system endonuclease	NA	A0A1B1IW48	uncultured_Mediterranean_phage	21.9	1.9e-08
WP_109181989.1|2590736_2591735_+	Abi family protein	NA	NA	NA	NA	NA
WP_011409185.1|2591781_2593326_+	type I restriction-modification system subunit M	NA	A0A220A2U5	Liberibacter_phage	23.9	2.0e-13
WP_011409186.1|2593318_2594671_+	type I restriction endonuclease StySPI subunit S	NA	NA	NA	NA	NA
WP_011259929.1|2594704_2595013_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011259930.1|2595019_2595283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082323166.1|2596004_2596760_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_109181990.1|2597053_2598085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181991.1|2598093_2600028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181992.1|2599939_2600902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181993.1|2600979_2603844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181994.1|2603862_2604768_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069963891.1|2604709_2607481_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	5.1e-44
WP_011259938.1|2607573_2607927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259939.1|2607957_2610687_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_011259940.1|2610772_2611864_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_069959967.1|2611827_2613663_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 20
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	3031208	3142213	4999360	transposase	Ralstonia_phage(21.05%)	76	NA	NA
WP_109182118.1|3031208_3032816_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_082323409.1|3033013_3033241_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_075242321.1|3033245_3033905_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	7.1e-13
WP_011260279.1|3034091_3035456_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_011409411.1|3035671_3036367_+	VIT family protein	NA	NA	NA	NA	NA
WP_011409413.1|3037313_3037937_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011260283.1|3038081_3038879_+	cytochrome c4	NA	NA	NA	NA	NA
WP_011409415.1|3038972_3039623_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260284.1|3039714_3040530_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011409416.1|3040579_3041317_+	endonuclease	NA	NA	NA	NA	NA
WP_011409419.1|3043245_3044235_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_109182011.1|3044357_3046931_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_109182012.1|3047123_3047886_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|3047959_3048928_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011409421.1|3049661_3049928_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094187728.1|3050859_3051658_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260292.1|3053304_3054537_+	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_011409423.1|3054576_3055539_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|3055714_3056671_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011258802.1|3056882_3057851_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187715.1|3058186_3058949_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182013.1|3062359_3063325_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012444134.1|3063786_3064017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409428.1|3064641_3066684_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_011409429.1|3066685_3068584_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_011260297.1|3068585_3069839_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_011260298.1|3069835_3070441_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_011409430.1|3070860_3072015_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_011260300.1|3072017_3073046_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_011409431.1|3073042_3074119_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260302.1|3074159_3075437_-	sugar MFS transporter	NA	NA	NA	NA	NA
WP_011409432.1|3075481_3076249_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409433.1|3076463_3077630_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_011260306.1|3080173_3083071_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
WP_011260307.1|3083221_3085912_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409437.1|3086193_3087150_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.6e-42
WP_109182014.1|3087640_3088876_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260311.1|3090311_3091496_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011409442.1|3091563_3092301_+	pteridine reductase	NA	NA	NA	NA	NA
WP_011260313.1|3092469_3092985_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011260314.1|3093076_3094579_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
WP_011260315.1|3094582_3095023_-	response regulator	NA	NA	NA	NA	NA
WP_011409443.1|3095019_3096831_-	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
WP_011260317.1|3097116_3097488_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_011260318.1|3097638_3098691_+	oxidoreductase	NA	NA	NA	NA	NA
WP_011260319.1|3099030_3099972_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.9	5.9e-69
WP_075239460.1|3099992_3101330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409446.1|3101501_3101882_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_012444115.1|3102006_3102768_-	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_011409450.1|3105016_3106420_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	51.5	8.1e-131
WP_011260326.1|3106542_3107598_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.3e-80
WP_103057229.1|3107770_3108625_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011260328.1|3108916_3111100_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.6	2.8e-82
WP_011260329.1|3111598_3112693_-	type II restriction enzyme	NA	NA	NA	NA	NA
WP_155296183.1|3114594_3114744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260331.1|3114744_3115758_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_011260332.1|3115772_3116471_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_011409453.1|3116458_3116737_-	YbeD family protein	NA	NA	NA	NA	NA
WP_011260334.1|3117802_3119008_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	4.6e-66
WP_011260335.1|3119508_3120924_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_011260336.1|3120920_3122060_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_125168765.1|3123284_3123827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409455.1|3123798_3125073_-	DUF3380 domain-containing protein	NA	B3FJ91	Pseudomonas_phage	33.7	1.2e-21
WP_075242420.1|3125072_3125291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409456.1|3125367_3126330_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_115840194.1|3126209_3128345_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011409458.1|3128341_3129421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182015.1|3129417_3130902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409460.1|3130960_3131956_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011260340.1|3132717_3133836_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_011409461.1|3133832_3135893_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_011409462.1|3135896_3136382_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_012444096.1|3137896_3138943_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.2	4.6e-06
WP_011260344.1|3139218_3140151_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_011257031.1|3140391_3141360_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_094187763.1|3141415_3142213_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	3194482	3270830	4999360	transposase	Ralstonia_phage(33.33%)	56	NA	NA
WP_094187715.1|3194482_3195246_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704042.1|3196293_3197079_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_075243437.1|3197332_3199024_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_011409497.1|3199567_3200014_-	autotransporter	NA	NA	NA	NA	NA
