The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028381	Escherichia coli strain RM10466 chromosome, complete genome	5044460	198505	260693	5044460	tRNA,protease,transposase,plate	Emiliania_huxleyi_virus(12.5%)	51	NA	NA
WP_001295561.1|198505_199858_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|199887_202320_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|202441_202927_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139284.1|202930_203956_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|204060_204516_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|204519_205308_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|205307_206456_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|206452_207049_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|207085_210568_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|210580_211540_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_109996707.1|211638_213780_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|213836_214226_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|214290_215589_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|215637_215898_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|215884_216085_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|216250_216796_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|216792_217215_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|217228_217939_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399648.1|218188_219169_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001260712.1|220247_221966_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|222077_222785_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202335.1|222781_223186_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|223303_224119_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|224158_224812_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|224804_225836_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140163.1|226023_226596_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|232355_233159_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648606.1|233155_234070_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234310_235111_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211690.1|235188_235959_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|236006_237365_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052720.1|237436_238192_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|238225_238948_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|238944_239412_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|239476_240208_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|240747_241533_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|241669_242149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|242158_243073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|243116_243599_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087745.1|243622_244975_-	membrane protein	NA	NA	NA	NA	NA
WP_122985538.1|244985_248420_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240530.1|248528_249941_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088859.1|249945_250689_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614334.1|250685_253445_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.4	4.7e-82
WP_000343293.1|253453_254215_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246416.1|254219_255551_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|255553_256078_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113703.1|256074_257355_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|257379_258462_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|258425_260276_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|260279_260693_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP028381	Escherichia coli strain RM10466 chromosome, complete genome	5044460	569360	633858	5044460	capsid,transposase,tRNA,integrase,protease,head,portal,terminase,lysis,tail	Enterobacteria_phage(46.3%)	72	579522:579568	625332:625378
WP_000912345.1|569360_570746_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|570781_571303_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|571410_571623_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|571624_572491_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001369891.1|572971_573514_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988366.1|573733_574426_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_109996711.1|574456_577066_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691049.1|577078_578086_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250425.1|578096_578612_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|578614_579247_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
579522:579568	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001369915.1|579581_580745_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
WP_000433949.1|580600_580972_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.8e-46
WP_000206813.1|580971_581277_-	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	1.4e-48
WP_001242707.1|581276_581639_-	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000008170.1|581629_582166_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	97.8	9.0e-99
WP_000081287.1|582293_583118_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135682.1|583183_583546_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000559922.1|584016_584532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450738.1|584759_585386_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
WP_000205494.1|585483_585684_+	cell division protein	NA	NA	NA	NA	NA
WP_000515870.1|585721_586273_+	hypothetical protein	NA	U5P4K1	Shigella_phage	98.9	1.7e-100
WP_001250269.1|586448_586628_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001369913.1|586617_587559_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	4.9e-140
WP_001573323.1|587555_588050_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	6.2e-86
WP_000210176.1|588049_588376_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_000767127.1|588372_588762_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_001061408.1|588781_589579_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_001358249.1|589586_590576_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.0	2.4e-190
WP_001204780.1|590593_590977_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737283.1|591166_592264_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_000670959.1|592852_593068_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_001135281.1|593067_593565_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|593781_593964_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|594054_594348_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|594638_595049_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|595334_595541_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|595705_595900_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_109996712.1|596288_596834_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027283.1|596808_598734_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|598730_598937_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001369921.1|598933_600535_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.9e-309
WP_000123273.1|600515_601835_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	2.6e-232
WP_001369910.1|601844_602177_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.1e-54
WP_000063218.1|602232_603258_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
WP_000158868.1|603299_603695_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000753019.1|603706_604060_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000975051.1|604071_604650_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	3.5e-80
WP_000683105.1|604646_605042_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001345558.1|605049_605790_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.0e-128
WP_000479154.1|605805_606228_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	9.7e-72
WP_000459458.1|606209_606644_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000840258.1|606636_609198_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.6	0.0e+00
WP_000847379.1|609194_609524_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|609523_610222_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194780.1|610227_610971_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_071532093.1|610907_611540_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	1.4e-95
WP_000515725.1|611600_615014_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_001233071.1|615084_615684_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_000279163.1|615748_618709_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
WP_000885616.1|618708_619284_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086514.1|619381_619972_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000836768.1|620288_620522_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|620590_620704_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239874.1|621069_621738_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|621794_622100_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226378.1|622283_623768_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|623954_624908_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177464.1|625421_626183_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
