The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029546	Lacticaseibacillus paracasei strain EG9 chromosome, complete genome	2927257	3831	63367	2927257	tRNA,transposase,holin,protease	unidentified_phage(33.33%)	54	NA	NA
WP_003568424.1|3831_5220_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_003572790.1|5261_7163_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_003568420.1|7425_7635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016387281.1|7796_8561_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003568415.1|8562_9051_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003586125.1|9047_10247_+	amidohydrolase	NA	NA	NA	NA	NA
WP_003659016.1|11125_11629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109990468.1|11648_13031_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_109989988.1|13633_14650_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	5.4e-36
WP_109989989.1|14675_14987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016363467.1|15331_16108_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_109989990.1|16324_17524_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.8	1.6e-66
WP_162551598.1|17928_18534_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003568507.1|18657_19551_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003568509.1|19599_20238_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003568512.1|20466_21843_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003592443.1|22065_22410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016387641.1|22901_23828_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003584098.1|23969_25412_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003584100.1|25607_26240_+	membrane protein	NA	NA	NA	NA	NA
WP_003577243.1|26412_27024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109989992.1|27183_28113_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	2.9e-20
WP_003562571.1|30039_30690_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_011673955.1|31088_31781_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003592457.1|32057_32411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003592458.1|32475_32796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673957.1|33952_35545_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.5	8.6e-12
WP_016386840.1|35882_37256_-	MFS transporter	NA	NA	NA	NA	NA
WP_011673959.1|37433_37757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016386839.1|37937_41249_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_003572929.1|41245_41848_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003572931.1|42098_42359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562592.1|42572_43235_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016386838.1|43234_44164_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003568628.1|44175_44805_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016386837.1|44807_46061_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	43.0	1.5e-14
WP_003577283.1|46693_47347_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011673963.1|47412_47634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562602.1|47757_47943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016386836.1|47979_49836_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.0	7.5e-68
WP_003592581.1|49855_50083_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_003577285.1|50230_50815_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_003592583.1|50863_51523_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_011673965.1|52136_52931_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_003562635.1|52923_54144_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_003592587.1|54127_54727_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_003592589.1|54754_55537_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	39.5	7.6e-38
WP_003577290.1|55533_56559_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.3	6.0e-59
WP_003577291.1|57314_58454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673967.1|58585_60412_-	MFS transporter	NA	NA	NA	NA	NA
WP_003592593.1|60570_61149_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032759734.1|61271_61646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003592598.1|61629_62352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109989993.1|62446_63367_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
>prophage 2
NZ_CP029546	Lacticaseibacillus paracasei strain EG9 chromosome, complete genome	2927257	328206	415849	2927257	transposase,holin,protease	Faecalibacterium_phage(21.74%)	77	NA	NA
WP_109990471.1|328206_328896_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_109990037.1|329049_330066_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.4e-36
WP_003583152.1|330151_330838_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_003583154.1|331349_332876_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.1	1.6e-52
WP_109990038.1|333146_335243_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003563244.1|335243_335555_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003563247.1|335696_336983_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_049144716.1|336999_337422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563251.1|337443_338304_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_049144717.1|338417_339059_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003563255.1|339345_340176_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_049144718.1|340168_341038_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_109990039.1|341077_342073_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_049144719.1|342627_343407_+	alpha/beta hydrolase	NA	A0A291AV30	Mycobacterium_phage	25.4	1.3e-05
WP_003561810.1|344757_345687_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_011674977.1|346298_347315_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
WP_002816285.1|347582_347834_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_109990040.1|347887_348730_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.3	6.7e-157
WP_003593002.1|349020_349710_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	3.3e-29
WP_003573580.1|349870_351241_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.0	4.8e-11
WP_011674103.1|351604_352423_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003563382.1|352739_353009_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_003563383.1|353249_354257_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003563385.1|354308_354800_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003563386.1|354842_355652_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003568992.1|355644_356496_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_003593021.1|356525_358769_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_003573589.1|358858_359275_+	PTS N-acetylglucosamine transporter subunit IIBC	NA	NA	NA	NA	NA
WP_109990472.1|359267_360953_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_003593025.1|361135_362947_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.0	1.4e-45
WP_003593027.1|362939_364649_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	8.0e-40
WP_071798369.1|365165_365288_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_162551625.1|365618_366722_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_162551602.1|367338_368352_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003659803.1|368614_368803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003593032.1|368909_369776_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003583296.1|369932_370949_+	linear amide C-N hydrolase	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	29.2	5.8e-22
WP_003563408.1|371068_372049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016386916.1|372195_373890_-	oleate hydratase	NA	NA	NA	NA	NA
WP_003577796.1|374125_374689_-	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003563416.1|374773_375142_-	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_003593036.1|375191_375773_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_003563420.1|375759_376779_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_003593039.1|377169_377598_-	OsmC family protein	NA	NA	NA	NA	NA
WP_003593042.1|377783_377963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109990473.1|378171_379077_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_109989998.1|379140_380157_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	8.4e-37
WP_109990041.1|380572_381985_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_003593046.1|382217_382511_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003593047.1|382589_383753_+	MFS transporter	NA	NA	NA	NA	NA
WP_003583317.1|383935_384547_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_096836596.1|385186_386050_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	3.1e-24
WP_079322958.1|386046_386343_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_109990043.1|386573_387455_-	class II fructose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_003563444.1|388041_389775_+	pyruvate oxidase	NA	G8DDL3	Micromonas_pusilla_virus	23.9	2.7e-27
WP_109990044.1|389860_390874_-	serine hydrolase	NA	X2KYU1	Mycobacterium_phage	26.4	1.5e-17
WP_003593056.1|390952_392020_-	dipeptide epimerase	NA	NA	NA	NA	NA
WP_003563450.1|392232_392982_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	56.3	1.4e-73
WP_003604400.1|393011_393764_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_003593060.1|394091_395435_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_003593063.1|395564_396692_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_003589893.1|396811_398167_+	APC family permease	NA	NA	NA	NA	NA
WP_003563458.1|398231_398660_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003601252.1|398831_399698_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	31.9	2.1e-28
WP_109990045.1|399819_400842_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003563463.1|400987_401332_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_109990046.1|401439_402684_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	6.7e-12