WP_012444053.1|3200344_3200629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703841.1|3201223_3202135_-	magnesium transporter	NA	NA	NA	NA	NA
WP_027703842.1|3202380_3203376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757313.1|3203469_3204846_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_041182283.1|3206066_3207713_+	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_044756397.1|3208121_3209894_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_044756396.1|3210169_3211045_-	DMT family transporter	NA	NA	NA	NA	NA
WP_044757311.1|3211242_3212121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033013384.1|3212212_3212815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260398.1|3214160_3215252_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_041182286.1|3217154_3219479_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_109182018.1|3219674_3221621_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409509.1|3221995_3222187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260404.1|3222577_3224161_+	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_027704189.1|3224508_3225105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960267.1|3226453_3227302_-	threonine aldolase	NA	NA	NA	NA	NA
WP_011409514.1|3227336_3228812_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
WP_011260408.1|3229430_3230360_-	lipid kinase YegS	NA	NA	NA	NA	NA
WP_011260409.1|3230594_3231086_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260410.1|3231082_3231754_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011409516.1|3232148_3232478_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_044757306.1|3234085_3234763_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	60.3	8.8e-75
WP_011409520.1|3237280_3237766_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_011409522.1|3238304_3241133_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_011409523.1|3241132_3241507_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_069960013.1|3241503_3243048_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_044756383.1|3243044_3243551_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_011260421.1|3243547_3243832_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_011260422.1|3243828_3244182_+	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
WP_103057261.1|3244629_3244968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|3245151_3246120_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011409528.1|3246551_3247877_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_162597427.1|3248241_3249357_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_069960268.1|3249475_3249970_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409530.1|3250326_3250917_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_109182020.1|3250928_3252437_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.4	1.1e-61
WP_011260428.1|3252879_3253773_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_011409533.1|3255155_3255821_+	pyruvate dehydrogenase E1 subunit alpha	NA	NA	NA	NA	NA
WP_109182021.1|3256453_3257419_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260435.1|3257951_3258332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080493654.1|3258534_3259437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409537.1|3259508_3260804_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_011409538.1|3260933_3261458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260439.1|3261883_3263149_-	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_011409539.1|3263145_3264123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444011.1|3264226_3265030_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_109182022.1|3265205_3266015_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_109182023.1|3266022_3266821_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465763.1|3266863_3267481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409543.1|3267605_3268181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181902.1|3268392_3269712_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011409545.1|3269861_3270830_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 22
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	3278581	3337624	4999360	tRNA,transposase	Acinetobacter_phage(37.5%)	50	NA	NA
WP_094187763.1|3278581_3279380_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099051302.1|3279433_3280232_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409552.1|3280451_3281414_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182024.1|3281861_3282625_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260456.1|3282906_3283683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409554.1|3283679_3284996_+	amino acid permease	NA	NA	NA	NA	NA
WP_011408623.1|3285512_3286748_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260459.1|3287341_3287623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960022.1|3288183_3288621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|3288623_3289592_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409559.1|3289952_3291131_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_069960023.1|3292126_3293089_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260467.1|3295422_3297594_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_109182026.1|3297821_3298178_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_069964611.1|3298256_3299321_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.6	4.3e-100
WP_002808376.1|3299600_3299816_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_011409564.1|3300138_3300585_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.2	1.0e-23
WP_012443989.1|3302062_3303025_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_011260472.1|3303114_3304863_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
WP_041182298.1|3306190_3306436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059317500.1|3306435_3306702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013369.1|3306926_3307973_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_011409569.1|3308156_3309737_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011409570.1|3310125_3311022_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_011260477.1|3311024_3312188_-	heme A synthase	NA	NA	NA	NA	NA
WP_011260478.1|3312198_3312774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409571.1|3312801_3313521_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_012443949.1|3313581_3313800_+	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_011260481.1|3313899_3314775_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_012443948.1|3314813_3315410_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_011260484.1|3315560_3317165_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_069964612.1|3317203_3318157_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_044757542.1|3318173_3318650_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_011260487.1|3318926_3322127_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_109182027.1|3323342_3324308_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_069960028.1|3324320_3324791_-	bacterioferritin	NA	NA	NA	NA	NA
WP_027703893.1|3325133_3325349_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011260490.1|3325429_3326047_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005990700.1|3326595_3326988_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011260491.1|3326991_3327420_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_069960112.1|3327605_3328259_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_011409578.1|3328515_3328830_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011260494.1|3328989_3329784_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_011260495.1|3329921_3330614_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_011409579.1|3330934_3331651_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011260497.1|3331643_3332441_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
WP_011409580.1|3332577_3333615_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
