The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029451	Sinorhizobium fredii CCBAU 25509 chromosome, complete genome	4198614	140652	152404	4198614	tail,terminase,portal	EBPR_podovirus(36.36%)	14	NA	NA
WP_157784626.1|140652_141162_+|terminase	terminase small subunit protein	terminase	A0A2K8HN72	Pseudomonas_phage	47.3	2.5e-21
WP_050983985.1|141064_142483_+	DNA packaging protein	NA	C8CLI4	Xylella_phage	65.1	4.1e-167
WP_037391850.1|142482_144540_+|portal	phage portal protein	portal	F8TUR6	EBPR_podovirus	60.2	2.1e-204
WP_037391852.1|144539_144776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037391854.1|144807_145773_+	hypothetical protein	NA	F8TUR8	EBPR_podovirus	33.3	8.2e-34
WP_037391856.1|145797_146793_+	DUF5309 domain-containing protein	NA	A0A088FAT7	Sulfitobacter_phage	66.8	3.6e-117
WP_037391858.1|146805_147231_+	hypothetical protein	NA	A0A218MMG4	uncultured_virus	36.0	3.8e-07
WP_167414950.1|147297_147465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037391860.1|147461_147785_+	hypothetical protein	NA	F8TUS1	EBPR_podovirus	51.9	9.5e-27
WP_037391862.1|147781_148384_+	hypothetical protein	NA	K8DWF6	Pseudomonas_phage	25.6	5.5e-12
WP_037391864.1|148380_148983_+	hypothetical protein	NA	A0A088FAT4	Sulfitobacter_phage	33.0	3.2e-20
WP_037391865.1|148979_150593_+	hypothetical protein	NA	F8TUS4	EBPR_podovirus	38.4	7.2e-83
WP_037391866.1|150592_151054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037391868.1|151057_152404_+|tail	tail fiber domain-containing protein	tail	X2CY28	Brucella_phage	30.7	1.4e-34
>prophage 2
NZ_CP029451	Sinorhizobium fredii CCBAU 25509 chromosome, complete genome	4198614	774512	781479	4198614		uncultured_Caudovirales_phage(66.67%)	7	NA	NA
WP_037401578.1|774512_775022_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	42.6	3.0e-27
WP_037401581.1|775024_775723_+	aquaporin family protein	NA	NA	NA	NA	NA
WP_037401594.1|775719_776151_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	64.5	3.5e-45
WP_037401599.1|776107_776851_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.9	2.6e-88
WP_050984174.1|777188_778433_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	55.7	7.2e-99
WP_037401602.1|778722_779112_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	30.3	2.9e-06
WP_037401605.1|781218_781479_-	hypothetical protein	NA	A0A076G717	Sinorhizobium_phage	47.3	6.9e-12
>prophage 3
NZ_CP029451	Sinorhizobium fredii CCBAU 25509 chromosome, complete genome	4198614	1455715	1469848	4198614	tRNA	uncultured_Mediterranean_phage(81.82%)	14	NA	NA
WP_162129796.1|1455715_1456579_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	35.3	1.1e-32
WP_014328223.1|1456571_1457297_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.2	1.7e-39
WP_014328224.1|1457369_1458479_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.1e-29
WP_014328225.1|1458571_1458778_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	68.2	2.8e-08
WP_014328226.1|1458855_1459569_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_014328227.1|1459565_1460408_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.4	7.7e-44
WP_037393416.1|1460447_1461731_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.7	7.2e-102
WP_037393414.1|1461756_1462527_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	33.6	3.3e-25
WP_037393412.1|1462523_1463177_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	34.0	1.2e-15
WP_014328231.1|1463336_1463987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037393411.1|1464151_1465693_+	LysM peptidoglycan-binding domain-containing protein	NA	Q8SBN9	Clostridium_phage	35.9	5.6e-16
WP_037393410.1|1465725_1466601_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_037435264.1|1466900_1467233_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	38.8	5.7e-11
WP_037393390.1|1467277_1469848_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	44.0	3.3e-53
>prophage 4
NZ_CP029451	Sinorhizobium fredii CCBAU 25509 chromosome, complete genome	4198614	1594644	1669369	4198614	tail,head,transposase,tRNA,integrase,portal,capsid,terminase,protease	Rhizobium_phage(56.0%)	77	1636116:1636131	1674120:1674135
WP_037437944.1|1594644_1594995_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_109982119.1|1594943_1595792_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	32.5	1.6e-33
WP_014328326.1|1595904_1597125_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_014328327.1|1597124_1597619_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_014328328.1|1597618_1598434_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	50.8	5.8e-57
WP_014328329.1|1598443_1599457_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	45.2	1.5e-62
WP_037392749.1|1599475_1601371_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_014328331.1|1601739_1603386_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_014328332.1|1603583_1604954_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	27.3	3.8e-16
WP_014328333.1|1605100_1606927_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HPF5	Paramecium_bursaria_Chlorella_virus	40.9	1.5e-108
WP_037435895.1|1606923_1607424_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_037392752.1|1607441_1608137_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_037392753.1|1608158_1610264_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_014328337.1|1610380_1610686_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_060563360.1|1610694_1614207_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_014328339.1|1614260_1614926_-	DsbA family protein	NA	NA	NA	NA	NA