WP_003583336.1|402864_403467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109990047.1|403466_404897_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	27.3	2.8e-38
WP_003573646.1|404915_405281_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_011674122.1|405317_406463_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003563473.1|406579_406891_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_109990037.1|407955_408972_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.4e-36
WP_109990048.1|410294_410879_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	44.0	5.9e-35
WP_011674125.1|411137_413867_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_003577843.1|413859_414576_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_109989998.1|414832_415849_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	8.4e-37
>prophage 3
NZ_CP029546	Lacticaseibacillus paracasei strain EG9 chromosome, complete genome	2927257	427164	479308	2927257	transposase,integrase	Lactobacillus_phage(60.0%)	50	427121:427155	478155:478189
427121:427155	attL	GGCTCCTATGCTGTAATTACGGACAAAAATAGTTT	NA	NA	NA	NA
WP_079322958.1|427164_427461_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_109990049.1|427457_428321_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	2.4e-24
WP_011674977.1|433150_434167_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
WP_109990051.1|434230_434722_-	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_162551603.1|435265_440794_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_011674135.1|441299_443834_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.6	6.0e-68
WP_003577866.1|444417_445860_+	amino acid permease	NA	NA	NA	NA	NA
WP_109990053.1|445971_446475_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_003573683.1|446653_447547_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	3.0e-06
WP_109990054.1|447701_448568_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_109990055.1|448584_449418_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_109990056.1|449514_450405_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_016387388.1|450438_451656_+	MFS transporter	NA	NA	NA	NA	NA
WP_016387389.1|451674_452574_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_003593109.1|453014_453830_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_003577893.1|453863_454793_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	63.7	5.9e-106
WP_109990057.1|454982_455528_-	hydrophobic protein	NA	NA	NA	NA	NA
WP_003569067.1|455848_457018_-|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	98.2	6.6e-219
WP_003573997.1|457130_457391_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	40.7	2.5e-09
WP_109990058.1|457480_458104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002816285.1|458171_458423_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_109990040.1|458476_459319_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.3	6.7e-157
WP_109990059.1|459420_459675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003572180.1|459867_460575_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003572182.1|460734_461157_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IJN5	Lactobacillus_phage	39.1	7.8e-21
WP_003572184.1|461149_461503_-	helix-turn-helix transcriptional regulator	NA	A0A141E1M3	Streptococcus_phage	40.9	7.7e-14
WP_003574003.1|461746_461995_+	hypothetical protein	NA	A0A0P0ID24	Lactobacillus_phage	97.5	2.7e-37
WP_003572187.1|462036_462237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572188.1|462207_463041_-	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	37.8	2.8e-46
WP_010493122.1|463101_463860_+	ORF6C domain-containing protein	NA	A0A1B0YEA7	Lactobacillus_phage	49.4	1.9e-41
WP_003572193.1|463860_464040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572196.1|464032_464284_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_003572199.1|464349_464706_+	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	98.3	2.0e-62
WP_003572201.1|464790_464994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572202.1|464976_465522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003661649.1|465702_466017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003574012.1|466009_466756_+	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	55.3	1.7e-34
WP_003574014.1|466770_467595_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	75.5	2.3e-117
WP_003561810.1|467817_468747_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_003574018.1|469206_469629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016387459.1|469630_470368_+	hypothetical protein	NA	A0A097BY87	Enterococcus_phage	42.6	2.9e-47
WP_010493149.1|470379_470667_+	hypothetical protein	NA	Q8LTA8	Lactobacillus_phage	76.8	1.6e-38
WP_010493151.1|470736_471069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674145.1|471583_472027_+	hypothetical protein	NA	A0A0P0IZI6	Lactobacillus_phage	96.6	2.8e-77
WP_003572221.1|472540_473194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109990061.1|473444_474443_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.7	1.0e-50
WP_003573729.1|474638_474857_-	CsbD family protein	NA	NA	NA	NA	NA
WP_109990062.1|476489_477652_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.1	9.6e-29
WP_010493173.1|477743_478079_+	ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	90.6	6.8e-52
WP_041091277.1|478291_479308_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.1	2.7e-35
478155:478189	attR	GGCTCCTATGCTGTAATTACGGACAAAAATAGTTT	NA	NA	NA	NA
>prophage 4
NZ_CP029546	Lacticaseibacillus paracasei strain EG9 chromosome, complete genome	2927257	484084	510764	2927257	transposase	Lactobacillus_phage(57.14%)	19	NA	NA
WP_109990064.1|484084_484872_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003561810.1|485661_486591_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_003593233.1|486686_486935_-	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_049145074.1|487128_488235_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003596308.1|489149_490166_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
WP_003593245.1|491005_491923_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003593246.1|492069_492678_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	52.8	1.8e-50
WP_003593248.1|492688_493957_+	NADPH-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	47.7	1.8e-49
WP_079322958.1|494027_494324_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_109990049.1|494320_495184_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	2.4e-24
WP_003593269.1|495343_496315_+	LysM peptidoglycan-binding domain-containing protein	NA	Q6J1W8	Lactobacillus_phage	94.0	4.2e-171
WP_011674193.1|497022_498159_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003573812.1|499963_500677_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_016386980.1|501382_502294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016386981.1|502566_503955_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_003583591.1|505044_505713_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_003593290.1|506780_507158_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_016371951.1|507154_509158_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_096835977.1|509843_510764_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	2.6e-21
>prophage 5
NZ_CP029546	Lacticaseibacillus paracasei strain EG9 chromosome, complete genome	2927257	630481	654158	2927257	head,portal,transposase,tail,capsid	Acinetobacter_phage(33.33%)	26	NA	NA
WP_109990011.1|630481_631644_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.5	1.9e-29
WP_003593520.1|632214_633366_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	33.2	2.4e-56
WP_003662889.1|633352_634897_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	26.0	3.6e-39
WP_003593566.1|634960_635254_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_109990075.1|635847_636159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|636316_637237_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_162551605.1|637226_637877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003593570.1|638378_639419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003563847.1|639436_639775_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003563849.1|639935_640241_-	membrane protein	NA	NA	NA	NA	NA
WP_003563851.1|640396_640696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003593573.1|640756_641779_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_003563857.1|642032_642395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003593574.1|642532_643012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003563871.1|643004_644171_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003563872.1|644674_644869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563873.1|644997_645624_+	transcriptional repressor LexA	NA	A0A1B2APZ3	Phage_Wrath	35.9	4.9e-11
WP_003593577.1|645752_646226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003578002.1|646239_647187_-	AEC family transporter	NA	NA	NA	NA	NA
WP_003593579.1|647209_647827_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_003593583.1|648088_648997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003593584.1|649091_649652_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_003563881.1|649659_650016_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_003569257.1|650219_651155_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003593587.1|651379_652255_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_109990011.1|652995_654158_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.5	1.9e-29
>prophage 6
NZ_CP029546	Lacticaseibacillus paracasei strain EG9 chromosome, complete genome	2927257	774774	841795	2927257	head,terminase,tRNA,portal,transposase,holin,tail,capsid,integrase,protease	Lactobacillus_phage(89.8%)	77	774344:774361	849814:849831
774344:774361	attL	TCGCAGTCGCAGAAACCT	NA	NA	NA	NA
WP_003578174.1|774774_777186_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.4	0.0e+00