625332:625378	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|626365_627256_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662376.1|627256_630229_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_109996713.1|630215_632453_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000394594.1|632721_633858_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP028381	Escherichia coli strain RM10466 chromosome, complete genome	5044460	903905	1006422	5044460	capsid,transposase,integrase,protease,head,portal,terminase,plate,lysis,tail	Salmonella_phage(66.04%)	106	935535:935556	968803:968824
WP_000399648.1|903905_904886_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000168779.1|905146_906412_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114244.1|906563_907379_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209359.1|907524_909957_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001295295.1|909962_910862_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000424889.1|910992_911655_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.7	1.6e-25
WP_000829261.1|911833_912583_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_000397381.1|912582_913818_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000513775.1|914021_914987_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000090136.1|916864_918403_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_000936043.1|918420_919341_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_001236044.1|919343_920255_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_001349442.1|920432_922781_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000086910.1|922788_924117_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000049367.1|924163_925489_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_000497137.1|925701_926085_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_000555035.1|926195_927311_+	aldose sugar dehydrogenase YliI	NA	NA	NA	NA	NA
WP_001295292.1|927307_927934_-	glutathione S-transferase GstB	NA	NA	NA	NA	NA
WP_000195961.1|928179_929382_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
WP_000450133.1|929428_930187_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
WP_000892317.1|930244_930841_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001180076.1|931125_932358_+	multidrug efflux MFS transporter MdfA	NA	NA	NA	NA	NA
WP_000480892.1|932398_932683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297001.1|932768_933584_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase	NA	NA	NA	NA	NA
WP_000217848.1|933583_934792_-	MFS transporter	NA	NA	NA	NA	NA
WP_001297003.1|934875_935412_+	DNA-binding transcriptional regulator RcdA	NA	NA	NA	NA	NA
935535:935556	attL	CGCTGCCGCCATTTTGTCGCCA	NA	NA	NA	NA
WP_000290920.1|936174_937194_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	55.6	3.4e-102
WP_023568567.1|937273_937870_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_001420841.1|937873_939007_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000347902.1|939008_939575_-	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	39.2	1.6e-32
WP_000191881.1|939701_939923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460901.1|939955_940465_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.7e-86
WP_000956182.1|940472_940673_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000963472.1|940636_940978_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_001244230.1|941045_941279_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_000752619.1|941278_941506_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_000104146.1|941502_942357_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	90.1	2.9e-147
WP_001420002.1|942362_943184_+	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	75.7	1.1e-122
WP_023568566.1|943183_945556_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.1	0.0e+00
WP_001154434.1|945708_945897_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217568.1|945907_946141_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_000834899.1|946300_946726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109996719.1|947372_947642_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	42.4	7.6e-14
WP_089641074.1|947696_948743_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	89.2	9.8e-174
WP_001098431.1|948742_950509_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000216224.1|950651_951485_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.3	2.4e-122
WP_000742504.1|951501_952560_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	92.8	4.2e-180
WP_088294201.1|952563_953214_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
WP_000673529.1|953309_953774_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	8.4e-77
WP_109996720.1|953773_953977_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	89.6	5.7e-30
WP_000171569.1|953980_954196_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	78.9	3.1e-26
WP_001581542.1|954176_954692_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.4	1.6e-89
WP_109996721.1|954688_955117_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	88.7	2.8e-58
WP_097424227.1|955212_955644_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	91.6	1.9e-70
WP_061348709.1|955636_956083_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.5	1.6e-56
WP_044711059.1|956024_956831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032331041.1|956934_957513_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	7.2e-94
WP_000177574.1|957509_957869_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	4.2e-52
WP_061348708.1|957855_958764_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	9.2e-144
WP_001086845.1|958756_959362_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	2.0e-110
WP_109996722.1|959358_961089_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	62.8	1.0e-79
WP_109996723.1|961088_961523_+|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	40.6	5.5e-22
WP_109996724.1|961655_962828_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.2	1.9e-202
WP_109996725.1|962837_963353_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.2	2.4e-88
WP_109996726.1|963407_963710_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.9	1.6e-39
WP_000763311.1|963724_963844_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_109996727.1|963836_966914_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	61.3	5.7e-312
WP_000980413.1|966910_967396_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_001011799.1|967392_968493_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	2.2e-176
WP_000972391.1|968583_968802_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024867.1|969037_970723_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
968803:968824	attR	CGCTGCCGCCATTTTGTCGCCA	NA	NA	NA	NA
WP_000681108.1|970992_971370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195240.1|971399_971657_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|971816_972104_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|972087_972810_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|972870_973773_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|973860_974337_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126072.1|974688_975801_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996025.1|975895_977029_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
WP_000105430.1|977038_977992_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061657.1|977988_978834_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|978893_979382_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149733.1|979422_980550_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_001295905.1|980724_981456_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|981747_982416_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|982415_983132_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|983138_983870_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|983887_984616_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270740.1|984833_985349_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|985474_985798_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255144.1|985794_986625_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001338420.1|986621_987635_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136554.1|987733_989164_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566372.1|989174_990176_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815350.1|990212_991931_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
WP_000178677.1|992063_993032_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458817.1|993043_994696_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|994839_995739_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001297311.1|996233_996929_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599806.1|997354_999013_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001355621.1|999009_999966_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746460.1|1000116_1001232_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188180.1|1001228_1003175_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|1003247_1003472_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1003794_1004115_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1004145_1006422_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
>prophage 4