WP_037392779.1|1615017_1616805_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014328341.1|1617167_1617791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014328342.1|1617938_1618268_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_014328343.1|1618450_1619860_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_003528058.1|1619951_1620290_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_014328344.1|1620635_1622111_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_014328345.1|1622124_1622622_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014328346.1|1622809_1623565_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_014328347.1|1623729_1624329_+	NAD(P)H:quinone oxidoreductase type IV	NA	NA	NA	NA	NA
WP_014328348.1|1624584_1624827_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_014328349.1|1624919_1625138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014328350.1|1625221_1625428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080577291.1|1625424_1625631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014328352.1|1626140_1626731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014328353.1|1626947_1628195_+	threonine ammonia-lyase	NA	NA	NA	NA	NA
WP_037392765.1|1628272_1628593_+	transcriptional activator HlyU	NA	NA	NA	NA	NA
WP_014328355.1|1628852_1630835_-	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_037392773.1|1631057_1632305_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	41.6	2.0e-16
WP_014328357.1|1632318_1632780_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014328358.1|1632936_1634055_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_014328359.1|1634103_1634571_-	DUF1203 domain-containing protein	NA	NA	NA	NA	NA
WP_014328360.1|1634653_1635217_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_037392792.1|1635222_1636086_-	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_014328362.1|1636103_1636853_-|tRNA	alanyl-tRNA editing protein	tRNA	NA	NA	NA	NA
1636116:1636131	attL	AAGGTTTTCGGCCGCT	NA	NA	NA	NA
WP_014328363.1|1636861_1637902_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	38.7	2.4e-47
WP_014328364.1|1638216_1639065_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014328365.1|1639052_1639379_-	multidrug transporter	NA	NA	NA	NA	NA
WP_037392795.1|1639375_1639732_-	multidrug transporter	NA	NA	NA	NA	NA
WP_050983997.1|1639910_1641161_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	46.7	1.3e-84
WP_157784630.1|1641143_1641716_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_050983998.1|1641765_1641981_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_037392803.1|1641977_1642496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037392806.1|1642562_1642742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086018593.1|1645632_1645809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037392812.1|1645820_1646132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037392814.1|1646128_1646539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037392820.1|1646768_1647932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037392822.1|1648430_1648628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037392827.1|1649186_1649603_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_050984000.1|1649580_1651419_+|terminase	terminase	terminase	B0VK29	Azospirillum_phage	45.7	1.3e-144
WP_037392829.1|1651420_1652686_+|portal	phage portal protein	portal	B4UTP1	Rhizobium_phage	75.0	9.4e-171
WP_037392831.1|1652682_1653309_+|head,protease	HK97 family phage prohead protease	head,protease	B4UTP2	Rhizobium_phage	57.3	6.3e-43
WP_037392833.1|1653397_1654678_+|capsid	phage major capsid protein	capsid	B4UTP3	Rhizobium_phage	77.2	5.9e-181
WP_037392835.1|1654723_1654954_+	hypothetical protein	NA	B4UTP6	Rhizobium_phage	86.8	3.8e-30
WP_037392837.1|1654913_1655459_+	hypothetical protein	NA	B4UTP7	Rhizobium_phage	96.1	1.0e-97
WP_037392840.1|1655476_1655887_+	lipase chaperone	NA	B4UTP8	Rhizobium_phage	63.3	8.3e-36
WP_037392843.1|1656037_1656388_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_037392848.1|1656384_1656867_+	HK97 gp10 family phage protein	NA	A0A141GEW6	Brucella_phage	41.7	2.2e-19
WP_037392851.1|1656866_1657283_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_011975484.1|1657323_1657761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037392854.1|1657760_1658117_+	gene transfer agent family protein	NA	B4UTQ4	Rhizobium_phage	41.9	2.5e-12
WP_157784631.1|1658173_1658338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037392857.1|1658334_1658625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037392859.1|1658669_1660931_+	tape measure protein	NA	B4UTQ6	Rhizobium_phage	37.7	7.6e-22
WP_037392862.1|1660940_1661648_+	hypothetical protein	NA	B4UTQ7	Rhizobium_phage	87.6	5.2e-118
WP_086018594.1|1661660_1661825_+	hypothetical protein	NA	B4UTQ8	Rhizobium_phage	80.4	8.5e-16
WP_037392865.1|1661814_1662387_+	hypothetical protein	NA	B4UTQ9	Rhizobium_phage	84.7	4.8e-90
WP_037392867.1|1662371_1662785_+	hypothetical protein	NA	B4UTR0	Rhizobium_phage	76.6	2.8e-55
WP_037392870.1|1662795_1664919_+	hypothetical protein	NA	B4UTR1	Rhizobium_phage	85.6	0.0e+00
WP_037392873.1|1664992_1667326_+	hypothetical protein	NA	B4UTR2	Rhizobium_phage	33.3	5.1e-05
WP_080577294.1|1667413_1669369_-	glycosyltransferase	NA	Q9YN04	Myxoma_virus	24.6	4.6e-07
1674120:1674135	attR	AAGGTTTTCGGCCGCT	NA	NA	NA	NA
>prophage 5
NZ_CP029451	Sinorhizobium fredii CCBAU 25509 chromosome, complete genome	4198614	1863156	1870379	4198614		Pseudomonas_phage(16.67%)	9	NA	NA
WP_042776321.1|1863156_1864188_-	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	29.8	4.7e-11