WP_003564130.1|777451_779095_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_003593811.1|779099_779810_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_003569458.1|779952_780168_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003569460.1|780283_781105_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_109990084.1|781101_781605_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_109990085.1|781928_783068_-|integrase	site-specific integrase	integrase	A0A0P0IXL3	Lactobacillus_phage	98.4	3.9e-216
WP_109990086.1|783175_784339_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_109990475.1|784407_785721_-	adenine-specific methyltransferase EcoRI family protein	NA	A0A1B0XVT8	Campylobacter_phage	36.8	2.0e-22
WP_109990087.1|785841_786708_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IV64	Lactobacillus_phage	92.3	3.2e-146
WP_016371933.1|786694_787054_-	helix-turn-helix transcriptional regulator	NA	A0A0P0I3L3	Lactobacillus_phage	63.9	1.8e-34
WP_003578190.1|787323_787521_+	hypothetical protein	NA	A0A0P0IK60	Lactobacillus_phage	100.0	5.2e-28
WP_109990088.1|787517_788240_+	Rha family transcriptional regulator	NA	A0A0P0IDD0	Lactobacillus_phage	99.6	6.9e-126
WP_003593164.1|788247_788460_+	hypothetical protein	NA	A0A0N7IRA6	Lactobacillus_phage	98.6	1.7e-29
WP_003657835.1|788568_788793_+	DUF771 domain-containing protein	NA	A0A0P0IQT9	Lactobacillus_phage	100.0	2.6e-39
WP_012491233.1|788881_789094_+	hypothetical protein	NA	A0A0P0IXL9	Lactobacillus_phage	100.0	2.5e-36
WP_016364602.1|789103_789979_+	YqaJ viral recombinase family protein	NA	A0A0P0IJW5	Lactobacillus_phage	99.3	7.2e-170
WP_016364601.1|789981_790176_+	hypothetical protein	NA	A0A0P0IZQ2	Lactobacillus_phage	98.4	5.5e-30
WP_060611973.1|790175_791063_+	recombinase RecT	NA	A0A0P0HRX2	Lactobacillus_phage	99.3	7.3e-162
WP_109990089.1|791071_791317_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IV68	Lactobacillus_phage	96.3	3.2e-35
WP_109990090.1|791321_792155_+	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	90.0	6.5e-120
WP_109990091.1|792192_793014_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	99.3	8.8e-154
WP_109990092.1|793010_793310_+	hypothetical protein	NA	A0A0P0IK66	Lactobacillus_phage	82.8	3.4e-39
WP_109990093.1|793272_793557_+	hypothetical protein	NA	A0A0P0IDD7	Lactobacillus_phage	97.9	7.5e-44
WP_109990094.1|793525_793873_+	hypothetical protein	NA	A0A0P0IQU7	Lactobacillus_phage	98.3	1.3e-61
WP_003657857.1|793865_794444_+	HNH endonuclease	NA	A0A0P0I7T6	Lactobacillus_phage	98.4	5.9e-104
WP_025376211.1|794460_794880_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0IXM5	Lactobacillus_phage	98.6	3.5e-74
WP_016364251.1|795172_795496_+	hypothetical protein	NA	A0A0N7IRA8	Lactobacillus_phage	99.1	2.8e-55
WP_016364250.1|795574_796024_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0P0IZR0	Lactobacillus_phage	92.6	4.9e-74
WP_109990095.1|796684_797065_+	HNH endonuclease	NA	A0A0P0HRY0	Lactobacillus_phage	96.8	2.4e-69
WP_071798176.1|797134_797509_+	hypothetical protein	NA	A0A1B0YE76	Lactobacillus_phage	98.4	3.1e-61
WP_003598089.1|797511_799242_+|terminase	terminase large subunit	terminase	A0A0P0IJU3	Lactobacillus_phage	99.5	0.0e+00
WP_109990096.1|799260_800496_+|portal	phage portal protein	portal	A0A1B0Y4Q9	Lactobacillus_phage	99.5	1.7e-233
WP_109990097.1|800473_801181_+|protease	Clp protease ClpP	protease	A0A1B0Y857	Lactobacillus_phage	98.7	1.8e-126
WP_016387127.1|801185_802418_+|capsid	phage major capsid protein	capsid	A0A1B0YA73	Lactobacillus_phage	95.6	1.4e-216
WP_016382022.1|802491_802740_+	hypothetical protein	NA	A0A0P0I3K0	Lactobacillus_phage	96.3	1.3e-36
WP_109990098.1|802753_803053_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0Y2R7	Lactobacillus_phage	100.0	8.1e-49
WP_012491255.1|803018_803357_+|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	100.0	2.2e-58
WP_019875902.1|803340_803670_+	hypothetical protein	NA	A0A0P0IDB8	Lactobacillus_phage	99.1	2.6e-56
WP_016387125.1|803659_804043_+	phage protein	NA	A0A0P0IQS9	Lactobacillus_phage	98.4	2.2e-67
WP_020751513.1|804054_804702_+	hypothetical protein	NA	A0A0P0I7R6	Lactobacillus_phage	94.9	2.7e-113
WP_016387123.1|804778_805144_+	hypothetical protein	NA	A0A0P0IXK4	Lactobacillus_phage	99.2	1.0e-61
WP_003582283.1|805224_805386_+	hypothetical protein	NA	A0A0P0IJV2	Lactobacillus_phage	100.0	7.5e-25
WP_016387122.1|805405_808576_+|tail	phage tail tape measure protein	tail	A0A1B0YA78	Lactobacillus_phage	98.2	0.0e+00
WP_109990099.1|808582_809278_+|tail	phage tail protein	tail	A0A1B0Y2S2	Lactobacillus_phage	98.7	3.5e-127
WP_096835977.1|812640_813561_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	2.6e-21
WP_109990100.1|813587_814733_+	hypothetical protein	NA	A0A1B0Y2S0	Lactobacillus_phage	95.5	2.0e-167
WP_109990101.1|814761_815187_+	DUF1617 family protein	NA	A0A1B0Y2S1	Lactobacillus_phage	97.9	3.7e-71
WP_109990102.1|815189_815459_+	hypothetical protein	NA	A0A1B0Y3N0	Lactobacillus_phage	96.6	9.9e-38
WP_109990103.1|815504_815798_+	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	70.8	4.9e-30
WP_109990104.1|815787_816222_+|holin	phage holin	holin	A0A0P0IDC6	Lactobacillus_phage	96.5	5.3e-49
WP_012491267.1|816221_816410_+	hypothetical protein	NA	A0A0P0IQT6	Lactobacillus_phage	100.0	6.7e-25
WP_109990105.1|816396_817371_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0P0I7S1	Lactobacillus_phage	99.7	1.7e-196
WP_109990106.1|817891_819403_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_003593829.1|819430_820990_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_003564137.1|821086_821560_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003583932.1|821904_823110_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_016387113.1|823243_824572_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003564140.1|824761_825028_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003574245.1|825076_826420_+	PFL family protein	NA	NA	NA	NA	NA
WP_003593835.1|826529_827585_+	competence protein	NA	NA	NA	NA	NA
WP_003564143.1|827774_828410_-	DsbA family protein	NA	NA	NA	NA	NA
WP_003564144.1|828479_829073_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_003564145.1|829266_829938_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_003564146.1|829939_830737_+	NAD kinase	NA	NA	NA	NA	NA
WP_003564147.1|830736_831639_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003569478.1|831747_832806_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003569480.1|832962_833598_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_003564150.1|833619_834438_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_003601683.1|834656_835655_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.8	1.8e-55
WP_003564151.1|835759_836800_-	lactonase family protein	NA	NA	NA	NA	NA
WP_003593849.1|837071_837449_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_003564153.1|837561_837831_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_003564154.1|837958_838948_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	71.9	8.2e-138
WP_003564155.1|839175_840123_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003569501.1|840188_841031_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003564157.1|841285_841795_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
849814:849831	attR	AGGTTTCTGCGACTGCGA	NA	NA	NA	NA
>prophage 7
NZ_CP029546	Lacticaseibacillus paracasei strain EG9 chromosome, complete genome	2927257	889646	898989	2927257		Streptococcus_phage(33.33%)	8	NA	NA
WP_003564244.1|889646_892538_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	1.9e-307
WP_003564246.1|892889_893429_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_003564248.1|893591_894479_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	1.1e-08
WP_003564250.1|894475_895504_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	51.2	2.3e-90
WP_109990108.1|895508_896456_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.7	1.2e-53
WP_003569571.1|896841_897297_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003564255.1|897413_898004_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	52.3	1.1e-52
WP_109990109.1|898326_898989_-	Ltp family lipoprotein	NA	A0A097BY93	Leuconostoc_phage	65.5	9.4e-13
>prophage 8
NZ_CP029546	Lacticaseibacillus paracasei strain EG9 chromosome, complete genome	2927257	1319147	1326587	2927257	tRNA,transposase	unidentified_phage(33.33%)	7	NA	NA
WP_003570286.1|1319147_1320026_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	38.8	3.8e-54
WP_003570288.1|1320129_1321326_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	32.3	1.1e-43
WP_003565371.1|1321463_1321919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003590674.1|1322014_1323907_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.1	8.5e-51
WP_003598632.1|1323935_1324886_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	65.6	1.5e-125
WP_003579093.1|1325013_1325505_+	dihydrofolate reductase	NA	A0A1L7N103	Ralstonia_phage	35.9	5.3e-21
WP_109990140.1|1325657_1326587_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.5	3.2e-19
>prophage 9
NZ_CP029546	Lacticaseibacillus paracasei strain EG9 chromosome, complete genome	2927257	1718583	1829012	2927257	head,terminase,portal,tRNA,transposase,holin,tail,capsid,integrase,protease	Lactobacillus_phage(71.88%)	114	1763468:1763492	1834602:1834626
WP_109990015.1|1718583_1720086_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_003585300.1|1720186_1720540_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003585301.1|1720514_1720712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003594902.1|1720884_1721403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003594904.1|1721430_1721967_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_003594905.1|1722216_1723011_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_109990172.1|1723084_1724620_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003566031.1|1724613_1724988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003594910.1|1725064_1726432_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	D0R096	Streptococcus_phage	34.0	4.4e-73