NZ_CP028381	Escherichia coli strain RM10466 chromosome, complete genome	5044460	1095734	1164915	5044460	capsid,holin,integrase,protease,head,portal,terminase,tail	Escherichia_phage(39.29%)	81	1110830:1110889	1160181:1160242
WP_000156526.1|1095734_1097495_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877158.1|1097680_1098133_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750419.1|1098207_1099260_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1099616_1100126_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|1100344_1100974_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875044.1|1100936_1103099_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1103108_1103555_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001315388.1|1103677_1105732_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
WP_000424181.1|1105763_1106222_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1106317_1106980_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1107152_1107566_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1107610_1107928_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1107985_1109176_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048250.1|1109270_1109549_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1109545_1109875_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|1109965_1110625_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
1110830:1110889	attL	TTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGAC	NA	NA	NA	NA
WP_001367167.1|1111032_1112052_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	50.3	2.6e-86
WP_000273163.1|1112020_1112272_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_039264392.1|1112338_1114741_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.1	3.7e-176
WP_000092782.1|1114833_1115022_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|1115018_1115207_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_077632757.1|1116062_1116278_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	84.2	5.3e-10
WP_000380319.1|1116433_1116586_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_000948456.1|1116897_1117374_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000712070.1|1117498_1117822_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	43.5	1.4e-09
WP_000693925.1|1117805_1118231_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_039264394.1|1118299_1119331_+	phage replisome organiser	NA	A0A0U2RT81	Escherichia_phage	70.4	6.9e-87
WP_072130322.1|1119242_1119785_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_106879089.1|1119818_1120535_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.0	1.1e-72
WP_074398695.1|1120567_1120849_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	74.2	7.2e-31
WP_064506980.1|1120845_1121151_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.1	4.4e-50
WP_044527398.1|1121137_1121740_+	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	49.5	5.3e-39
WP_044527399.1|1121837_1122263_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	85.1	1.2e-16
WP_000206823.1|1122776_1123121_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	93.0	3.3e-54
WP_000967410.1|1123354_1123567_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	97.1	2.8e-27
WP_044527401.1|1123735_1124008_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	2.1e-11
WP_064506981.1|1124009_1125059_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.2	3.6e-115
WP_001204806.1|1125076_1125457_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_000917735.1|1125672_1125870_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483497.1|1126020_1127079_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_032360617.1|1127461_1128421_+	Shiga toxin Stx2 subunit A	NA	Q776Q3	Enterobacteria_phage	99.7	2.1e-175
WP_000738072.1|1128432_1128702_+	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_047090759.1|1128999_1129323_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	98.1	6.5e-60
WP_064506982.1|1129566_1131504_+	SASA family carbohydrate esterase	NA	S5MDQ7	Escherichia_phage	94.8	0.0e+00
WP_000143458.1|1131654_1131834_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290214.1|1131874_1132120_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
WP_000284506.1|1132197_1132413_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_064506983.1|1132416_1133208_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_001092874.1|1133719_1134253_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	1.4e-99
WP_051694738.1|1134409_1134592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135301858.1|1134960_1135146_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	95.1	1.1e-16
WP_000828070.1|1135546_1135873_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|1136004_1136205_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829192.1|1136246_1136612_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958387.1|1136901_1137465_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_106879091.1|1137461_1139123_+|terminase	terminase large subunit	terminase	Q6H9U9	Enterobacteria_phage	99.5	0.0e+00
WP_096633151.1|1139186_1141124_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.5	0.0e+00
WP_001063099.1|1141168_1141390_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_109996729.1|1141335_1143921_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	96.9	0.0e+00
WP_000125990.1|1143917_1144244_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001029274.1|1144253_1144604_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	6.0e-59
WP_000573358.1|1144600_1145047_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	2.0e-75
WP_000133383.1|1145043_1145388_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_001275448.1|1145454_1146171_+|tail	major tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.2	2.3e-126
WP_000710952.1|1146185_1146560_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_122993267.1|1146655_1146865_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_000212883.1|1146912_1150155_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	87.7	0.0e+00
WP_000343411.1|1150147_1150489_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.3	6.9e-52
WP_001499019.1|1150488_1151187_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.7	2.1e-132
WP_039264406.1|1151197_1151941_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	97.6	3.8e-148
WP_077632782.1|1151886_1152519_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.4	3.0e-101
WP_109996730.1|1152758_1156445_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	88.0	0.0e+00
WP_000078853.1|1156643_1156784_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_039264410.1|1156928_1158641_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	51.0	1.2e-67
WP_000438829.1|1158650_1158863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064506743.1|1158874_1159549_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	9.6e-114
WP_022581964.1|1159712_1160042_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001058323.1|1160696_1161815_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
1160181:1160242	attR	TTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
WP_000107388.1|1161811_1163605_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1163623_1164331_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|1164327_1164915_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP028381	Escherichia coli strain RM10466 chromosome, complete genome	5044460	1312056	1428837	5044460	capsid,holin,integrase,tRNA,protease,head,portal,terminase,plate,tail	Escherichia_phage(28.32%)	154	1330621:1330642	1392386:1392407
WP_000074972.1|1312056_1313175_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.6	1.5e-82
WP_000003742.1|1313143_1313413_-	excisionase	NA	NA	NA	NA	NA
WP_087613937.1|1313474_1315919_-	exonuclease	NA	V5UQJ3	Shigella_phage	56.7	1.4e-170
WP_000092784.1|1316011_1316200_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|1316196_1316385_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000559919.1|1316913_1317429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000380318.1|1317542_1317695_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_032211256.1|1317972_1318260_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001367155.1|1318260_1318452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087614071.1|1318420_1318840_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	56.2	1.2e-08
WP_000448216.1|1318900_1319272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021577226.1|1319374_1319656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693827.1|1319659_1320085_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_052909572.1|1320153_1321185_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	69.1	8.4e-85
WP_072130322.1|1321096_1321639_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_047082289.1|1321672_1322389_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.1	8.7e-73
WP_000017341.1|1322385_1322703_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.0	1.4e-35
WP_109996733.1|1322699_1322981_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	92.5	1.3e-45
WP_022581296.1|1323152_1323335_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	93.3	3.8e-25
WP_052904230.1|1323500_1324016_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.6	2.5e-37
WP_001398985.1|1324249_1324462_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	67.1	6.4e-16
WP_001341173.1|1324628_1324901_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	1.9e-12