WP_011260499.1|3333732_3334362_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011409581.1|3334513_3335095_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
WP_094187806.1|3336522_3337624_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
>prophage 23
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	3342510	3433536	4999360	tRNA,integrase,transposase	Acidithiobacillus_phage(15.38%)	55	3342392:3342412	3408906:3408926
3342392:3342412	attL	ATAGTCGCCCCTGAAAAACCG	NA	NA	NA	NA
WP_069964614.1|3342510_3343887_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.5	3.7e-80
WP_094187777.1|3346094_3346893_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069964474.1|3347877_3348846_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_069960033.1|3349012_3349984_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	7.2e-38
WP_109182028.1|3350176_3351361_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011260517.1|3351828_3352644_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_011409596.1|3353402_3354719_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011260520.1|3354978_3356223_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011260521.1|3356315_3359564_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_011409597.1|3359697_3362838_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011409598.1|3363127_3364495_-	VOC family protein	NA	NA	NA	NA	NA
WP_109181928.1|3365239_3366205_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109182029.1|3366623_3367589_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_027703675.1|3368051_3368522_+	thioesterase	NA	NA	NA	NA	NA
WP_011409601.1|3368550_3368973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260528.1|3369048_3369483_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011260529.1|3369592_3370108_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011409602.1|3370123_3371149_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011260531.1|3371471_3372068_-	Ax21 family protein	NA	NA	NA	NA	NA
WP_011260532.1|3372425_3374153_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_011260533.1|3374202_3375645_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011260534.1|3375629_3376976_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409603.1|3377166_3377916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260536.1|3378017_3378629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260537.1|3378733_3379957_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260538.1|3380298_3380775_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011409604.1|3380801_3381263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010370565.1|3381648_3381969_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_011260540.1|3382070_3383087_+	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011260541.1|3383158_3384322_+	Fic family protein	NA	NA	NA	NA	NA
WP_011260542.1|3384318_3385950_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.5	1.7e-63
WP_011409605.1|3385957_3388453_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_011260544.1|3388449_3389352_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409606.1|3389573_3389957_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011260546.1|3390275_3391946_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_011409607.1|3392174_3393185_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.6	1.5e-14
WP_011260548.1|3393249_3393408_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_011260549.1|3393642_3395019_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
WP_041182305.1|3395029_3395563_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409609.1|3395991_3397251_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_011260552.1|3397389_3398697_-	MFS transporter	NA	NA	NA	NA	NA
WP_011407587.1|3400781_3401816_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011409611.1|3402166_3402712_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_011409612.1|3402737_3403004_-	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011260556.1|3403178_3405017_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011260557.1|3405247_3406123_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.5	5.3e-56
WP_012445230.1|3407608_3408844_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_075240199.1|3411820_3412720_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
3408906:3408926	attR	CGGTTTTTCAGGGGCGACTAT	NA	NA	NA	NA
WP_011260561.1|3413667_3416469_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
WP_011409617.1|3416545_3416836_+	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_075240612.1|3418399_3418990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133260589.1|3419130_3420036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014504812.1|3420225_3422913_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_109182031.1|3425973_3426942_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.8e-97
WP_011409629.1|3433023_3433536_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	68.8	1.6e-44
>prophage 24
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	3531567	3589870	4999360	tRNA,transposase	Leptospira_phage(33.33%)	33	NA	NA
WP_109182036.1|3531567_3532533_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260658.1|3532633_3533059_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094187715.1|3533101_3533864_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260659.1|3533926_3534958_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.0e-70
WP_011260660.1|3536318_3537575_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011260661.1|3537571_3538462_+	allantoinase PuuE	NA	NA	NA	NA	NA
WP_012443820.1|3538458_3538854_+	DUF3225 domain-containing protein	NA	NA	NA	NA	NA
WP_075239612.1|3538873_3539452_+	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_115801912.1|3539337_3540195_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_011409690.1|3540127_3541516_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260667.1|3546302_3548387_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011260668.1|3548486_3550514_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011260669.1|3550756_3552367_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
WP_011260670.1|3552377_3553541_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011409694.1|3553669_3554290_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260672.1|3554851_3555187_-	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_075242289.1|3556811_3557123_-	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_011409699.1|3558241_3558760_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_011409700.1|3559031_3560750_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_011260679.1|3560840_3561227_-	MerC family mercury resistance protein	NA	NA	NA	NA	NA
WP_011260680.1|3561288_3562614_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_027703459.1|3562728_3563301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260682.1|3564139_3564865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409701.1|3565081_3565744_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409702.1|3565822_3566917_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_011409705.1|3568421_3571181_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.9	3.5e-146
WP_011409706.1|3571433_3573023_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_011409707.1|3573022_3575260_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_011409708.1|3575548_3576457_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011409709.1|3576546_3578361_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_153303324.1|3578746_3587572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182038.1|3587670_3588468_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409735.1|3588550_3589870_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	3600121	3676308	4999360	tail,transposase,tRNA	Arthrobacter_phage(25.0%)	49	NA	NA
WP_011260702.1|3600121_3601039_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_011259480.1|3601642_3602980_+	xylose isomerase	NA	NA	NA	NA	NA