WP_037396478.1|1864184_1864886_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	39.0	4.9e-36
WP_014328465.1|1864942_1866097_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	34.5	9.2e-48
WP_037396470.1|1866163_1867195_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	51.1	3.4e-17
WP_037396481.1|1867492_1867822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037396473.1|1868216_1868531_-	DUF1476 family protein	NA	NA	NA	NA	NA
WP_012708153.1|1868755_1869520_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	43.5	1.1e-44
WP_012708154.1|1869555_1869798_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_037396499.1|1869821_1870379_+	RNA 2'-phosphotransferase	NA	A0A2H4UTN1	Bodo_saltans_virus	42.0	6.0e-29
>prophage 6
NZ_CP029451	Sinorhizobium fredii CCBAU 25509 chromosome, complete genome	4198614	2140706	2153804	4198614	tail,portal	Sulfitobacter_phage(50.0%)	12	NA	NA
WP_014328773.1|2140706_2141918_-	hypothetical protein	NA	A0A1Y0SVH2	Sinorhizobium_phage	50.2	3.0e-57
WP_037397223.1|2142032_2143391_-|tail	tail fiber domain-containing protein	tail	M4NM77	Sulfitobacter_phage	33.6	4.4e-41
WP_014328775.1|2143450_2143903_-	GNAT family N-acetyltransferase	NA	X2CY06	Brucella_phage	53.6	4.9e-37
WP_014328777.1|2145510_2146113_-	hypothetical protein	NA	A0A088FAT4	Sulfitobacter_phage	33.0	1.7e-16
WP_014328778.1|2146109_2146706_-	hypothetical protein	NA	A0A2K9VHC9	Pseudomonas_phage	25.4	5.7e-09
WP_014328779.1|2146702_2147026_-	hypothetical protein	NA	F8TUS1	EBPR_podovirus	49.5	3.7e-23
WP_014328780.1|2147022_2147199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014328781.1|2147265_2148261_-	DUF5309 domain-containing protein	NA	A0A088FAT7	Sulfitobacter_phage	71.9	4.4e-131
WP_014328782.1|2148422_2149376_-	hypothetical protein	NA	A0A088F6W8	Sulfitobacter_phage	38.5	3.3e-35
WP_014328783.1|2149535_2149772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037397216.1|2150319_2152374_-|portal	phage portal protein	portal	A0A088F830	Sulfitobacter_phage	58.7	8.6e-198
WP_037397213.1|2152373_2153804_-	DNA packaging protein	NA	C8CLI4	Xylella_phage	64.3	3.1e-170
>prophage 7
NZ_CP029451	Sinorhizobium fredii CCBAU 25509 chromosome, complete genome	4198614	2542112	2576829	4198614	tRNA,transposase,protease	Bacillus_phage(40.0%)	31	NA	NA
WP_037437113.1|2542112_2542832_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_037400814.1|2543015_2543228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109982165.1|2543307_2546337_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_037400800.1|2546600_2549639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014329131.1|2550188_2551295_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012708843.1|2551349_2551661_-|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_014329132.1|2551837_2552941_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_014329133.1|2552980_2553436_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_014329134.1|2553432_2553903_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_037400797.1|2553985_2554528_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.8	2.2e-36
WP_012708848.1|2554825_2555011_+	DUF1059 domain-containing protein	NA	NA	NA	NA	NA
WP_014329136.1|2555026_2556286_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A1B0V011	Roseobacter_phage	43.4	3.6e-53
WP_014329137.1|2556282_2556915_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_014329138.1|2556911_2557535_-	DUF1285 domain-containing protein	NA	NA	NA	NA	NA
WP_037400794.1|2557801_2558815_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_014329140.1|2558818_2559739_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_167331216.1|2559738_2562549_+	DUF4159 domain-containing protein	NA	NA	NA	NA	NA
WP_037400792.1|2562556_2564626_+	membrane protein	NA	NA	NA	NA	NA
WP_014329144.1|2565100_2565661_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_014329145.1|2565912_2566890_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_109982119.1|2567013_2567862_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	32.5	1.6e-33
WP_037437944.1|2567810_2568161_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014329146.1|2568520_2569009_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_037437944.1|2569324_2569675_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_109982119.1|2569623_2570472_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	32.5	1.6e-33
WP_014329147.1|2570754_2571663_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_014329148.1|2571834_2572380_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_014329149.1|2572560_2573079_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_037396124.1|2573082_2573910_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_037396121.1|2574107_2575817_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_037396119.1|2576244_2576829_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	37.3	1.1e-28
>prophage 8
NZ_CP029451	Sinorhizobium fredii CCBAU 25509 chromosome, complete genome	4198614	2634894	2669244	4198614	tail,head,tRNA,integrase,portal,capsid,protease	Diachasmimorpha_longicaudata_entomopoxvirus(14.29%)	32	2663895:2663912	2675008:2675025
WP_037396083.1|2634894_2635611_+|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_014329204.1|2635719_2636172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037396037.1|2636823_2638356_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.7	3.4e-58
WP_014329206.1|2638501_2639059_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_014329207.1|2639069_2640002_-	DMT family transporter	NA	NA	NA	NA	NA