WP_032284906.1|1324902_1325952_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	7.7e-110
WP_000904108.1|1325964_1326339_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.4e-35
WP_000762903.1|1326335_1327157_+	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	59.7	2.9e-80
WP_000917741.1|1327383_1327581_+	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_062876351.1|1327731_1328790_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	96.3	9.5e-201
WP_087614088.1|1329172_1330132_+	Shiga toxin Stx2 subunit A	NA	Q5TJL6	Enterobacteria_phage	99.4	6.2e-175
WP_000738072.1|1330143_1330413_+	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
1330621:1330642	attL	CACCGGGAGGCACCCGGCACCA	NA	NA	NA	NA
WP_109996734.1|1330914_1332852_+	SASA family carbohydrate esterase	NA	S5MDQ7	Escherichia_phage	93.5	0.0e+00
WP_000143458.1|1332989_1333169_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1333209_1333455_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1333532_1333748_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_039264424.1|1333751_1334543_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	86.7	4.0e-34
WP_109996735.1|1335054_1335588_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	6.9e-99
WP_062896309.1|1335744_1335927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072057482.1|1336295_1336502_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	63.2	4.6e-11
WP_047083440.1|1336566_1336791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047091053.1|1337236_1337785_+|terminase	terminase small subunit	terminase	K7PJS9	Enterobacteria_phage	60.0	4.6e-58
WP_109996798.1|1337777_1339685_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.8	4.3e-260
WP_000259002.1|1339668_1339875_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_109996736.1|1339871_1341464_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	5.8e-186
WP_052909563.1|1341453_1342959_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.4	1.5e-98
WP_000256803.1|1342995_1343343_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_044803575.1|1343400_1344429_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
WP_001373367.1|1344480_1344864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204531.1|1344856_1345210_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.8e-40
WP_001571311.1|1345225_1345801_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.3	1.7e-50
WP_000683074.1|1345797_1346193_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	2.2e-57
WP_000235126.1|1346200_1346950_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.4	1.6e-130
WP_001299690.1|1346965_1347397_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_071532372.1|1347423_1347837_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	2.3e-41
WP_087614060.1|1347817_1350397_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.4	0.0e+00
WP_000847280.1|1350393_1350723_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_001499019.1|1350722_1351421_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.7	2.1e-132
WP_109996737.1|1351431_1352175_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	94.7	8.3e-143
WP_162543788.1|1352120_1352717_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	72.4	1.4e-79
WP_000514886.1|1353627_1357314_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	88.3	0.0e+00
WP_000078853.1|1357512_1357653_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_109996739.1|1357797_1359501_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	51.9	3.3e-70
WP_000438830.1|1359510_1359723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001373129.1|1359734_1360409_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	3.3e-114
WP_022581964.1|1360572_1360902_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000799399.1|1361067_1361931_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|1361914_1363051_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359432.1|1363300_1364530_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1364675_1365797_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085265.1|1366045_1367275_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	1.5e-133
WP_000953271.1|1367649_1367838_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_000182306.1|1368086_1368290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103621.1|1368347_1368527_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.5e-10
WP_000190551.1|1369032_1369212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024201884.1|1369404_1369602_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_050867507.1|1369594_1369807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033882705.1|1369796_1370036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064565559.1|1370028_1370262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|1370494_1370794_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_050867509.1|1370790_1372200_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	58.9	3.4e-113
WP_024174166.1|1372402_1372654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050867510.1|1372650_1373073_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_050867511.1|1373490_1373697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050867512.1|1373696_1374752_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.4	2.1e-70
WP_050867513.1|1374763_1375099_+|head	head decoration protein	head	NA	NA	NA	NA
WP_050867514.1|1375111_1375525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106904103.1|1375771_1376356_+|terminase	terminase small subunit	terminase	K7PJS9	Enterobacteria_phage	57.2	3.2e-57
WP_021292930.1|1376611_1376893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735412.1|1377742_1379203_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1379202_1379874_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1380041_1381412_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|1381415_1382057_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1382092_1383199_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476089.1|1383252_1383714_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|1383723_1384377_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1384548_1385799_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000885267.1|1386205_1388533_-	ATPase AAA	NA	NA	NA	NA	NA
WP_000741318.1|1388851_1389979_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	60.5	2.7e-121
WP_001527050.1|1389959_1390205_-	phage excisionase	NA	NA	NA	NA	NA
WP_000008212.1|1390259_1390796_-	HD family hydrolase	NA	U5P0T3	Shigella_phage	94.3	3.9e-94
WP_000081287.1|1390924_1391749_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135682.1|1391814_1392177_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_001514782.1|1392777_1393053_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	7.0e-47
1392386:1392407	attR	TGGTGCCGGGTGCCTCCCGGTG	NA	NA	NA	NA
WP_001369946.1|1393061_1393265_-	ClpX C4-type zinc finger	NA	A0A1C9IHZ4	Salmonella_phage	68.3	8.9e-15
WP_001369890.1|1393541_1394234_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.6	2.3e-126
WP_001191674.1|1394331_1394592_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515847.1|1394584_1395136_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.4	2.9e-100
WP_001250269.1|1395311_1395491_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104988.1|1395480_1396422_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.4	8.6e-153
WP_074400771.1|1396418_1396913_+	PerC family transcriptional regulator	NA	S5MW49	Escherichia_phage	96.9	6.2e-86
WP_001369966.1|1396912_1397566_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.5e-127
WP_000210187.1|1397562_1397889_+	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
WP_000767113.1|1397885_1398275_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061425.1|1398294_1399137_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	91.5	6.3e-139
WP_033812102.1|1399144_1400134_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.6e-194
WP_001205449.1|1400151_1400499_+	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	85.0	8.0e-56
WP_001198055.1|1400512_1401604_-	MBL fold metallo-hydrolase	NA	Q332C0	Clostridium_botulinum_C_phage	35.4	5.3e-05
WP_162543785.1|1401627_1402200_-	hypothetical protein	NA	A0A1L2CVC4	Pectobacterium_phage	40.4	2.3e-07
WP_000143147.1|1402196_1402913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120498.1|1403288_1403615_+|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	98.1	3.4e-56
WP_001148537.1|1403618_1404095_+	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	98.7	8.3e-88
WP_001369893.1|1404078_1404471_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	89.2	6.5e-54
WP_001140095.1|1404923_1405274_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	6.8e-63
WP_000929173.1|1405400_1405895_+|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	100.0	1.3e-88
WP_072011717.1|1406128_1407625_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000605606.1|1407636_1407819_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000466253.1|1407818_1409060_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	2.6e-242
WP_001398562.1|1409037_1409688_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	7.3e-119
WP_000257511.1|1409702_1410908_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	1.2e-223
WP_000601360.1|1410957_1411158_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000927719.1|1411160_1411484_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702388.1|1411480_1411891_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000213502.1|1411865_1412372_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