WP_011409721.1|3603205_3604273_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409722.1|3604448_3606644_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409723.1|3606640_3608605_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409724.1|3608616_3609876_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_011260707.1|3609875_3611576_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011260708.1|3611578_3614293_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260709.1|3614515_3615988_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_011260711.1|3616965_3618021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260712.1|3618248_3619667_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_011409725.1|3619707_3620685_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_042465333.1|3622101_3623403_-	MFS transporter	NA	NA	NA	NA	NA
WP_011409727.1|3623864_3626798_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409728.1|3626896_3628384_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260718.1|3628415_3629450_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_094187716.1|3629866_3630664_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182039.1|3631970_3632927_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_109182040.1|3633654_3634417_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075242372.1|3634434_3635535_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011260725.1|3635600_3636722_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_011409734.1|3636731_3637808_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260727.1|3637900_3638581_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_109182041.1|3638613_3639412_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409735.1|3639540_3640860_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465802.1|3640962_3641919_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.4e-41
WP_011260733.1|3643385_3643844_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409738.1|3643945_3644374_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_069960048.1|3644620_3645484_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_042465346.1|3648660_3648927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260739.1|3649088_3649337_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_109182042.1|3649545_3650304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465805.1|3650300_3650996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409745.1|3651094_3651427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409747.1|3651898_3652333_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_069960049.1|3652448_3652694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260743.1|3653029_3653362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703652.1|3653811_3655206_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011260746.1|3656133_3656424_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	53.8	1.5e-15
WP_012443754.1|3656441_3656723_-	plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	40.7	3.1e-10
WP_069960050.1|3656817_3659070_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	21.9	1.8e-10
WP_044756262.1|3659257_3663331_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.5	4.1e-10
WP_109182043.1|3663327_3666741_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_133260594.1|3666776_3667079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182044.1|3667146_3669801_+	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	26.6	1.1e-48
WP_075250760.1|3674043_3674286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409756.1|3674571_3675117_+|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_011260754.1|3675185_3675713_+|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011260755.1|3675771_3676308_+|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
>prophage 26
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	3830456	3884539	4999360	transposase,protease,tRNA	Ralstonia_phage(33.33%)	39	NA	NA
WP_011260886.1|3830456_3831242_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409856.1|3831371_3832472_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_011409859.1|3835197_3836055_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_044757272.1|3836213_3837554_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_011409861.1|3837718_3840421_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011409862.1|3840499_3842236_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_011409863.1|3842261_3842699_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_002805908.1|3842737_3842878_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_011407161.1|3843120_3844449_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_011257008.1|3844726_3845827_+	DNA polymerase III subunit beta	NA	A0A0A8IL17	Aurantimonas_phage	37.9	2.5e-55
WP_011257009.1|3847077_3848184_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_011407163.1|3848298_3850743_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.7	1.3e-112
WP_011407164.1|3850810_3851647_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011407165.1|3851833_3852640_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|3852916_3854110_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011257014.1|3854263_3854935_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257015.1|3855019_3855781_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|3855827_3856250_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|3856253_3856667_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_109182051.1|3856962_3857730_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|3857740_3858010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407167.1|3858084_3859545_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011257020.1|3860192_3861203_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|3861474_3862677_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|3862818_3864957_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|3865167_3865461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296734.1|3865492_3865990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257024.1|3866236_3867217_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	1.6e-88
WP_011257025.1|3867264_3868431_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_069959658.1|3868577_3869144_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_069959660.1|3870618_3871827_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011257029.1|3872454_3873477_-	sugar kinase	NA	NA	NA	NA	NA
WP_041181893.1|3874057_3874297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|3874299_3875268_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_129215536.1|3876887_3877595_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.6e-05
WP_109182052.1|3878196_3879573_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.5	9.2e-79
WP_012443643.1|3882585_3882828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443642.1|3882769_3883093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257128.1|3883558_3884539_-|transposase	IS5-like element ISXoo7 family transposase	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
>prophage 27
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	3892430	4043236	4999360	transposase	Ralstonia_phage(35.71%)	104	NA	NA
WP_011407913.1|3892430_3893645_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_094187731.1|3894165_3894963_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182053.1|3896678_3897644_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_125168734.1|3897640_3897919_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_109182054.1|3898062_3899451_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407197.1|3899498_3900545_+	methylamine utilization protein	NA	NA	NA	NA	NA