WP_037396035.1|2640137_2640599_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_048655303.1|2640925_2642320_+	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_014329210.1|2642324_2643266_+	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_037396033.1|2643282_2644137_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_037429073.1|2644325_2646071_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_014329213.1|2646166_2647600_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_037396023.1|2647672_2648668_-	GguC protein	NA	NA	NA	NA	NA
WP_014329215.1|2648822_2650037_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_014329216.1|2650036_2651572_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.2	1.3e-17
WP_014329217.1|2651760_2652828_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014329218.1|2653103_2654087_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014329219.1|2654186_2654645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014329220.1|2654648_2654879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014329221.1|2655290_2656283_+	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_014329222.1|2656347_2658702_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_037396015.1|2658813_2660025_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_014329224.1|2660266_2661307_+	D-xylose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_037396013.1|2661460_2662777_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_037396011.1|2662792_2663578_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-19
2663895:2663912	attL	TCCTGTCGGGTGCGCCAT	NA	NA	NA	NA
WP_037396009.1|2663948_2664992_-|integrase	tyrosine-type recombinase/integrase	integrase	B0VK72	Azospirillum_phage	31.5	1.4e-26
WP_080577550.1|2664988_2665243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037396007.1|2665229_2665760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037396005.1|2665771_2666116_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_037396003.1|2666112_2667330_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	34.7	4.3e-56
WP_037396000.1|2667329_2667857_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2K9VGN9	Pontimonas_phage	51.0	1.6e-31
WP_037395999.1|2667853_2668132_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_037395997.1|2668131_2669244_-|capsid	phage major capsid protein	capsid	K7XS73	uncultured_Mediterranean_phage	31.8	6.4e-38
2675008:2675025	attR	TCCTGTCGGGTGCGCCAT	NA	NA	NA	NA
>prophage 1
NZ_CP029453	Sinorhizobium fredii CCBAU 25509 plasmid pSF25509a, complete sequence	401505	0	65313	401505	transposase	Burkholderia_phage(16.67%)	55	NA	NA
WP_014858028.1|1242_2223_+	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	39.1	7.5e-59
WP_014858027.1|2377_3592_+	replication initiation protein RepC	NA	L7TKN6	Rhizobium_phage	26.2	2.2e-15
WP_080577853.1|4286_4802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158499791.1|5738_6314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034859522.1|6313_6520_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	47.1	2.3e-10
WP_015633599.1|6667_7585_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	51.7	5.6e-32
WP_162600460.1|8461_8704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085939171.1|8731_9791_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_109982302.1|9751_10429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014330219.1|10649_11567_-	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	25.1	1.4e-06
WP_014330218.1|11566_13219_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_014330217.1|13211_13808_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	49.5	5.2e-39
WP_014330934.1|14278_15274_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014330935.1|15282_15573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014857805.1|15602_16214_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_014330937.1|16210_17848_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	42.9	4.9e-103
WP_014330938.1|17893_18241_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	64.5	3.4e-38
WP_014330939.1|18237_18630_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_014857770.1|19038_20277_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_014857769.1|20295_21900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100209377.1|21930_22827_-	agmatinase family protein	NA	NA	NA	NA	NA
WP_014857767.1|22878_24075_-	radical SAM protein	NA	NA	NA	NA	NA
WP_014857766.1|24212_24365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014857764.1|25280_28784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037446536.1|28905_29985_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_034859931.1|30300_30873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080589713.1|31246_31801_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_167414966.1|31728_32151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167414967.1|32147_33227_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_015633366.1|33754_35452_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_015633367.1|35738_36011_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_014858087.1|36010_36571_+	cytochrome b561	NA	NA	NA	NA	NA
WP_014858088.1|36585_37260_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	28.3	2.3e-19
WP_015633368.1|37508_37760_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_034859617.1|38061_38535_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_153458762.1|38673_38934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034859618.1|39171_39369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034859607.1|39604_40318_-	ParA family protein	NA	A0A2H4JGZ2	uncultured_Caudovirales_phage	27.6	8.0e-10