WP_000779292.1|1412368_1412929_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000497751.1|1412937_1413108_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000155716.1|1413091_1414588_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.2	1.2e-273
WP_000090998.1|1414587_1414944_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000811154.1|1414943_1415213_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	7.8e-43
WP_000807196.1|1415354_1417190_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.3	1.5e-307
WP_000219910.1|1417250_1418579_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000999507.1|1418575_1419655_+	hypothetical protein	NA	U5P0H6	Shigella_phage	99.4	4.5e-206
WP_001259081.1|1419654_1420203_+|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	99.5	1.5e-96
WP_000424732.1|1420202_1420628_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_000785311.1|1420614_1421673_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	8.1e-200
WP_000383545.1|1421663_1422248_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	2.4e-113
WP_000554683.1|1422251_1422899_+	hypothetical protein	NA	U5P0I1	Shigella_phage	64.4	8.4e-67
WP_000416463.1|1422901_1423333_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	74.6	4.3e-43
WP_001057699.1|1423304_1423907_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	88.4	8.9e-95
WP_044721967.1|1423906_1424437_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	96.6	4.4e-98
WP_000905000.1|1424466_1425021_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.9	4.4e-88
WP_000557907.1|1425127_1425961_+	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000943926.1|1426194_1426359_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-24
WP_001307134.1|1426461_1426785_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_032141808.1|1427317_1427428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1427480_1427885_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332302.1|1428105_1428837_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 6
NZ_CP028381	Escherichia coli strain RM10466 chromosome, complete genome	5044460	1527274	1596106	5044460	capsid,holin,integrase,protease,head,terminase,lysis,tail	Escherichia_phage(27.45%)	76	1527107:1527134	1582301:1582328
1527107:1527134	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113693.1|1527274_1528405_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	4.0e-104
WP_000113183.1|1528382_1528631_-	excisionase	NA	NA	NA	NA	NA
WP_000034484.1|1528695_1531167_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	1.3e-54
WP_000092839.1|1531262_1531451_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_109996740.1|1531447_1531636_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001365839.1|1532410_1532779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380317.1|1532790_1532943_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001003380.1|1533132_1533540_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	5.5e-24
WP_000476991.1|1533617_1533845_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705131.1|1533828_1534350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054520.1|1534330_1535296_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
WP_000790460.1|1535302_1536043_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	4.7e-114
WP_000450858.1|1536072_1536834_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	64.0	8.4e-74
WP_000215513.1|1536893_1537088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211993.1|1537429_1537981_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000882661.1|1538195_1538408_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	5.6e-28
WP_000042395.1|1538510_1538828_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001452497.1|1539416_1539644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024199763.1|1539697_1539967_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	1.2e-11
WP_050877448.1|1539968_1541018_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.5e-110
WP_000904164.1|1541030_1541393_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
WP_001064918.1|1541385_1542051_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.0	1.6e-60
WP_000342737.1|1542304_1543018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917733.1|1543191_1543389_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_064579144.1|1543539_1544598_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	4.4e-206
WP_000271631.1|1545078_1545507_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000382067.1|1546203_1546929_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_109996741.1|1548786_1550751_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	78.8	6.5e-296
WP_000142780.1|1550885_1551065_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	93.2	5.4e-24
WP_001290230.1|1551105_1551351_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1551428_1551644_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_024200907.1|1551647_1552316_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	76.7	6.0e-60
WP_001063216.1|1552295_1552616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992036.1|1552741_1553275_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	97.2	7.4e-101
WP_072024677.1|1553431_1553614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024173692.1|1553762_1554230_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.1	7.9e-67
WP_000877795.1|1554410_1554956_+	hypothetical protein	NA	A0A0P0ZFJ1	Escherichia_phage	68.6	7.4e-64
WP_000828070.1|1555292_1555619_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|1555750_1555951_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829191.1|1555992_1556358_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	1.0e-61
WP_000958387.1|1556646_1557210_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001398587.1|1557206_1558868_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.6	0.0e+00
WP_000172990.1|1558931_1560869_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|1560913_1561135_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125990.1|1563499_1563826_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001029274.1|1563835_1564186_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	6.0e-59
WP_000573391.1|1564182_1564629_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133383.1|1564625_1564970_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_039264404.1|1565036_1565753_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	98.7	8.9e-126
WP_000710934.1|1565767_1566142_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	7.8e-65
WP_122993267.1|1566237_1566447_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_109996742.1|1566494_1569737_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	87.7	0.0e+00
WP_000343412.1|1569729_1570071_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.1	2.6e-51
WP_000738904.1|1570269_1571433_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.9	1.6e-140
WP_001499019.1|1571643_1572342_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.7	2.1e-132
WP_109996743.1|1572352_1573096_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	94.7	4.1e-142
WP_122993618.1|1573041_1573674_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.0	1.9e-100
WP_109996744.1|1574584_1578280_+	DUF1983 domain-containing protein	NA	Q6H9T2	Enterobacteria_phage	84.2	0.0e+00
WP_001270059.1|1578348_1578972_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	9.0e-66
WP_109996745.1|1579121_1580126_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	97.3	1.3e-53
WP_109996746.1|1580194_1580866_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	83.9	3.3e-106
WP_109996747.1|1582478_1582985_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1582301:1582328	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|1583030_1583531_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1583616_1583796_-	general stress protein	NA	NA	NA	NA	NA
WP_000443056.1|1584176_1584983_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209516.1|1584982_1586176_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_024177467.1|1586187_1587546_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000763511.1|1587549_1589145_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194592.1|1589144_1590707_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1590798_1590843_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1590980_1591862_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1591858_1592479_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|1592579_1593452_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|1593491_1594082_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559280.1|1594078_1594837_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_000422045.1|1595056_1596106_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NZ_CP028381	Escherichia coli strain RM10466 chromosome, complete genome	5044460	1877653	1940162	5044460	holin,integrase,protease,portal,terminase,tail	Escherichia_phage(53.45%)	78	1892570:1892587	1912178:1912195
WP_047084001.1|1877653_1878325_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	86.1	3.2e-109
WP_064550087.1|1878393_1879662_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	98.2	1.9e-54
WP_000078853.1|1879805_1879946_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_109996754.1|1880144_1883831_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	88.1	0.0e+00