WP_011407198.1|3900685_3901183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703730.1|3901346_3901979_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_011257110.1|3901995_3904158_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011407199.1|3904272_3904458_-	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_011257109.1|3904480_3907084_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_094187819.1|3907080_3908970_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_011257107.1|3909026_3910784_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_011407200.1|3910786_3913021_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_027703733.1|3913017_3914601_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_011257104.1|3915074_3916703_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_011257103.1|3916699_3918064_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_011257102.1|3918256_3919198_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_011407202.1|3919438_3921163_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
WP_109181945.1|3921169_3921933_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407204.1|3921992_3922253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182843.1|3922271_3924830_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_011257097.1|3925014_3925356_+	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_011257094.1|3927571_3929125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257093.1|3929588_3930152_-	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	38.5	4.4e-11
WP_011257092.1|3930527_3930947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|3931409_3932378_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011257091.1|3932845_3934663_-	type III secretion system outer membrane ring subunit SctC	NA	NA	NA	NA	NA
WP_011257090.1|3934745_3935576_-	type III secretion system export apparatus protein SctT	NA	NA	NA	NA	NA
WP_011257089.1|3935572_3936082_-	type III secretion protein HrpB7	NA	NA	NA	NA	NA
WP_011257088.1|3936074_3937403_-	type III secretion system ATPase SctN	NA	NA	NA	NA	NA
WP_011257087.1|3937392_3938094_-	type III secretion system stator protein SctL	NA	NA	NA	NA	NA
WP_011257086.1|3938078_3938708_-	type III secretion protein HrpB4	NA	NA	NA	NA	NA
WP_011257085.1|3938715_3939477_-	type III secretion inner membrane ring lipoprotein SctJ	NA	NA	NA	NA	NA
WP_011407211.1|3939478_3939871_-	type III secretion protein HrpB2	NA	NA	NA	NA	NA
WP_011257083.1|3939904_3940360_-	HrpB1 family type III secretion system apparatus protein	NA	NA	NA	NA	NA
WP_012443605.1|3940574_3941654_+	type III secretion system export apparatus subunit SctU	NA	NA	NA	NA	NA
WP_011257081.1|3941647_3943585_+	hypersensitivity response secretion protein hrcV	NA	NA	NA	NA	NA
WP_027704247.1|3943584_3944226_+	type III secretion system protein SctP	NA	NA	NA	NA	NA
WP_027704248.1|3944318_3945272_+	type III secretion system cytoplasmic ring protein SctQ	NA	NA	NA	NA	NA
WP_011407215.1|3945258_3945903_+	type III secretion system export apparatus protein SctR	NA	NA	NA	NA	NA
WP_011257077.1|3945907_3946168_+	type III secretion system export apparatus subunit SctS	NA	NA	NA	NA	NA
WP_011257076.1|3946164_3946992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257075.1|3946988_3947927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257074.1|3947936_3948179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257073.1|3948259_3948541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257072.1|3948595_3949066_+	protein HpaB	NA	NA	NA	NA	NA
WP_109182055.1|3951460_3951907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|3953608_3954577_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011257310.1|3954703_3955939_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109182056.1|3956109_3957429_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407219.1|3957617_3958601_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_109182057.1|3958971_3960207_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407220.1|3960642_3963015_+	HPr kinase	NA	NA	NA	NA	NA
WP_011257061.1|3963890_3965519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407223.1|3966076_3966460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407224.1|3966456_3966942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407225.1|3966945_3967308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407226.1|3967424_3968861_-	Do family serine endopeptidase	NA	W5SAB9	Pithovirus	30.7	1.5e-10
WP_011407227.1|3969102_3969954_+	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
WP_011257053.1|3970413_3970731_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011257052.1|3971036_3971924_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_011407229.1|3972630_3973581_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.9	3.0e-97
WP_125168735.1|3973694_3973904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407230.1|3973971_3974232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257048.1|3974284_3974566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407231.1|3974704_3975763_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011407232.1|3975903_3976851_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
WP_011407233.1|3977105_3977417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|3978883_3979354_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011257042.1|3979523_3980216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257041.1|3980307_3980706_+	host attachment protein	NA	NA	NA	NA	NA
WP_011407237.1|3981507_3982464_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_044756192.1|3982438_3982909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407238.1|3983100_3984348_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011407239.1|3985571_3986261_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	1.3e-36
WP_011257145.1|3986273_3987431_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_011257146.1|3987443_3988754_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_027703668.1|3990629_3990881_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_075239626.1|3991333_3991735_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011407243.1|3991758_3991989_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011407244.1|3992055_3992718_-	hemolysin III	NA	NA	NA	NA	NA
WP_011407245.1|3992905_3995401_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	36.0	1.5e-07
WP_042464339.1|3995397_3997224_+	ribonuclease H-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407248.1|3997712_3999857_-	avirulence protein	NA	NA	NA	NA	NA
WP_011407249.1|4000047_4001205_-	ROK family protein	NA	NA	NA	NA	NA
WP_042464342.1|4001377_4003966_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257157.1|4003976_4004762_+	DUF1868 domain-containing protein	NA	NA	NA	NA	NA
WP_042465397.1|4005075_4006266_-	saccharopine dehydrogenase	NA	NA	NA	NA	NA
WP_011407253.1|4007365_4007671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042464345.1|4007992_4009246_-	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	35.2	1.9e-38
WP_011257161.1|4009302_4009683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257162.1|4009884_4014357_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_011257163.1|4014550_4016032_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_109182058.1|4017269_4018235_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187801.1|4019670_4020469_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082325201.1|4020707_4022090_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	4.7e-75
WP_011407263.1|4023491_4024520_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_103057315.1|4024692_4024788_-	xylosidase	NA	NA	NA	NA	NA
WP_011407264.1|4024763_4025291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464354.1|4026113_4028297_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_011407267.1|4028308_4031659_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_011407268.1|4031655_4034772_-	DUF3416 domain-containing protein	NA	NA	NA	NA	NA
WP_011407278.1|4041916_4043236_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	4067988	4240388	4999360	transposase,holin,tRNA	Bacillus_phage(15.79%)	115	NA	NA
WP_011257198.1|4067988_4069893_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_075239321.1|4070153_4070333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407290.1|4070466_4070934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257199.1|4071091_4072051_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_011407291.1|4072035_4072653_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011257200.1|4072695_4073115_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_011257201.1|4073367_4074273_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	39.2	4.4e-37