WP_034859608.1|40962_41364_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_034859612.1|43873_44086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109023434.1|44201_44918_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_034859666.1|45370_46228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034859668.1|49453_50779_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.5	8.4e-29
WP_014330950.1|50969_51275_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_014857518.1|51274_51625_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_034859669.1|52042_52222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109982134.1|58001_58949_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_014330959.1|59370_59976_-	DUF1419 domain-containing protein	NA	NA	NA	NA	NA
WP_086018031.1|60473_61533_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_014330962.1|61534_62233_-	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_014330963.1|62229_62439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014330964.1|62410_62587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100209375.1|62872_63850_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014330966.1|63916_64117_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014857732.1|64509_65313_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	3.5e-30
>prophage 2
NZ_CP029453	Sinorhizobium fredii CCBAU 25509 plasmid pSF25509a, complete sequence	401505	72547	156070	401505	transposase	Escherichia_phage(12.5%)	51	NA	NA
WP_014330974.1|72547_73441_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	28.2	4.3e-21
WP_100209376.1|73639_74563_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_109023434.1|75703_76420_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_014330979.1|76769_78515_+	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_014857719.1|80012_80498_+	NTPase KAP	NA	NA	NA	NA	NA
WP_014857718.1|80523_80892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085939171.1|80949_82010_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_109023434.1|82223_82940_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_015633430.1|83294_84266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015633429.1|84353_85325_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014328393.1|85741_86764_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_083846302.1|88666_89650_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_080577880.1|89748_90684_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	34.3	1.2e-29
WP_161623564.1|90664_92149_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_161623566.1|92455_92776_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015633423.1|98299_98746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015633422.1|98742_99003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015633421.1|99893_100700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034859947.1|102142_102607_+	phasin	NA	NA	NA	NA	NA
WP_167331221.1|102916_103729_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_014857788.1|103838_106019_-	S9 family peptidase	NA	A0A1V0SHT0	Klosneuvirus	32.8	1.1e-41
WP_014328799.1|110215_111613_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_153297037.1|112649_112955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014857797.1|114530_115133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034859822.1|115163_115349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041409929.1|115654_117199_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_085939171.1|117288_118348_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_167331220.1|120243_121290_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_014857794.1|121369_122227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015633362.1|122320_122599_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_014857792.1|122595_123123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037403046.1|123246_125094_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_015633363.1|125093_125582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014857789.1|125569_126601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014327878.1|127764_128598_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014858061.1|130352_130802_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	40.4	5.2e-07
WP_015633495.1|130782_131136_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	48.4	5.5e-20
WP_014328441.1|132146_133244_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_037403033.1|134612_135824_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_014858053.1|137407_138151_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_014858052.1|138938_139085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014328799.1|140031_141429_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_014858072.1|141746_142526_+	radical SAM protein	NA	NA	NA	NA	NA
WP_015633488.1|142933_143524_+	nodulation N-acyltransferase NodA	NA	NA	NA	NA	NA
WP_010875356.1|143520_144168_+	chitooligosaccharide deacetylase NodB	NA	NA	NA	NA	NA
WP_014858070.1|144182_145424_+	chitooligosaccharide synthase NodC	NA	M1HPL2	Paramecium_bursaria_Chlorella_virus	26.7	2.5e-11
WP_015633486.1|145575_146607_+	nodulation factor ABC transporter ATP-binding protein NodI	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.5	9.4e-28