WP_136760451.1|1884070_1884703_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.4	2.3e-101
WP_106901611.1|1884648_1885392_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	93.9	4.6e-141
WP_001365876.1|1885402_1886101_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.4e-131
WP_000847279.1|1886100_1886430_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	100.0	5.6e-59
WP_044527407.1|1886426_1889072_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	93.2	0.0e+00
WP_000532075.1|1889115_1889424_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000479054.1|1889450_1889873_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	100.0	5.1e-73
WP_000174599.1|1889889_1890639_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	98.8	5.3e-137
WP_000682704.1|1890646_1891045_-	hypothetical protein	NA	S5MW30	Escherichia_phage	100.0	2.7e-71
WP_000974964.1|1891054_1891681_-	hypothetical protein	NA	S5MBY4	Escherichia_phage	100.0	7.8e-102
WP_001281350.1|1891683_1891965_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097057.1|1891957_1892284_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	99.1	4.0e-49
WP_162543789.1|1892370_1894350_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.8	0.0e+00
1892570:1892587	attL	GCATCAAGACGCGCTTCC	NA	NA	NA	NA
WP_000974560.1|1894339_1895842_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	5.4e-290
WP_000102415.1|1895841_1896054_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000133402.1|1897546_1897828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032313484.1|1898085_1899975_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.4	1.6e-182
WP_000761833.1|1900946_1902701_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.6	3.9e-90
WP_000770163.1|1902697_1902997_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_044527408.1|1903002_1903236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204072.1|1903237_1903459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032307277.1|1903431_1903674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000076671.1|1903663_1903894_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	49.1	4.5e-07
WP_000226789.1|1903890_1904085_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000108048.1|1904283_1904589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071531869.1|1904646_1904874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038669.1|1905266_1905848_-	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	61.3	3.4e-51
WP_000229066.1|1905907_1906132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000114064.1|1906124_1907363_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.1	6.6e-60
WP_044527410.1|1907524_1908532_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.7	5.3e-201
WP_000348556.1|1908528_1909005_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	96.8	1.3e-80
WP_012816791.1|1909519_1909705_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001092868.1|1910223_1910757_-	lysozyme	NA	G9L6J6	Escherichia_phage	95.5	1.1e-99
WP_001457151.1|1911268_1911754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000284510.1|1911757_1911973_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_064550301.1|1912050_1912296_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	98.8	7.4e-16
1912178:1912195	attR	GCATCAAGACGCGCTTCC	NA	NA	NA	NA
WP_000143458.1|1912336_1912516_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_064550303.1|1912666_1914613_-	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	97.8	0.0e+00
WP_000738080.1|1915125_1915395_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001365055.1|1915406_1916366_-	Shiga toxin Stx2d subunit A	NA	Q6DWN9	Enterobacteria_phage	100.0	1.6e-175
WP_000762906.1|1916851_1917673_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	57.2	1.2e-86
WP_001258479.1|1917669_1918044_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.4	4.7e-38
WP_024200897.1|1918056_1919106_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	2.5e-108
WP_047090793.1|1919107_1919380_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.2e-12
WP_001260977.1|1919515_1919773_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_000220600.1|1919778_1920078_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	99.0	3.9e-51
WP_000651124.1|1920282_1920678_-	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	61.2	2.5e-37
WP_000829416.1|1920667_1920886_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	70.3	1.2e-06
WP_000991478.1|1921015_1921327_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	79.6	6.5e-49
WP_001373171.1|1921323_1921479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029374881.1|1921507_1921807_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.9	4.8e-49
WP_024200898.1|1921803_1922085_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	66.7	5.7e-28
WP_001151140.1|1922089_1922524_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	60.9	2.0e-35
WP_000450642.1|1922539_1923265_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.4	2.0e-77
WP_074435815.1|1923298_1923841_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.8	9.5e-80
WP_001262404.1|1923752_1924784_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	70.0	5.8e-86
WP_000693921.1|1924852_1925278_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261756.1|1925274_1925502_-	cell division protein	NA	NA	NA	NA	NA
WP_000444611.1|1925600_1926245_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	25.9	6.1e-09
WP_122993314.1|1926717_1926975_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	81.6	4.1e-09
WP_000449172.1|1927796_1927985_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|1927981_1928170_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048380.1|1928265_1930737_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	59.3	8.5e-59
WP_001368608.1|1930822_1931059_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000877018.1|1931094_1932369_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	61.7	2.8e-154
WP_072094462.1|1932397_1932505_-	transporter	NA	NA	NA	NA	NA
WP_000836072.1|1932562_1933582_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	1.6e-16
WP_001295394.1|1933593_1934808_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1935013_1935340_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1935474_1935816_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1935850_1936411_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1936413_1937124_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|1937231_1937537_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041556.1|1937735_1940162_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
>prophage 8
NZ_CP028381	Escherichia coli strain RM10466 chromosome, complete genome	5044460	2446924	2508859	5044460	capsid,holin,tRNA,integrase,head,portal,terminase,plate,lysis,tail	Escherichia_phage(51.06%)	73	2451982:2452009	2481583:2481610
WP_000675150.1|2446924_2448328_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137869.1|2448324_2449047_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_000929408.1|2449237_2449570_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|2449778_2450075_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|2450076_2450373_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|2450475_2451837_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
2451982:2452009	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2452109_2452328_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_044527455.1|2452409_2453573_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	5.4e-205
WP_000978892.1|2453572_2454052_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.9e-84
WP_044527454.1|2454066_2456514_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.6	0.0e+00
WP_000785970.1|2456506_2456626_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|2456658_2456934_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2456990_2457509_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286727.1|2457521_2458712_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
WP_101981607.1|2458835_2459306_-|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	42.8	1.2e-22
WP_109996762.1|2459272_2461003_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	64.0	1.2e-83
WP_001285352.1|2460999_2461611_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_001121479.1|2461603_2462512_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_000127164.1|2462516_2462864_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_109996763.1|2462860_2463496_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	4.2e-111
WP_001001780.1|2463562_2464015_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_000917190.1|2464007_2464475_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	9.7e-81
WP_001300730.1|2464437_2464611_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_033811832.1|2464582_2465008_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	95.7	8.0e-66
WP_001712252.1|2464995_2465421_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	96.5	8.6e-60
WP_001144101.1|2465435_2465933_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|2465932_2466214_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|2466217_2466421_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988628.1|2466420_2466930_-|head	head completion/stabilization protein	head	Q858W4	Yersinia_virus	100.0	3.0e-91
WP_000203414.1|2467029_2467767_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	98.4	1.2e-128