WP_003566035.1|1726716_1727190_+	nucleoside 2-deoxyribosyltransferase	NA	A0A1W6JL37	Lactococcus_phage	56.2	3.5e-38
WP_003566037.1|1727273_1728011_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_109990173.1|1729419_1730582_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.1	2.8e-28
WP_109990175.1|1731309_1733064_-	pyruvate oxidase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	27.5	1.1e-39
WP_003594933.1|1733387_1734554_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003575994.1|1734537_1735818_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_109990176.1|1735829_1737011_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_003566056.1|1737355_1737655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003660564.1|1737655_1738486_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_003575983.1|1738633_1739197_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_003594938.1|1739309_1740128_+	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_003566065.1|1740187_1741327_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_003566067.1|1741405_1742011_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003594941.1|1742738_1743203_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003594944.1|1743195_1743648_-	SprT family protein	NA	NA	NA	NA	NA
WP_109990177.1|1743789_1744542_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.4	1.9e-09
WP_003575502.1|1744534_1745434_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003566076.1|1745430_1746426_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003594949.1|1746912_1747350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566079.1|1747486_1750147_-	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.8	1.4e-75
WP_011674604.1|1750454_1751612_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003660553.1|1751878_1752706_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.3	6.1e-70
WP_003594959.1|1752708_1753902_-	serine hydrolase	NA	A0A2R4AS58	Mycobacterium_phage	27.1	2.7e-10
WP_003566087.1|1753905_1755369_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	42.7	2.6e-100
WP_003566099.1|1755731_1756433_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003575514.1|1756457_1757603_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_109990178.1|1757709_1758507_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	38.7	2.1e-35
WP_109990179.1|1758519_1760496_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_109990180.1|1760824_1761652_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003566109.1|1761713_1763180_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	35.9	8.9e-72
1763468:1763492	attL	GGTCCTTATGTGTAGGTTTCTGGGC	NA	NA	NA	NA
WP_109990181.1|1763654_1765973_-	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	40.1	2.8e-35
WP_003594971.1|1766398_1766773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566828.1|1766912_1767335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109990182.1|1769421_1770558_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_003594977.1|1770666_1770984_-	glutaredoxin	NA	NA	NA	NA	NA
WP_003594979.1|1771154_1772822_-	phosphoenolpyruvate carboxykinase (ATP)	NA	NA	NA	NA	NA
WP_003566823.1|1773036_1773204_-	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_109990183.1|1773239_1775351_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_109990184.1|1776028_1776781_-	acyltransferase	NA	NA	NA	NA	NA
WP_109990185.1|1777268_1777778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060612012.1|1777770_1778352_-	hypothetical protein	NA	C1KFI5	Lactobacillus_virus	37.1	5.0e-10
WP_060612010.1|1778378_1778963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109990186.1|1779094_1780147_-	peptidoglycan recognition protein	NA	A0A0P0I386	Lactobacillus_phage	95.4	6.1e-200
WP_109990187.1|1780148_1780580_-|holin	phage holin	holin	A0A0P0IDC6	Lactobacillus_phage	94.7	3.1e-41
WP_016363252.1|1780569_1780863_-	hypothetical protein	NA	A0A0P0IK41	Lactobacillus_phage	78.4	1.1e-34
WP_109990188.1|1780892_1781024_-	XkdX family protein	NA	U5U4L4	Lactobacillus_phage	93.0	1.2e-17
WP_109990189.1|1781010_1781307_-	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	89.6	6.6e-43
WP_109990190.1|1781316_1783836_-|tail	phage tail protein	tail	Q9T0W6	Lactobacillus_phage	87.2	1.4e-295
WP_109990191.1|1783832_1785731_-|tail	phage tail family protein	tail	A0A2D1GPH2	Lactobacillus_phage	79.0	1.1e-287
WP_109990192.1|1785731_1790606_-|tail	phage tail tape measure protein	tail	A0A2D1GPD5	Lactobacillus_phage	93.2	0.0e+00
WP_109990193.1|1790728_1791142_-	hypothetical protein	NA	A0A2D1GPL7	Lactobacillus_phage	100.0	6.4e-52
WP_109990194.1|1791212_1791341_-	Ig-like domain-containing protein	NA	A0A2D1GPF6	Lactobacillus_phage	85.4	1.2e-09
WP_109990195.1|1791344_1791956_-|tail	phage tail protein	tail	B4XYQ1	Lactobacillus_phage	95.1	5.1e-106
WP_109990196.1|1791989_1792376_-|tail	phage tail protein	tail	U5U3W4	Lactobacillus_phage	94.5	2.3e-67
WP_016389064.1|1792375_1792762_-	HK97 gp10 family phage protein	NA	B4XYP9	Lactobacillus_phage	97.7	1.5e-66
WP_016389065.1|1792761_1793091_-|head,tail	head-tail adaptor protein	head,tail	B4XYP8	Lactobacillus_phage	96.3	7.6e-56
WP_049179713.1|1793080_1793440_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5U4K5	Lactobacillus_phage	94.1	2.0e-57
WP_016385826.1|1793450_1793690_-	hypothetical protein	NA	U5U4N8	Lactobacillus_phage	81.0	2.1e-15
WP_109990197.1|1793707_1794910_-|capsid	phage major capsid protein	capsid	B4XYP6	Lactobacillus_phage	97.7	3.2e-213
WP_060611442.1|1794951_1795581_-|head,protease	HK97 family phage prohead protease	head,protease	U5U3W0	Lactobacillus_phage	97.6	9.6e-116
WP_109990198.1|1795534_1796788_-|portal	phage portal protein	portal	Q8LTC2	Lactobacillus_phage	99.3	2.2e-236
WP_109990199.1|1796793_1796985_-	hypothetical protein	NA	A0A2D1GPE7	Lactobacillus_phage	98.4	5.0e-28
WP_109990200.1|1796996_1798709_-|terminase	terminase large subunit	terminase	A0A2D1GPB8	Lactobacillus_phage	98.9	0.0e+00
WP_003661401.1|1798730_1799186_-|terminase	P27 family phage terminase small subunit	terminase	U5U3Z1	Lactobacillus_phage	99.3	4.7e-80
WP_109990201.1|1799386_1800181_-	HNH endonuclease	NA	U5U440	Lactobacillus_phage	98.5	8.3e-149
WP_109990202.1|1800170_1800752_-	hypothetical protein	NA	U5U409	Lactobacillus_phage	88.6	8.9e-92
WP_109990203.1|1800764_1801088_-	hypothetical protein	NA	U5U7A9	Lactobacillus_phage	71.1	2.0e-29
WP_109990204.1|1801090_1801411_-	ribonucleoside-diphosphate reductase	NA	U5U741	Lactobacillus_phage	98.1	3.1e-54
WP_109990205.1|1801414_1801747_-	HNH endonuclease	NA	U5U4N5	Lactobacillus_phage	69.0	9.7e-35
WP_109990206.1|1801781_1802943_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.5	1.5e-29
WP_109990207.1|1802926_1803205_-	hypothetical protein	NA	B4XYU1	Lactobacillus_phage	49.4	3.2e-15
WP_109990208.1|1803191_1804409_-	hypothetical protein	NA	A8YQN3	Lactobacillus_phage	98.0	8.6e-238
WP_109990210.1|1805283_1805718_-	transcriptional regulator	NA	B4XYT9	Lactobacillus_phage	73.4	1.5e-51
WP_109990211.1|1805969_1806188_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IXA5	Lactobacillus_phage	91.7	9.5e-31
WP_109990212.1|1806265_1806460_-	hypothetical protein	NA	U5U7A2	Lactobacillus_phage	72.4	2.1e-13
WP_109990213.1|1806456_1806903_-	hypothetical protein	NA	Q6J1U2	Lactobacillus_phage	93.7	6.7e-39
WP_109990214.1|1806899_1807202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109990215.1|1807212_1807443_-	hypothetical protein	NA	U5U426	Lactobacillus_phage	67.1	1.2e-20
WP_109990216.1|1807445_1807691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109990217.1|1807687_1808080_-	DUF1642 domain-containing protein	NA	Q8LTB5	Lactobacillus_phage	70.4	2.9e-46
WP_109990218.1|1808069_1808330_-	hypothetical protein	NA	A0A2D1GPC7	Lactobacillus_phage	38.0	5.7e-06
WP_109990219.1|1808319_1808553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109990220.1|1808539_1808935_-	hypothetical protein	NA	A0A140HLR7	Bacillus_phage	50.0	6.4e-25
WP_109990221.1|1808921_1809488_-	DUF1642 domain-containing protein	NA	B4XYT4	Lactobacillus_phage	46.9	2.4e-33
WP_109990222.1|1809649_1810114_-	endonuclease	NA	A0A0P0IXF6	Lactobacillus_phage	97.4	5.0e-13
WP_109990223.1|1810126_1810528_-	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	71.5	5.8e-50
WP_003579409.1|1810569_1810914_-	hypothetical protein	NA	U5U420	Lactobacillus_phage	100.0	1.3e-61
WP_109990224.1|1810915_1812178_-	DNA helicase	NA	U5U3Y9	Lactobacillus_phage	98.3	6.4e-236
WP_109990225.1|1812174_1813002_-	helix-turn-helix domain-containing protein	NA	A0A2D1GPH5	Lactobacillus_phage	76.7	3.3e-116
WP_003661426.1|1812994_1813309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003661427.1|1813383_1813587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109990226.1|1813668_1814028_-	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	97.5	7.0e-63
WP_109990227.1|1814093_1814345_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_109990228.1|1814337_1814517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_191989240.1|1814584_1814734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109990229.1|1814730_1815501_-	phage antirepressor KilAC domain-containing protein	NA	Q6J1W3	Lactobacillus_phage	60.0	2.1e-72
WP_109990230.1|1815497_1815773_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IX93	Lactobacillus_phage	97.1	7.8e-30
WP_109990231.1|1815906_1816680_+	helix-turn-helix transcriptional regulator	NA	Q6J1W4	Lactobacillus_phage	93.4	1.6e-133
WP_016378619.1|1816735_1817533_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_109990232.1|1817623_1818250_+	hypothetical protein	NA	A0A0A0RSV1	Bacillus_phage	44.3	5.9e-09
WP_109990233.1|1818452_1819622_+|integrase	site-specific integrase	integrase	A0A2D1GPE8	Lactobacillus_phage	97.7	4.7e-217
WP_003566819.1|1820072_1820711_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003575678.1|1820749_1821262_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003566817.1|1821414_1821939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004562115.1|1827728_1829012_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.7	2.3e-84
1834602:1834626	attR	GCCCAGAAACCTACACATAAGGACC	NA	NA	NA	NA