WP_015633485.1|146610_147399_+	nodulation protein NodJ	NA	NA	NA	NA	NA
WP_014858065.1|149724_150450_+	2-O-methyltransferase NoeI	NA	A0A2P0VP97	Tetraselmis_virus	28.3	3.3e-11
WP_015633479.1|154357_154591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037446536.1|154990_156070_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP029453	Sinorhizobium fredii CCBAU 25509 plasmid pSF25509a, complete sequence	401505	165393	218811	401505	transposase,integrase	Stx2-converting_phage(50.0%)	43	174752:174811	208096:209034
WP_015633473.1|165393_166395_+|integrase	site-specific integrase	integrase	S5M9V8	Brevibacillus_phage	23.6	4.1e-12
WP_014327878.1|168224_169058_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014858092.1|169839_170244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014330863.1|170986_171220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014330862.1|171200_172901_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	40.5	4.6e-88
WP_080577875.1|172946_173285_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	55.4	3.3e-30
WP_014330860.1|173296_173668_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_034859935.1|173746_174577_+	glycoside hydrolase family 16 protein	NA	M1HRU7	Paramecium_bursaria_Chlorella_virus	26.3	1.0e-16
174752:174811	attL	TAAGAGCCTGACCGAAAAAGAGTTGAGTGAAATCAGCCAGTTGTGATTCTGTTTGTTTGC	NA	NA	NA	NA
WP_014327878.1|174832_175666_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_034859708.1|175685_176171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083846293.1|176389_176764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014858080.1|176891_177929_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	43.0	3.9e-13
WP_161623565.1|179121_179271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014328393.1|182452_183475_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015633467.1|183627_183891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014330935.1|185837_186128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014857805.1|186157_186769_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_014330937.1|186765_188403_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	42.9	4.9e-103
WP_014330938.1|188448_188796_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	64.5	3.4e-38
WP_014330939.1|188792_189185_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_014857776.1|189234_189402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014857771.1|190501_191371_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	34.3	1.7e-33
WP_037437088.1|191380_192556_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_086018849.1|192954_193908_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_014857748.1|193972_196084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014857747.1|196132_197923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014857746.1|197975_198374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014857744.1|198610_199525_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_080577880.1|200388_201324_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	34.3	1.2e-29
WP_161623564.1|201304_202789_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_014327268.1|203446_203743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014327269.1|203742_205365_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.3	3.1e-102
WP_014332410.1|205429_205777_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	54.3	3.0e-26
WP_041409271.1|205773_206142_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_109982303.1|206199_206490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034859893.1|206621_208073_-	radical SAM family RiPP maturation amino acid epimerase	NA	NA	NA	NA	NA
WP_014327878.1|208176_209010_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014857677.1|209149_209527_-	hypothetical protein	NA	NA	NA	NA	NA
208096:209034	attR	TAAGAGCCTGACCGAAAAAGAGTTGAGTGAAATCAGCCAGTTGTGATTCTGTTTGTTTGCTTAGGACGAACGGAGACCACAATGGGCTGGACTGATTTCACCCGTCGGCAATATGCCCGACGCGCAAGGCGGTATGCAAGCGATCTGACGGACCGGGAATGGGGATTGATCTCGCCTTGCCTGCCTGGACCGCGGCGGTTGGGCAGGCCGCGCAGCACCGATCTTCGCGAGGTCGTGAATGCGTTGCTTTACATCGCCACGACGGGGTGCCAGTGGCGGATGATGCCCAAGGATTTTCCGCCTTTTACAACTGTCCAGTCCTATTTCTACGAATGGCGAGCGACAGGGTTATGGGGTCGGATCAACCATCATCTTGTGATGGAGGCGCGCGAATTGGAAGGCCGGGAAGCCTCGCCATCTGCTGGCGTGATTGACAGTCAAAGCGTGAAAACCACGGAAAGCGGCGGAATTTCGGGCTATGACGCGGGCAAGAAGATCAAGGGACGGAAGCGTCATATCGTCGTCGACACGCTCGGGTTGATGGTCGGCCTCAGGGTTCACAGCGCCGATATCCAAGATCGCGACGGCGCACCTGCCGTCCTCAAAACCATTCTCAAGCGCTGGCCGTGGCTGAGACATATCTTCGCCGACGGTGGTTATGCCGGACCGAAGCTGAAGGGCGCACTCCAAAAGATCGCTGCCTTCACTCTCCAGATCGTCAAGCGGACCGACAAGGCCAAGGGCTTCGAAGTTCTGCCGCGGCGCTGGGTCGTGGAGCGCACCTTCGCATGGCTTGGCAGATGCCGACGATTGGCTAAGGATTGGGAGAAGTCCATCGCATCAGCCGAGGCTTGGATCACTATCGCCCACATCCGGGTCCTGACACGACGCTTGGCAAGGTACGGATATTGTTGAGACCTTTTCGAGTCAGGCTCTAAG	NA	NA	NA	NA
WP_014857676.1|210166_210619_-	nitrogenase stabilizing/protective protein NifW	NA	NA	NA	NA	NA
WP_014857675.1|210782_211946_-	cysteine desulfurase NifS	NA	H7BUW1	unidentified_phage	36.4	9.6e-37
WP_015633453.1|212943_214812_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014857667.1|217682_217907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014327878.1|217977_218811_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP029453	Sinorhizobium fredii CCBAU 25509 plasmid pSF25509a, complete sequence	401505	229745	231306	401505		Lake_Baikal_phage(50.0%)	2	NA	NA
WP_014857651.1|229745_230066_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	37.6	2.9e-12
WP_014857650.1|230739_231306_-	peroxiredoxin	NA	M1TUY3	Synechococcus_phage	54.0	9.1e-49