WP_011257202.1|4074521_4075406_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_011257203.1|4075469_4076252_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407292.1|4076296_4077058_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_011257206.1|4077221_4077551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407293.1|4077869_4078961_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_011407294.1|4079029_4080628_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_011407295.1|4080792_4082037_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_011257210.1|4082488_4083118_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	3.3e-52
WP_011257211.1|4083324_4085301_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.2	1.1e-112
WP_011407298.1|4086687_4087353_-	YceH family protein	NA	NA	NA	NA	NA
WP_011257214.1|4087639_4088650_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_011257215.1|4088646_4089378_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_011257216.1|4089731_4091261_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	1.0e-46
WP_011407300.1|4091370_4094403_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257218.1|4094701_4097740_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257219.1|4097904_4098957_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_075240491.1|4099125_4099371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407301.1|4099369_4100335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257221.1|4100334_4102995_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_008573820.1|4104812_4105016_-	YdcH family protein	NA	NA	NA	NA	NA
WP_109182059.1|4105549_4106651_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	2.1e-41
WP_011257226.1|4108655_4109300_-	DUF4375 domain-containing protein	NA	NA	NA	NA	NA
WP_011257227.1|4109440_4110331_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_011407307.1|4110458_4110941_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257232.1|4113976_4114510_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_011407313.1|4117325_4118384_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
WP_011257237.1|4118691_4119765_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257238.1|4120527_4121580_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257239.1|4122227_4123358_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257241.1|4124681_4125071_+	YchJ family protein	NA	NA	NA	NA	NA
WP_011407316.1|4125278_4125485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|4125716_4126685_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011257243.1|4126938_4129101_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011407318.1|4129648_4130953_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011407319.1|4131012_4131615_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011257245.1|4131611_4133516_+	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_011407325.1|4142835_4143651_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_041182297.1|4143997_4144960_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182012.1|4145064_4145827_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257253.1|4147626_4148685_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011257254.1|4148695_4148986_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257255.1|4148975_4149638_-	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_012446379.1|4149634_4150186_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257257.1|4150197_4150947_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407332.1|4150946_4151741_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257259.1|4152125_4152413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703982.1|4152431_4152989_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182061.1|4153006_4153972_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407336.1|4154816_4155773_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	2.9e-39
WP_109182012.1|4155844_4156607_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182062.1|4156646_4157445_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407338.1|4157576_4158791_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
WP_109182063.1|4158850_4159681_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257269.1|4159843_4161079_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011257271.1|4162476_4162905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407344.1|4162915_4163365_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257273.1|4163345_4163573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407346.1|4163880_4165635_-	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
WP_109182012.1|4166575_4167338_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703800.1|4167391_4167976_-	gluconokinase	NA	NA	NA	NA	NA
WP_011407349.1|4168133_4169516_+	MFS transporter	NA	NA	NA	NA	NA
WP_044757567.1|4169518_4171918_+	NdvB protein	NA	NA	NA	NA	NA
WP_109182064.1|4172021_4174664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257279.1|4175411_4178861_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011407353.1|4179053_4179638_-	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011407354.1|4180114_4180891_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069959686.1|4181071_4182373_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011257283.1|4182375_4182735_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_011257284.1|4183171_4184653_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
WP_109182027.1|4184845_4185811_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407357.1|4186637_4188800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182065.1|4188926_4191095_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011257288.1|4191732_4192362_-|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_011257289.1|4192364_4192796_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011257290.1|4192852_4193431_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_027703865.1|4193526_4194279_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_011257292.1|4194503_4194893_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011257293.1|4195006_4196680_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
WP_044757204.1|4196676_4197321_-	sterol-binding protein	NA	NA	NA	NA	NA
WP_011407366.1|4201005_4201290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182066.1|4201641_4202440_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|4202499_4203263_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182067.1|4207218_4208184_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042464374.1|4209244_4210351_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465421.1|4212144_4213083_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_080493948.1|4213201_4213990_-	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	4.5e-54
WP_012446343.1|4213953_4214745_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257314.1|4214762_4215758_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
WP_075242284.1|4215794_4216622_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_109182068.1|4216706_4217702_-	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_011407380.1|4217766_4218039_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_153296754.1|4218159_4218321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465424.1|4218524_4219112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257320.1|4219108_4219309_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011407383.1|4219369_4220971_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024712051.1|4221002_4221749_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
WP_011407385.1|4221745_4222939_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407386.1|4223348_4224371_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_041181930.1|4224510_4226076_-	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