>prophage 10
NZ_CP029546	Lacticaseibacillus paracasei strain EG9 chromosome, complete genome	2927257	1873524	1910324	2927257	transposase,protease	Faecalibacterium_phage(40.0%)	28	NA	NA
WP_109990244.1|1873524_1874541_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	3.2e-36
WP_109990245.1|1874629_1875268_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	1.8e-24
WP_003595059.1|1875405_1875966_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003595061.1|1875988_1876867_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	3.2e-16
WP_003595063.1|1876863_1877952_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	1.0e-16
WP_109990246.1|1878002_1878314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674622.1|1878417_1879401_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003595070.1|1879669_1880623_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003595071.1|1880727_1882398_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003573210.1|1882760_1883441_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_109990247.1|1883437_1883770_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003566252.1|1883981_1884245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109990248.1|1884351_1886007_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	21.1	3.4e-11
WP_003596308.1|1887653_1888670_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
WP_003595076.1|1889214_1889613_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_011674627.1|1889704_1889998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108298866.1|1890146_1893749_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003605487.1|1894101_1894863_+|protease	matrixin family metalloprotease	protease	G9I094	Helicoverpa_zea_nudivirus	53.1	1.7e-05
WP_003595080.1|1895037_1895805_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_003595085.1|1898412_1898742_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_108298868.1|1899116_1899761_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_109990249.1|1901368_1902531_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.1	2.8e-28
WP_109990250.1|1902879_1903503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162551611.1|1903846_1904179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162551612.1|1904927_1906676_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_003596308.1|1906950_1907967_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
WP_109990253.1|1908037_1909054_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_011674977.1|1909307_1910324_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
>prophage 11
NZ_CP029546	Lacticaseibacillus paracasei strain EG9 chromosome, complete genome	2927257	1980508	2039999	2927257	transposase,protease	unidentified_phage(21.43%)	51	NA	NA
WP_109990275.1|1980508_1981429_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	2.6e-21
WP_109990276.1|1981913_1984064_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	36.6	5.2e-121
WP_003570845.1|1984445_1985210_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_109990277.1|1985387_1986281_+	LCP family protein	NA	NA	NA	NA	NA
WP_109990278.1|1986668_1987913_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.2	1.1e-09
WP_003599423.1|1987990_1988659_-	sugar transferase	NA	NA	NA	NA	NA
WP_003599424.1|1988914_1989757_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.5	7.2e-34
WP_003599425.1|1989831_1990857_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.4	2.0e-70
WP_003575756.1|1990859_1991432_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	43.0	3.2e-33
WP_003599426.1|1991443_1992316_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	58.9	5.6e-98
WP_003599427.1|1992529_1993522_-	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_109990279.1|1993525_1994599_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_109990280.1|1994620_1995709_-	EpsG family protein	NA	NA	NA	NA	NA
WP_181810027.1|1995705_1996683_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003599432.1|1996708_1997521_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_109990281.1|1997510_1998590_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_109990282.1|1998601_1999384_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_109990283.1|1999380_2000772_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_049181711.1|2001217_2001982_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_109990284.1|2001998_2002913_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_109990285.1|2003274_2003994_+	acyltransferase	NA	NA	NA	NA	NA
WP_109990286.1|2004275_2004776_-	QueT transporter family protein	NA	NA	NA	NA	NA
WP_003607236.1|2004887_2005601_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_109990287.1|2005597_2005822_-	DUF2829 domain-containing protein	NA	A8AT88	Listeria_phage	35.2	4.0e-08
WP_003566698.1|2006106_2006418_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003566700.1|2006677_2007316_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003566702.1|2007624_2008602_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.9	6.2e-21
WP_003566704.1|2008603_2009656_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	4.3e-20
WP_003566706.1|2009667_2010666_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003566708.1|2010665_2011589_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_109990288.1|2011763_2013386_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_109990482.1|2013817_2015242_-	MFS transporter	NA	NA	NA	NA	NA
WP_003566713.1|2015780_2016344_-	elongation factor P	NA	NA	NA	NA	NA
WP_109990289.1|2017563_2018271_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_109990290.1|2018263_2019748_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_109990291.1|2019744_2020527_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_003566723.1|2020998_2021565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003591381.1|2021816_2022152_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_109990292.1|2022208_2023309_-	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_013245936.1|2023417_2023828_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_011674746.1|2023799_2024006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109990293.1|2024002_2025427_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003580183.1|2026230_2028453_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_109990296.1|2028515_2029259_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_109990297.1|2030748_2033331_-	AAA family ATPase	NA	U5J9B0	Bacillus_phage	25.3	1.3e-49
WP_109990298.1|2033371_2033962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109990299.1|2034387_2034993_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_003591398.1|2035677_2036490_-	ribokinase family sugar kinase	NA	NA	NA	NA	NA
WP_109990300.1|2036900_2037917_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	9.3e-36
WP_003574021.1|2038136_2039057_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_109990301.1|2039156_2039999_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.6	1.1e-154
>prophage 12
NZ_CP029546	Lacticaseibacillus paracasei strain EG9 chromosome, complete genome	2927257	2195009	2282009	2927257	head,terminase,tRNA,portal,transposase,holin,tail,capsid,integrase,protease	Lactobacillus_phage(54.55%)	101	2214172:2214186	2273539:2273553
WP_003567053.1|2195009_2195654_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_162551614.1|2195734_2196793_+	LCP family protein	NA	NA	NA	NA	NA
WP_003580611.1|2196854_2197883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003603162.1|2197883_2198771_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003567064.1|2198767_2199133_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_109990351.1|2199274_2199928_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_109990352.1|2200145_2202098_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	9.7e-58
WP_003567071.1|2202374_2202710_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003567073.1|2202805_2203831_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.0	5.4e-60
WP_003567075.1|2203864_2204398_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_003567077.1|2204381_2205104_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003603166.1|2205587_2206193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016386172.1|2206481_2207759_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.0	1.9e-49
WP_003567081.1|2207927_2208446_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_003603167.1|2208929_2209910_+	asparaginase	NA	NA	NA	NA	NA
WP_003567089.1|2210005_2210749_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_003603168.1|2210843_2211701_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.4	9.4e-74
WP_003567092.1|2211702_2212041_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	38.9	4.6e-16
WP_003588621.1|2212045_2213023_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	27.8	1.1e-25
WP_003567098.1|2213022_2213352_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_016365525.1|2213386_2214031_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	53.1	3.1e-53
2214172:2214186	attL	AGGCAAAAAGCGGCA	NA	NA	NA	NA
WP_003567100.1|2214540_2214804_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003567101.1|2214803_2215403_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003567105.1|2215718_2216027_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003567107.1|2216043_2217741_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	44.4	3.0e-55
WP_003567109.1|2218213_2218720_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003567111.1|2218861_2219191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003603173.1|2219247_2219844_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003603175.1|2219948_2222558_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_003571317.1|2222960_2223374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109990353.1|2223523_2224456_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003607135.1|2228372_2229572_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.0	9.2e-67