>prophage 5
NZ_CP029453	Sinorhizobium fredii CCBAU 25509 plasmid pSF25509a, complete sequence	401505	236103	237750	401505		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_034859517.1|236103_237750_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	35.5	1.7e-15
>prophage 6
NZ_CP029453	Sinorhizobium fredii CCBAU 25509 plasmid pSF25509a, complete sequence	401505	250754	254547	401505		Acanthamoeba_polyphaga_moumouvirus(33.33%)	3	NA	NA
WP_014857633.1|250754_252293_+	insulinase family protein	NA	L7RBE7	Acanthamoeba_polyphaga_moumouvirus	29.3	1.2e-23
WP_014857632.1|252289_253633_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	22.2	7.7e-14
WP_014857631.1|254115_254547_+	helix-turn-helix transcriptional regulator	NA	A0A223W054	Agrobacterium_phage	47.1	4.8e-26
>prophage 7
NZ_CP029453	Sinorhizobium fredii CCBAU 25509 plasmid pSF25509a, complete sequence	401505	260068	297457	401505	transposase	Stx2-converting_phage(22.22%)	27	NA	NA
WP_041415762.1|260068_261148_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_014857619.1|263361_263619_-	hypothetical protein	NA	A0A2I7REY7	Vibrio_phage	49.2	4.9e-10
WP_048655403.1|264081_265650_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_080577876.1|265911_266130_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	51.4	2.4e-10
WP_034859758.1|266424_266862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086018031.1|268493_269554_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_048655401.1|269886_270351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015633375.1|270376_270847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085939171.1|272896_273956_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_015633378.1|274011_274377_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015633379.1|274373_275243_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	29.3	2.8e-25
WP_014857614.1|277880_278891_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_109982151.1|279177_280605_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_014857613.1|280881_281427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014857612.1|281426_281735_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_014857607.1|283912_284530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014857606.1|284660_285107_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015633385.1|285252_285684_-	helix-turn-helix transcriptional regulator	NA	A0A223W054	Agrobacterium_phage	46.3	2.9e-23
WP_014857603.1|286283_287249_-	transcriptional regulator NodD1	NA	NA	NA	NA	NA
WP_048655408.1|287977_289432_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.0	8.6e-51
WP_034859288.1|289578_290994_+	phosphomannomutase	NA	NA	NA	NA	NA
WP_014857596.1|291308_292277_+	nodulation protein NodZ	NA	NA	NA	NA	NA
WP_014857595.1|292521_293577_+	GDP-mannose 4,6-dehydratase	NA	M1HKK4	Acanthocystis_turfacea_Chlorella_virus	64.3	4.5e-126
WP_034859283.1|293591_294530_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.6	3.5e-90
WP_041409271.1|295057_295426_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014332410.1|295422_295770_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	54.3	3.0e-26
WP_014327269.1|295834_297457_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.3	3.1e-102
>prophage 8
NZ_CP029453	Sinorhizobium fredii CCBAU 25509 plasmid pSF25509a, complete sequence	401505	310648	311788	401505		Synechococcus_phage(50.0%)	2	NA	NA
WP_014330283.1|310648_311110_-	Hsp20 family protein	NA	C7BV44	Synechococcus_phage	37.4	5.2e-18
WP_014330282.1|311473_311788_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	60.9	3.1e-22
>prophage 9
NZ_CP029453	Sinorhizobium fredii CCBAU 25509 plasmid pSF25509a, complete sequence	401505	316182	385185	401505	protease,transposase	Acidithiobacillus_phage(25.0%)	56	NA	NA
WP_034859270.1|316182_316827_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	33.3	6.3e-14
WP_014330276.1|316923_319821_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.8e-184
WP_167414968.1|320281_320896_-|protease	YopT-type cysteine protease domain-containing protein	protease	NA	NA	NA	NA
WP_014857579.1|321648_321864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037446536.1|322270_323350_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_037403072.1|325357_326908_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.9	9.3e-112
WP_014330860.1|327474_327846_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_080577875.1|327857_328196_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	55.4	3.3e-30
WP_014330862.1|328241_329940_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	40.5	4.6e-88
WP_014330863.1|329921_330155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015633401.1|331150_331699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014857573.1|331715_333809_-	type III secretion system export apparatus subunit SctV	NA	NA	NA	NA	NA
WP_014857572.1|333997_334888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014857569.1|336278_337091_-	effector protein NopP	NA	NA	NA	NA	NA
WP_014857567.1|337886_338924_-	translocation protein	NA	NA	NA	NA	NA
WP_034859387.1|338920_339739_-	type III secretion system export apparatus protein SctT	NA	NA	NA	NA	NA
WP_010875101.1|339747_340023_-	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_014857564.1|340022_340691_-	type III secretion system export apparatus protein SctR	NA	NA	NA	NA	NA
WP_034859390.1|340683_341739_-	type III secretion system cytoplasmic ring protein SctQ	NA	NA	NA	NA	NA
WP_014857562.1|341785_342322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015633405.1|342297_343653_-	type III secretion system ATPase SctN	NA	NA	NA	NA	NA