WP_011257326.1|4226086_4227100_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407388.1|4227089_4227791_-	SapC family protein	NA	NA	NA	NA	NA
WP_011407389.1|4227974_4230989_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257330.1|4231378_4232068_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_069959690.1|4232492_4234730_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_069959691.1|4234938_4236729_+	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_069959692.1|4236828_4237287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257334.1|4237951_4238944_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_109182069.1|4239068_4240388_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	4580111	4639492	4999360	transposase	Enterobacteria_phage(25.0%)	54	NA	NA
WP_109182076.1|4580111_4581077_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_069960068.1|4583485_4584757_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011407585.1|4584964_4586794_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.5	1.3e-133
WP_011257638.1|4587175_4587649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257639.1|4587880_4588456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187804.1|4588488_4589251_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|4589367_4590402_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011407588.1|4590618_4591143_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_011257643.1|4591299_4592406_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_103057232.1|4592402_4594250_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_011257645.1|4594336_4594753_-	CopL family metal-binding regulatory protein	NA	NA	NA	NA	NA
WP_011407590.1|4594888_4595992_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_011407591.1|4596035_4598060_+	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_041181965.1|4598233_4599055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257649.1|4599168_4600377_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_011407593.1|4600376_4600892_-	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA	NA	NA	NA	NA	NA
WP_011407594.1|4601237_4602317_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_011407595.1|4602458_4603109_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_011257653.1|4603420_4603819_-	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_011407596.1|4603815_4604298_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_011407597.1|4604622_4605297_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_011407598.1|4605411_4605747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703598.1|4605939_4606293_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_011407600.1|4606705_4608088_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.3	1.4e-55
WP_019301777.1|4608180_4608306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257658.1|4608467_4609457_+	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
WP_042464484.1|4609500_4610127_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_011407601.1|4610465_4611599_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_011407602.1|4611697_4612081_+	DUF4398 domain-containing protein	NA	NA	NA	NA	NA
WP_011257662.1|4612077_4612968_+	membrane protein	NA	NA	NA	NA	NA
WP_003484103.1|4613309_4613528_+	YdcH family protein	NA	NA	NA	NA	NA
WP_011407603.1|4613769_4615140_+	pyridoxal-phosphate dependent enzyme	NA	A0A1X9I5F1	Streptococcus_phage	38.8	2.6e-49
WP_011257665.1|4615230_4616424_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_011257666.1|4616470_4617271_+	FkbM family methyltransferase	NA	H8ZJI6	Ostreococcus_tauri_virus	28.0	3.5e-06
WP_011407605.1|4617305_4618382_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SG19	Hokovirus	21.8	4.9e-11
WP_011407606.1|4619413_4620340_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_024744691.1|4620360_4620651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257668.1|4620641_4621805_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011257669.1|4621810_4622863_+	acyltransferase	NA	A9YX16	Burkholderia_phage	33.9	1.5e-41
WP_109182077.1|4622949_4624269_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407609.1|4624584_4625769_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_011407610.1|4626298_4627612_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
WP_011407611.1|4627601_4628420_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_069959723.1|4628642_4629584_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011257675.1|4629583_4630330_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011407612.1|4630555_4631611_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011407613.1|4631666_4632554_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407614.1|4632550_4633108_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
WP_011407615.1|4633104_4634013_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
WP_011257680.1|4634129_4635533_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011407616.1|4635579_4636926_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_011407617.1|4637059_4637791_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_011257683.1|4637790_4638420_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_011258802.1|4638523_4639492_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 31
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	4650338	4718719	4999360	transposase,tRNA	Ralstonia_phage(20.0%)	46	NA	NA
WP_011257693.1|4650338_4652033_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011257694.1|4652144_4652549_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_011407623.1|4652680_4653454_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011257696.1|4653464_4653932_+	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_011407624.1|4653928_4654411_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182079.1|4654969_4656289_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182080.1|4656446_4657766_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407627.1|4657978_4658947_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_109182081.1|4659096_4660416_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_027704044.1|4660720_4662694_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	7.9e-15
WP_011257702.1|4662960_4664001_-	pectate lyase	NA	NA	NA	NA	NA
WP_094187731.1|4665590_4666388_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075244150.1|4667040_4667355_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_109182082.1|4667540_4668642_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	1.6e-41
WP_027704099.1|4669268_4669571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182083.1|4669578_4672521_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.6	3.2e-129
WP_003490202.1|4672728_4673154_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_011257712.1|4673194_4673500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257713.1|4673499_4674972_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.2	6.2e-49
WP_011407634.1|4675079_4676162_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_011407635.1|4676158_4677265_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_011257716.1|4677679_4678147_-	RDD family protein	NA	NA	NA	NA	NA
WP_011257717.1|4678573_4679545_+	site-specific tyrosine recombinase XerD	NA	G1JX48	Mycobacterium_phage	27.9	6.4e-18
WP_011257718.1|4679998_4680796_+	DsbC family protein	NA	NA	NA	NA	NA
WP_011257719.1|4681194_4685247_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	7.5e-121
WP_069959728.1|4686224_4690022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409190.1|4691520_4692477_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	2.4e-41
WP_011257721.1|4693357_4695040_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_041181968.1|4695036_4695216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257722.1|4695215_4696433_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_011407642.1|4696700_4697132_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_011257724.1|4697141_4697651_+	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_011257725.1|4697647_4698064_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_011257726.1|4698060_4698696_+	type II secretion system protein J	NA	NA	NA	NA	NA