WP_003603183.1|2232204_2233104_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003572665.1|2233450_2233618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109990354.1|2233601_2234651_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9MCC8	Lactobacillus_phage	64.9	1.1e-124
WP_109990355.1|2234650_2234923_-|holin	holin	holin	Q9MCC7	Lactobacillus_phage	92.2	1.4e-39
WP_109990356.1|2234912_2235146_-	hypothetical protein	NA	U5U779	Lactobacillus_phage	75.0	4.7e-12
WP_109990357.1|2235138_2235516_-	hypothetical protein	NA	A0A0P0IJI4	Lactobacillus_phage	94.4	2.4e-61
WP_109990358.1|2235537_2238693_-	CotH kinase family protein	NA	NA	NA	NA	NA
WP_109990359.1|2238661_2240758_-|tail	phage tail protein	tail	Q597U4	Lactobacillus_virus	51.8	7.7e-202
WP_109990360.1|2240770_2242036_-|tail	phage tail family protein	tail	Q597U5	Lactobacillus_virus	42.0	4.8e-90
WP_109990361.1|2242039_2245036_-|tail	phage tail tape measure protein	tail	A0A097BYC3	Leuconostoc_phage	66.7	9.8e-126
WP_109990362.1|2245035_2245305_-	hypothetical protein	NA	Q597U7	Lactobacillus_virus	35.2	7.9e-11
WP_045136425.1|2245340_2245781_-	hypothetical protein	NA	A0A2P0ZL56	Lactobacillus_phage	50.7	3.2e-25
WP_109990363.1|2245844_2246474_-|tail	phage major tail protein, TP901-1 family	tail	G8FV40	Pediococcus_virus	77.9	1.9e-87
WP_109990364.1|2246475_2246841_-	hypothetical protein	NA	Q597V0	Lactobacillus_virus	46.6	2.3e-21
WP_109990365.1|2246837_2247212_-	HK97 gp10 family phage protein	NA	Q597V1	Lactobacillus_virus	36.1	7.6e-12
WP_109990367.1|2247500_2247860_-|head,tail	phage head-tail connector protein	head,tail	A0A2K9VBX4	Lactobacillus_phage	62.7	8.3e-24
WP_109990368.1|2247859_2248738_-	hypothetical protein	NA	A0A0P0IJL6	Lactobacillus_phage	81.5	1.5e-146
WP_109990369.1|2248806_2249727_-|capsid	phage capsid protein	capsid	A0A2P0ZL66	Lactobacillus_phage	74.2	4.8e-116
WP_109990370.1|2249740_2250283_-	DUF4355 domain-containing protein	NA	Q597V6	Lactobacillus_virus	54.5	8.5e-20
WP_162551615.1|2250434_2250644_-	ChaB family protein	NA	NA	NA	NA	NA
WP_109990372.1|2250654_2250888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109990488.1|2250897_2251608_-|head	phage head morphogenesis protein	head	Q597V7	Lactobacillus_virus	50.9	2.6e-61
WP_109990373.1|2251633_2253154_-|portal	phage portal protein	portal	Q597V8	Lactobacillus_virus	63.7	5.1e-179
WP_109990374.1|2253155_2254454_-|terminase	PBSX family phage terminase large subunit	terminase	Q597V9	Lactobacillus_virus	69.1	1.1e-179
WP_109990375.1|2254437_2255022_-|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	46.6	1.7e-26
WP_003566426.1|2255021_2255159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109990376.1|2255168_2256317_-	hypothetical protein	NA	A0A0P0I3G0	Lactobacillus_phage	97.1	3.2e-218
WP_109990377.1|2256341_2256596_-	hypothetical protein	NA	U5U404	Lactobacillus_phage	96.4	1.9e-43
WP_003582019.1|2257275_2257704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109990378.1|2257779_2257998_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IXA5	Lactobacillus_phage	94.4	2.5e-31
WP_109990212.1|2258075_2258270_-	hypothetical protein	NA	U5U7A2	Lactobacillus_phage	72.4	2.1e-13
WP_109990213.1|2258266_2258713_-	hypothetical protein	NA	Q6J1U2	Lactobacillus_phage	93.7	6.7e-39
WP_109990214.1|2258709_2259012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162551596.1|2259008_2259170_-	hypothetical protein	NA	A0A2D1GPG2	Lactobacillus_phage	93.3	2.6e-17
WP_109990379.1|2259172_2259418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071252654.1|2259503_2259692_-	hypothetical protein	NA	D6PSV2	Lactobacillus_phage	91.9	1.1e-24
WP_109990380.1|2259688_2260006_-	hypothetical protein	NA	C1KFE7	Lactobacillus_virus	48.6	1.3e-20
WP_109990381.1|2260116_2260671_-	HNH endonuclease	NA	B4XYU1	Lactobacillus_phage	38.1	4.4e-24
WP_109990382.1|2260663_2261185_-	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	60.1	2.2e-41
WP_109990383.1|2261181_2261445_-	hypothetical protein	NA	B4XYT2	Lactobacillus_phage	96.6	2.5e-41
WP_003607027.1|2261552_2261918_-	endodeoxyribonuclease	NA	A0A0P0HRU0	Lactobacillus_phage	100.0	1.8e-66
WP_109990384.1|2261914_2262169_-	hypothetical protein	NA	A0A0P0IQP0	Lactobacillus_phage	97.6	6.5e-39
WP_109990385.1|2262215_2262665_-	hypothetical protein	NA	Q6J1V3	Lactobacillus_phage	91.9	1.0e-66
WP_109990386.1|2262661_2262877_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IJY1	Lactobacillus_phage	88.6	2.0e-28
WP_109990387.1|2262907_2263456_-	HNH endonuclease	NA	A8YQL7	Lactobacillus_phage	78.2	5.6e-80
WP_109990388.1|2263476_2263959_-	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	90.7	4.7e-62
WP_109990389.1|2263971_2264928_-	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	85.8	3.2e-115
WP_109990489.1|2264943_2265768_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	92.7	2.5e-148
WP_109990390.1|2265724_2266618_-	recombinase RecT	NA	A0A0P0IJP1	Lactobacillus_phage	94.8	1.7e-150
WP_049181946.1|2266587_2267028_-	hypothetical protein	NA	A0A0P0IXE5	Lactobacillus_phage	58.3	7.3e-38
WP_109990391.1|2267020_2267272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003581994.1|2267390_2267717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109990392.1|2267707_2268181_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004562013.1|2268243_2268402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109990393.1|2268398_2268665_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CYW6	Paenibacillus_phage	37.5	4.4e-06
WP_031546731.1|2268814_2269240_+	helix-turn-helix transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	44.6	8.9e-25
WP_191989241.1|2269249_2269711_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_109990394.1|2269770_2270349_+	hypothetical protein	NA	A0A1B0Y834	Lactobacillus_phage	92.2	3.1e-97
WP_109990395.1|2270442_2271657_+|integrase	site-specific integrase	integrase	A0A1X9I5L3	Streptococcus_phage	27.2	1.4e-35
WP_109990396.1|2271792_2272161_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_003603186.1|2272201_2272708_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003567142.1|2273132_2274365_+	MFS transporter	NA	NA	NA	NA	NA
2273539:2273553	attR	AGGCAAAAAGCGGCA	NA	NA	NA	NA
WP_162551618.1|2274422_2275256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003661843.1|2275248_2275767_-	DUF3278 domain-containing protein	NA	NA	NA	NA	NA
WP_109990397.1|2276023_2277229_+	MFS transporter	NA	NA	NA	NA	NA
WP_003591597.1|2277299_2278673_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_109990398.1|2278860_2279550_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_003567155.1|2279649_2280075_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_011674977.1|2280992_2282009_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
>prophage 13
NZ_CP029546	Lacticaseibacillus paracasei strain EG9 chromosome, complete genome	2927257	2302404	2368552	2927257	tRNA,transposase,bacteriocin,protease	Streptococcus_phage(23.08%)	60	NA	NA
WP_003561810.1|2302404_2303334_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_003603228.1|2303362_2304046_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_109990403.1|2304042_2305098_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016365345.1|2305593_2305935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003576196.1|2306138_2306678_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_003576198.1|2306678_2307458_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_003567219.1|2307429_2307858_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_016383619.1|2307854_2309261_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	30.6	8.8e-53
WP_003596308.1|2309934_2310951_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
WP_003661815.1|2312213_2312801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003576205.1|2312800_2312992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003576207.1|2313467_2314961_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003588680.1|2315108_2316089_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_109990404.1|2316204_2316876_-	ribose-5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_003603237.1|2317059_2317890_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_109990405.1|2318036_2318876_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003661808.1|2318888_2319905_-	membrane protein	NA	NA	NA	NA	NA
WP_003567242.1|2319911_2320286_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016371648.1|2320450_2321722_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_004469769.1|2322039_2322816_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003603253.1|2322833_2323721_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.5	1.5e-34
WP_109990406.1|2324023_2325139_-	PIN domain nuclease	NA	NA	NA	NA	NA
WP_109990407.1|2325161_2326526_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003567256.1|2326542_2327085_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	8.1e-39
WP_003567258.1|2327305_2327596_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003603256.1|2328334_2329654_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	34.5	7.0e-60
WP_003603257.1|2330012_2331359_+	C1 family peptidase	NA	A0A2H4UTL8	Bodo_saltans_virus	29.8	6.9e-47
WP_003599703.1|2331586_2332687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162551620.1|2332683_2333880_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003567269.1|2333942_2334821_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	1.2e-12
WP_003599714.1|2334982_2337037_+	KUP/HAK/KT family potassium transporter	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	32.9	1.6e-63
WP_003576237.1|2339985_2340609_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_109990409.1|2341108_2341780_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003599717.1|2342289_2343411_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_003567280.1|2343424_2343709_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_003588738.1|2343899_2345015_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003567284.1|2345202_2345409_-	CsbD family protein	NA	NA	NA	NA	NA