WP_014857560.1|343649_344276_-	nodulation protein NolV	NA	NA	NA	NA	NA
WP_015633406.1|344277_344916_-	nodulation protein NolU	NA	NA	NA	NA	NA
WP_014857558.1|344912_345782_-	nodulation protein NolT	NA	NA	NA	NA	NA
WP_014857557.1|345791_346286_-	nodulation protein NolB	NA	NA	NA	NA	NA
WP_032490256.1|346441_347146_+	nodulation protein NolW	NA	NA	NA	NA	NA
WP_014857555.1|347427_349218_+	type II secretion system effector nodulation protein NopX	NA	NA	NA	NA	NA
WP_014857553.1|349402_349831_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_014857550.1|351180_352191_+	cysteine synthase family protein	NA	NA	NA	NA	NA
WP_014857549.1|352187_353327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014857548.1|353326_355213_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_014857547.1|355209_356424_+	MFS transporter	NA	NA	NA	NA	NA
WP_014857546.1|356681_357698_+	type II secretion system effector nodulation protein NopL	NA	NA	NA	NA	NA
WP_014328393.1|358247_359270_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014857545.1|359488_360055_-	CpaD family pilus assembly lipoprotein	NA	NA	NA	NA	NA
WP_034859716.1|360064_361492_-	type II and III secretion system protein family protein	NA	NA	NA	NA	NA
WP_014857543.1|361515_362196_-	response regulator	NA	W8CYM9	Bacillus_phage	26.5	3.8e-17
WP_014857541.1|363364_363571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037402985.1|363890_364829_+	transcriptional regulator NodD2	NA	NA	NA	NA	NA
WP_086018076.1|365773_366963_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	7.0e-51
WP_014857536.1|367953_368697_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	46.1	3.5e-56
WP_014327878.1|369858_370692_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_037403140.1|371725_372028_-	exopolysaccharide production repressor	NA	NA	NA	NA	NA
WP_010875125.1|372160_372337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014857531.1|372333_372537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014857530.1|372559_373048_-	NifX-associated nitrogen fixation protein	NA	NA	NA	NA	NA
WP_015633414.1|373300_374842_-	nitrogenase molybdenum-iron protein subunit beta	NA	NA	NA	NA	NA
WP_014857528.1|374937_376452_-	nitrogenase molybdenum-iron protein alpha chain	NA	NA	NA	NA	NA
WP_010875130.1|376547_377438_-	nitrogenase iron protein	NA	NA	NA	NA	NA
WP_166436502.1|377934_378972_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_014857526.1|379179_379770_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014857525.1|379762_380992_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_158499789.1|381747_381894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109023434.1|382561_383278_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_037403195.1|383399_383873_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_167414969.1|384459_385185_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP029452	Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence	2210745	598357	635082	2210745	transposase	Leptospira_phage(42.86%)	30	NA	NA
WP_037471040.1|598357_598600_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014327268.1|598793_599090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014327269.1|599089_600712_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.3	3.1e-102
WP_014332410.1|600776_601124_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	36.6	3.4e-14
WP_041409271.1|601120_601489_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_037471036.1|601707_603300_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	33.8	4.8e-55
WP_080581779.1|603397_603676_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	37.3	2.0e-09
WP_095678167.1|605422_606509_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.7	5.8e-44
WP_050984210.1|606569_607823_-	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_050996901.1|608040_608346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037402644.1|608422_609757_-	RkpR, polysaccharide export protein	NA	NA	NA	NA	NA
WP_037402642.1|609757_610417_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.0	1.1e-08
WP_037402639.1|610413_611184_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_037402637.1|611188_612490_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_037402635.1|612597_613512_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_037402633.1|614287_614671_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_037402653.1|614667_614862_-	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_037402650.1|615391_616558_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_162129735.1|616814_617138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109982230.1|619163_620876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109982231.1|621388_621916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037402730.1|623307_624219_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_037402726.1|624215_625316_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_037402724.1|625312_626848_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	4.4e-21
WP_037402721.1|626851_627952_-	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_037402736.1|627974_629354_-	amidohydrolase	NA	NA	NA	NA	NA
WP_037402718.1|629355_630015_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_037402715.1|630857_631511_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_037402712.1|631958_632186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095689778.1|633990_635082_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