WP_011407644.1|4698692_4699544_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_011407645.1|4699540_4700662_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011407646.1|4700645_4701299_+	general secretion pathway protein GspM	NA	NA	NA	NA	NA
WP_011407647.1|4701288_4702098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257731.1|4702094_4704407_+	type II secretion system secretin GspD	NA	A7BJX1	Enterobacteria_phage	23.5	5.2e-10
WP_011257732.1|4704403_4705243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257733.1|4705659_4706388_-	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_011407648.1|4706493_4707069_-	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_011407649.1|4707444_4709607_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407650.1|4709642_4710800_-	phosphotransferase	NA	NA	NA	NA	NA
WP_011407652.1|4711410_4712250_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011258802.1|4717750_4718719_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 32
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	4728360	4778665	4999360	protease,transposase	Trichoplusia_ni_ascovirus(10.0%)	42	NA	NA
WP_109182084.1|4728360_4729326_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257750.1|4729716_4730292_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_011407659.1|4730404_4730914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010368401.1|4731012_4731207_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_011257752.1|4731296_4732274_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011257753.1|4732503_4732944_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_011257754.1|4733221_4734166_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_011407660.1|4734248_4734992_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
WP_010368407.1|4735196_4735436_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
WP_011407661.1|4735577_4736813_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_011407662.1|4736983_4738339_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_011257758.1|4738399_4739473_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_069959732.1|4739469_4740429_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_011257760.1|4740425_4740779_+	type IV fimbriae assembly protein	NA	NA	NA	NA	NA
WP_133261978.1|4741481_4742264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407665.1|4742625_4742952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181972.1|4743187_4744786_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_011257763.1|4744931_4745828_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_011407667.1|4745903_4747058_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_069963828.1|4747251_4749843_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_011407669.1|4750165_4750303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960159.1|4750575_4751775_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_011407672.1|4752274_4754491_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703871.1|4754569_4755568_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011257770.1|4755677_4755860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182085.1|4756839_4759827_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182786.1|4760001_4760949_+	glycerophosphodiester phosphodiesterase family protein	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
WP_011407676.1|4761447_4761984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182086.1|4762054_4763374_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182087.1|4763718_4764681_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	2.2e-42
WP_011257778.1|4764814_4765375_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011257779.1|4765417_4765900_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_011407679.1|4766062_4766539_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011257781.1|4766949_4767849_+	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011257782.1|4768088_4768475_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011407680.1|4769104_4770232_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257784.1|4770231_4771095_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_011257785.1|4771388_4771574_+	DUF2065 family protein	NA	NA	NA	NA	NA
WP_011407681.1|4771911_4773204_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	37.5	8.4e-74
WP_011407682.1|4773529_4776202_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.0	2.6e-77
WP_011257788.1|4776395_4777178_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_109182119.1|4777288_4778665_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.4	5.0e-77
>prophage 33
NZ_CP020942	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4999360	4817386	4879180	4999360	protease,transposase	Ralstonia_phage(22.22%)	40	NA	NA
WP_109182067.1|4817386_4818352_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109182120.1|4818348_4818522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446005.1|4818806_4819298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257827.1|4820977_4822234_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011257828.1|4822393_4822957_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_011257829.1|4823323_4824682_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_027703752.1|4824681_4825278_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_011257831.1|4825424_4826309_+	membrane protein	NA	NA	NA	NA	NA
WP_011257834.1|4828290_4828905_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011257835.1|4828987_4829974_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|4830089_4830584_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|4830828_4832658_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011407704.1|4832676_4833147_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|4834069_4835197_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|4835297_4836680_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_011257842.1|4836927_4839051_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407706.1|4839579_4840098_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_109182088.1|4840804_4841906_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.2e-41
WP_011257570.1|4842421_4843657_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_103057209.1|4844270_4845119_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_012445986.1|4845250_4845391_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_011407175.1|4846865_4847834_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407713.1|4850110_4851346_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109182089.1|4852328_4853648_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182948.1|4854393_4855317_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.3e-36
WP_109182121.1|4856379_4857345_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|4857646_4859224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|4859291_4860055_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|4862723_4863692_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011407721.1|4863952_4864414_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011257866.1|4864962_4865205_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_109182012.1|4865198_4865962_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_049756327.1|4865994_4866726_-	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
WP_109182091.1|4868545_4869298_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181928.1|4869299_4870265_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257874.1|4870527_4871535_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011257875.1|4871678_4872440_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_012445939.1|4875757_4877050_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|4877142_4877769_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|4877893_4879180_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