WP_044527451.1|2467770_2468844_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.4	1.9e-201
WP_044527450.1|2468902_2469757_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MH0	Enterobacteria_phage	97.5	1.7e-131
WP_044527449.1|2469930_2471703_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.5	0.0e+00
WP_044527448.1|2471702_2472737_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	4.2e-201
WP_071987867.1|2473089_2474244_-	DNA cytosine methyltransferase	NA	Q83VT0	Escherichia_phage	99.4	3.2e-210
WP_071526056.1|2474264_2474534_+	helix-turn-helix transcriptional regulator	NA	Q83VS9	Escherichia_phage	100.0	3.6e-40
WP_000866882.1|2474511_2475567_+	restriction endonuclease, SacI family	NA	Q83VS8	Escherichia_phage	100.0	2.2e-197
WP_044527447.1|2475660_2477931_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.2	0.0e+00
WP_000027664.1|2477920_2478196_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113258.1|2478192_2478417_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	97.3	2.5e-34
WP_001277958.1|2478416_2478719_-	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_000557703.1|2478718_2478943_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|2479006_2479507_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000043869.1|2479684_2479960_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|2480074_2480374_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000985256.1|2480489_2481503_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
WP_000716757.1|2481767_2482085_-	hypothetical protein	NA	NA	NA	NA	NA
2481583:2481610	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2482499_2483399_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|2483480_2484260_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844200.1|2484359_2485400_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490717.1|2485447_2486803_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000823272.1|2486806_2487091_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|2487121_2487574_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853892.1|2487583_2488846_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000289788.1|2488874_2489729_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|2490038_2491091_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858484.1|2491347_2492625_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000846219.1|2492621_2493626_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	1.3e-13
WP_000011973.1|2493622_2494588_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|2494561_2495308_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001315719.1|2495359_2496178_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000822274.1|2496242_2497043_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195590.1|2497039_2497828_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|2498050_2498323_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134576.1|2498443_2499268_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|2499486_2499825_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001026151.1|2499906_2500941_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_109996764.1|2500954_2503435_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677395.1|2503450_2504125_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|2504205_2504748_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001324851.1|2505040_2505322_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|2505584_2506694_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001295427.1|2506825_2508859_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 9
NZ_CP028381	Escherichia coli strain RM10466 chromosome, complete genome	5044460	2521424	2530865	5044460		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292774.1|2521424_2522561_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001317947.1|2522557_2524558_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|2524681_2525143_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2525183_2525654_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2525700_2526420_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2526416_2528102_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2528323_2529055_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2529114_2529222_+	protein YohO	NA	NA	NA	NA	NA
WP_109996766.1|2529202_2529934_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569325.1|2529938_2530865_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 10
NZ_CP028381	Escherichia coli strain RM10466 chromosome, complete genome	5044460	2992568	3085279	5044460	capsid,transposase,tRNA,integrase,head,portal,terminase,plate,lysis,tail	Salmonella_phage(68.52%)	99	3058724:3058739	3072828:3072843
WP_001298974.1|2992568_2993306_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2993437_2994772_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|2994980_2995862_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|2995964_2996552_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|2996607_2996991_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|2997295_2997985_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997404.1|2998032_2999070_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2999276_2999696_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001343689.1|2999764_3000463_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082964.1|3000494_3003155_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3003268_3004624_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000464877.1|3004648_3004993_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852115.1|3004989_3006288_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	2.2e-45
WP_001235102.1|3012154_3014728_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040149.1|3014857_3015589_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079112.1|3015585_3016566_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3016700_3017438_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3017708_3018050_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3018153_3018201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109996774.1|3018299_3019460_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|3019502_3020624_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168044.1|3020634_3021705_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000976004.1|3021914_3022280_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3022429_3022948_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969032.1|3022937_3024164_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|3024179_3024662_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3024738_3025086_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3025127_3025895_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3025925_3026474_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3026492_3026741_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3026877_3028239_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001189257.1|3028330_3029197_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077221315.1|3029217_3030504_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3030558_3031152_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|3031274_3032153_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|3032238_3033900_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3034048_3034390_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3034451_3034742_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3034731_3035208_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3035339_3035822_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000391797.1|3036522_3037005_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	33.7	2.0e-17
WP_000980501.1|3037031_3037250_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_001011775.1|3037318_3038419_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.8	6.9e-178
WP_000980395.1|3038415_3038901_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_069919222.1|3038897_3041975_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.7	0.0e+00
WP_000763311.1|3041967_3042087_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281016.1|3042101_3042404_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_044527351.1|3042458_3042974_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.2	1.1e-88
WP_000046146.1|3042983_3044156_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
WP_000120166.1|3044288_3044723_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	40.6	4.2e-22
WP_109996775.1|3044722_3046453_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	62.8	4.7e-80
WP_001086820.1|3046449_3047055_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
WP_000268301.1|3047047_3047956_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_001583421.1|3047942_3048302_-	lysozyme family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	1.5e-52
WP_044527322.1|3048298_3048877_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.2e-93
WP_023135313.1|3048945_3049392_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.5e-62
WP_001595569.1|3049384_3049816_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	9.9e-72
WP_023135316.1|3049911_3050340_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	1.9e-46
WP_000727851.1|3050336_3050714_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
WP_001513678.1|3050715_3051228_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	9.0e-88