WP_003567286.1|2345541_2345799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567288.1|2345869_2346076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567290.1|2346300_2346552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567292.1|2346879_2348112_+	MFS transporter	NA	NA	NA	NA	NA
WP_003599729.1|2348190_2349447_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	56.8	5.6e-99
WP_003599730.1|2349535_2350369_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	7.3e-47
WP_003588746.1|2350685_2350880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109990411.1|2351133_2351670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003661784.1|2351858_2353082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003599733.1|2353317_2354145_-	class C sortase	NA	NA	NA	NA	NA
WP_109990412.1|2354151_2355711_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_003661777.1|2355707_2357030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109990413.1|2357031_2360037_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003580832.1|2360314_2360872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049166630.1|2360966_2362163_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_016377825.1|2362371_2363427_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_003599756.1|2363697_2364327_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	37.5	1.6e-06
WP_016386172.1|2364472_2365750_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.0	1.9e-49
WP_003567322.1|2365965_2366295_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003599757.1|2366291_2367080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567326.1|2367132_2367921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109990414.1|2367965_2368244_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003599758.1|2368267_2368552_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 14
NZ_CP029546	Lacticaseibacillus paracasei strain EG9 chromosome, complete genome	2927257	2503538	2621345	2927257	tRNA,transposase,protease,integrase	Streptococcus_phage(26.47%)	102	2491745:2491760	2624755:2624770
2491745:2491760	attL	GTATTCACCGCGGCGT	NA	NA	NA	NA
WP_109990432.1|2503538_2505686_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	A9YVR1	Ostreococcus_tauri_virus	50.1	2.7e-109
WP_003567626.1|2505747_2506293_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	32.8	1.1e-11
WP_049145169.1|2506289_2507600_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	25.9	3.4e-06
WP_003567630.1|2507677_2508163_-	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_032761188.1|2508372_2508774_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003567635.1|2508873_2509137_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_016387567.1|2509140_2510718_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_003596227.1|2510838_2514363_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_003596228.1|2514435_2514993_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_181810017.1|2515640_2516648_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003571470.1|2517054_2518425_+	peptidoglycan binding domain-containing protein	NA	NA	NA	NA	NA
WP_003567650.1|2518926_2519592_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003596235.1|2519867_2520572_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_032761189.1|2520965_2521277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109990434.1|2521520_2522954_-	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_011674930.1|2523089_2527547_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_003567657.1|2527820_2528342_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	32.3	4.6e-07
WP_003567661.1|2528525_2528909_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2K9V2U7	Faecalibacterium_phage	36.1	1.2e-09
WP_003567665.1|2528928_2529177_-	antitoxin	NA	NA	NA	NA	NA
WP_003596242.1|2529244_2530381_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	31.8	1.8e-35
WP_003567669.1|2530367_2530742_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003567670.1|2530911_2532420_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	39.3	4.1e-72
WP_003567673.1|2532545_2532689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674931.1|2532719_2534108_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_003576482.1|2534168_2534933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003571475.1|2535064_2535712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003596259.1|2535708_2536386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567685.1|2536485_2536914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016387573.1|2541428_2541671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016387574.1|2541712_2542036_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	42.3	1.2e-16
WP_010491213.1|2542053_2542425_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	52.0	1.7e-27
WP_016387575.1|2542502_2542766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016387576.1|2542776_2543016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010491207.1|2543050_2543299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016376177.1|2543318_2543606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016387577.1|2545252_2545513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010491198.1|2545828_2547019_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	43.7	7.9e-95
WP_010491196.1|2547008_2547335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016377126.1|2547465_2548200_+	site-specific DNA-methyltransferase	NA	A0A2K8IKC3	Lactococcus_phage	54.0	6.6e-68
WP_003606383.1|2548298_2548520_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.6	1.7e-27
WP_016387579.1|2548523_2549021_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	45.2	7.7e-36
WP_010491186.1|2549082_2549475_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	73.6	6.5e-46
WP_016387580.1|2549458_2551924_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	64.7	0.0e+00
WP_109990435.1|2551910_2554004_+	conjugal transfer protein	NA	A0A1S5SF30	Streptococcus_phage	51.0	3.0e-145
WP_016387582.1|2554000_2554996_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	60.0	2.1e-109
WP_016387583.1|2555005_2555539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032761194.1|2555535_2556459_+	conjugal transfer protein	NA	A0A2K5B2A4	Erysipelothrix_phage	39.7	6.3e-07
WP_064557438.1|2556630_2557629_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.0	5.3e-52
WP_109990436.1|2558173_2558960_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003597463.1|2559091_2559316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039639870.1|2559406_2562352_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003662080.1|2562359_2562929_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_109990437.1|2563648_2564435_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153109594.1|2564552_2564696_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016372107.1|2564986_2565895_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_080643447.1|2566319_2566862_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016387451.1|2566819_2566948_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003603298.1|2568185_2569865_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_016376168.1|2569956_2570340_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_016376169.1|2570374_2571196_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_109990438.1|2571205_2572630_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.7	1.4e-69
WP_064557577.1|2572676_2573870_+	MFS transporter	NA	NA	NA	NA	NA
WP_064557580.1|2575518_2576202_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.3	1.1e-59
WP_014271905.1|2576282_2577203_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	4.0e-22
WP_049146068.1|2577566_2578250_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	52.4	3.1e-59
WP_046782834.1|2578347_2578596_+	hypothetical protein	NA	C1KFC0	Lactobacillus_virus	91.5	3.2e-35
WP_162551597.1|2579814_2580018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003585301.1|2580098_2580296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003585300.1|2580270_2580624_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_109990015.1|2580724_2582227_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_049145461.1|2583356_2583938_+	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_109990439.1|2584303_2585011_-	aquaporin family protein	NA	M1I8Y5	Paramecium_bursaria_Chlorella_virus	34.1	3.0e-25
WP_049145466.1|2585025_2586879_-	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_016386908.1|2586943_2588461_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_032759982.1|2588666_2589368_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002816285.1|2590045_2590297_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_109990440.1|2590350_2591193_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.6	6.1e-158
WP_016377101.1|2593184_2593649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016377102.1|2593666_2595676_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_155760105.1|2595672_2595846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162551621.1|2595842_2596571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003561810.1|2596573_2597503_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_109990443.1|2597597_2598263_-	DEAD/DEAH box helicase family protein	NA	A0A2H4UTW8	Bodo_saltans_virus	25.0	9.1e-08
WP_016377104.1|2598259_2601508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109990444.1|2601619_2602018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162551622.1|2602108_2604166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003561810.1|2604192_2605122_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_109990446.1|2605087_2605684_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_162551623.1|2605700_2605997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003596308.1|2606912_2607929_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