WP_000171568.1|3051208_3051424_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3051427_3051631_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673523.1|3051630_3052095_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_025790323.1|3052190_3052841_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	3.3e-111
WP_000742510.1|3052844_3053903_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_044527321.1|3053919_3054753_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.2e-121
WP_001098411.1|3054895_3056662_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_039516393.1|3056661_3057690_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.7	4.0e-172
WP_039516390.1|3057737_3058655_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_039516388.1|3058617_3059820_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	36.2	2.9e-60
3058724:3058739	attL	TATTGCTGGGTAAGAT	NA	NA	NA	NA
WP_001217575.1|3060146_3060380_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3060390_3060579_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_044527320.1|3060731_3063146_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
WP_044527319.1|3063142_3064000_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.5	1.5e-159
WP_000752619.1|3063996_3064224_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_001244223.1|3064223_3064457_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	3.2e-32
WP_044527318.1|3064524_3064866_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	96.5	1.1e-54
WP_000934004.1|3064948_3065197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001399247.1|3065282_3065579_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	92.3	2.2e-22
WP_001399248.1|3065586_3066096_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	99.4	3.4e-87
WP_000102105.1|3066128_3066371_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000932271.1|3066492_3067125_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.9	3.7e-59
WP_001399250.1|3067127_3068144_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	94.7	1.4e-188
WP_001083625.1|3068154_3068823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113814.1|3069158_3070400_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.3	2.6e-101
WP_001317263.1|3070538_3071633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000169527.1|3072890_3073190_+|transposase	transposase	transposase	NA	NA	NA	NA
3072828:3072843	attR	ATCTTACCCAGCAATA	NA	NA	NA	NA
WP_000878220.1|3073186_3074053_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	1.9e-50
WP_000532680.1|3074066_3075365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000878218.1|3075382_3076249_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|3076245_3076545_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000871156.1|3076572_3076806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106377177.1|3077522_3081128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000443183.1|3081166_3081913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000925811.1|3081899_3082079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000655916.1|3082346_3083228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001367084.1|3083341_3083581_+	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	49.2	2.5e-08
WP_001283984.1|3083746_3084046_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_085950812.1|3084066_3085279_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	56.8	2.4e-99
>prophage 11
NZ_CP028381	Escherichia coli strain RM10466 chromosome, complete genome	5044460	3160673	3167813	5044460		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|3160673_3163235_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141340.1|3163340_3163997_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272551.1|3164047_3164845_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.7e-69
WP_000847985.1|3165010_3165919_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590384.1|3165915_3167178_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_001278994.1|3167174_3167813_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 1
NZ_CP028382	Escherichia coli strain RM10466 plasmid pRM10466-1, complete sequence	160675	71615	81057	160675		Cronobacter_phage(25.0%)	12	NA	NA
WP_000117306.1|71615_73574_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.4	2.1e-20
WP_000006027.1|73633_73867_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001276132.1|73924_74458_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	71.8	2.3e-46
WP_000274419.1|75222_75657_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104873.1|75670_75892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086114.1|75892_76576_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.1e-30
WP_077629773.1|76961_77864_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618108.1|78282_78531_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	46.7	4.1e-14
WP_000109074.1|78527_78965_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	3.7e-26
WP_001370040.1|78964_79957_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	59.2	2.3e-100
WP_001369986.1|80001_80235_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	56.6	2.0e-18
WP_000587689.1|80430_81057_+	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
>prophage 2
NZ_CP028382	Escherichia coli strain RM10466 plasmid pRM10466-1, complete sequence	160675	91073	137255	160675	protease,transposase,integrase	Macacine_betaherpesvirus(25.0%)	38	86570:86592	144414:144436
86570:86592	attL	CGTCTTATATCACTGGCGCTGAC	NA	NA	NA	NA
WP_001370065.1|91073_92666_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	3.3e-173
WP_001278809.1|92870_93287_-	recombinase	NA	NA	NA	NA	NA
WP_000688508.1|93279_94260_-	Plasmid segregation protein parM	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	2.2e-79
WP_000030199.1|94674_94983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144036.1|95069_95714_-	ParA family protein	NA	NA	NA	NA	NA
WP_000016966.1|95893_96700_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	1.2e-54
WP_001159871.1|96700_97006_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813639.1|97007_97226_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000343100.1|97821_98082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194569.1|98078_98669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142426.1|98686_99034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000850413.1|99933_100665_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_001369978.1|101835_102813_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	64.5	9.4e-102
WP_032279745.1|103490_103721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000377257.1|103850_104345_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001213534.1|104465_105905_-	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_072094473.1|105908_108029_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.4	9.3e-46
WP_000217748.1|108078_111075_-	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_001365635.1|111076_111592_-	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000899428.1|112019_112823_-	OmpA family protein	NA	NA	NA	NA	NA
WP_024177480.1|112847_117155_-	hemagglutinin	NA	NA	NA	NA	NA
WP_000439678.1|117375_117660_-	major pilus subunit operon regulatory protein PapB	NA	NA	NA	NA	NA
WP_000554412.1|122656_124213_+	L-lactate permease	NA	NA	NA	NA	NA
WP_001102092.1|124263_124983_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000054160.1|124993_126409_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000431492.1|126413_127112_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001369996.1|127152_127389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077629759.1|127456_127921_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	60.8	1.2e-46
WP_000203485.1|128036_128348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000264906.1|128375_128567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997727.1|128576_128942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062896385.1|129075_129285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047091594.1|129447_133350_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.5	1.7e-239
WP_000598953.1|133846_134233_-	thermonuclease	NA	A0A0R6PHV6	Moraxella_phage	33.9	1.1e-10
WP_044527425.1|134391_135069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000220092.1|135558_135879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000169527.1|136799_137099_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_122993544.1|137126_137255_-|transposase	transposase	transposase	NA	NA	NA	NA
144414:144436	attR	GTCAGCGCCAGTGATATAAGACG	NA	NA	NA	NA
>prophage 3
NZ_CP028382	Escherichia coli strain RM10466 plasmid pRM10466-1, complete sequence	160675	140623	148608	160675	transposase	Stx2-converting_phage(33.33%)	7	NA	NA
WP_001223214.1|140623_142711_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	32.2	6.8e-09
WP_001212725.1|142971_143394_-	Exc2 family lipoprotein	NA	NA	NA	NA	NA
WP_001373081.1|144444_144870_-	subtilase AB5 cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	45.2	2.1e-26
WP_000912970.1|144886_145930_-	subtilase AB5 cytotoxin subunit A	NA	A0A1B0T6A2	Bacillus_phage	28.3	3.5e-06
WP_000080208.1|146218_147811_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	2.3e-174
WP_000624657.1|147841_148192_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	6.9e-39
WP_000422688.1|148188_148608_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	88.7	6.5e-44