WP_162551624.1|2610338_2610674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109989997.1|2610781_2612197_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109990449.1|2612168_2612774_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_096836596.1|2612985_2613849_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	3.1e-24
WP_079322958.1|2613845_2614142_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_109990450.1|2614154_2614460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674977.1|2615366_2616383_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
WP_016377381.1|2617721_2618405_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	52.9	3.6e-60
WP_049145301.1|2618732_2619131_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_032761263.1|2619151_2619409_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016387644.1|2619758_2620031_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016387645.1|2620082_2621345_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2624755:2624770	attR	GTATTCACCGCGGCGT	NA	NA	NA	NA
>prophage 15
NZ_CP029546	Lacticaseibacillus paracasei strain EG9 chromosome, complete genome	2927257	2656149	2720296	2927257	tRNA,transposase,holin,protease	Acinetobacter_phage(16.67%)	51	NA	NA
WP_109990011.1|2656149_2657312_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.5	1.9e-29
WP_003581138.1|2657951_2659934_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	37.1	1.5e-93
WP_003567758.1|2660012_2660891_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_004469014.1|2661099_2661912_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_004469015.1|2661904_2662384_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003567764.1|2662528_2663434_-	L-2-hydroxyisocaproate dehydrogenase	NA	NA	NA	NA	NA
WP_003567766.1|2663461_2664070_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003567768.1|2664161_2664854_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_003567770.1|2665137_2665284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674945.1|2665280_2666207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109990011.1|2666418_2667581_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.5	1.9e-29
WP_003567776.1|2667794_2668778_-	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_003567778.1|2668995_2669937_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_003585697.1|2669933_2672096_-	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
WP_003567781.1|2672092_2673622_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_003567783.1|2674008_2674941_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	24.3	8.9e-09
WP_003606086.1|2675107_2675932_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003571512.1|2675954_2676455_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003567789.1|2676742_2678098_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_003571520.1|2678312_2679173_-	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_003599988.1|2679181_2679790_-	LemA family protein	NA	NA	NA	NA	NA
WP_016386868.1|2679975_2680992_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016387660.1|2683655_2684981_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003567800.1|2684986_2685946_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.9	8.8e-28
WP_003567802.1|2685945_2687478_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_109989998.1|2688001_2689018_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	8.4e-37
WP_049146394.1|2689327_2691616_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016387602.1|2691750_2692584_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003606099.1|2692608_2693580_-	TDT family transporter	NA	NA	NA	NA	NA
WP_003576567.1|2694015_2694660_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_016369097.1|2695183_2695858_-	HD domain-containing protein	NA	S4W232	Pandoravirus	30.5	3.3e-13
WP_003567813.1|2695985_2696402_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016387604.1|2696614_2699143_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	33.1	8.3e-110
WP_003576574.1|2699206_2700211_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_016387605.1|2700512_2701325_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003567827.1|2701387_2701732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567829.1|2702039_2702303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567831.1|2702591_2703269_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_016387608.1|2703274_2703961_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003567836.1|2704005_2704818_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003567838.1|2704914_2705397_+	ribonuclease HI	NA	A0A0H3UZB5	Geobacillus_virus	38.1	1.8e-21
WP_016387610.1|2705402_2706305_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016387611.1|2706554_2707757_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	27.9	5.6e-24
WP_016387612.1|2708061_2709255_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.8	1.9e-104
WP_003567846.1|2709655_2710354_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_003567848.1|2710512_2710986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016387614.1|2711567_2713550_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003662604.1|2713553_2714483_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_003567854.1|2714608_2715361_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016387269.1|2718742_2719945_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	46.3	4.2e-88
WP_025376307.1|2720182_2720296_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
>prophage 16
NZ_CP029546	Lacticaseibacillus paracasei strain EG9 chromosome, complete genome	2927257	2858804	2873412	2927257	terminase,portal,transposase,capsid,integrase	Lactobacillus_phage(25.0%)	17	2861148:2861167	2875257:2875276
WP_003574021.1|2858804_2859725_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_162832635.1|2860779_2861019_-	hypothetical protein	NA	NA	NA	NA	NA
2861148:2861167	attL	TATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
WP_109990463.1|2861264_2862422_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	33.2	1.3e-46
WP_016373189.1|2862515_2863169_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003577123.1|2863297_2863576_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003577124.1|2863663_2863885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049144943.1|2864231_2864507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003604804.1|2864503_2864692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019888685.1|2864675_2865503_+	bifunctional DNA primase/polymerase	NA	Q854C1	Mycobacterium_phage	32.5	3.4e-12
WP_109990464.1|2865495_2866887_+	DNA primase	NA	A0A0M4RE09	Enterococcus_phage	33.1	5.3e-42
WP_016373451.1|2867438_2867780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_181810029.1|2867862_2868180_+	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	42.3	2.5e-11
WP_014570231.1|2868361_2868832_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_079351769.1|2868828_2870532_+|terminase	terminase	terminase	E9LUI0	Lactobacillus_phage	40.0	6.6e-119
WP_016386406.1|2870497_2870677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016386407.1|2870681_2871866_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	34.4	5.3e-59
WP_014570234.1|2871852_2873412_+|capsid	phage major capsid protein	capsid	A0A2H4J9X8	uncultured_Caudovirales_phage	29.8	3.3e-32
2875257:2875276	attR	TATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
>prophage 1
NZ_CP029547	Lacticaseibacillus paracasei strain EG9 plasmid pEG9A, complete sequence	79815	4568	56942	79815	bacteriocin,transposase,holin,protease	Lactobacillus_phage(36.36%)	53	NA	NA
WP_109990497.1|4568_5813_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	4.9e-47
WP_019887590.1|6012_6267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016388733.1|6341_6530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003586951.1|6909_7188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032798703.1|7199_7466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572358.1|7484_7661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572360.1|7662_7890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003597574.1|7932_9174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109990498.1|9151_10711_+	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_003572366.1|10720_11140_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_109990499.1|11148_11727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109990500.1|11753_14213_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_109990501.1|14209_16273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109990502.1|16278_16614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109990503.1|16597_17194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016371340.1|17174_19103_+	type IV secretory pathway, VirB4 component	NA	NA	NA	NA	NA
WP_109990504.1|19104_20115_+	C40 family peptidase	NA	A0A1X9SGZ2	Bradyrhizobium_phage	39.1	9.0e-15
WP_109990505.1|20130_20775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109990506.1|20771_21179_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_109990507.1|21168_21990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016375147.1|22584_22785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016370734.1|22781_23039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016372366.1|23077_23515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109990508.1|23507_24752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162551629.1|24793_25039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109990510.1|25025_27569_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_109990511.1|27909_28014_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_109990512.1|28281_29712_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003583464.1|29817_29970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076652366.1|29951_30206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_191989242.1|30208_30352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047107637.1|30344_30794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076652369.1|31108_31555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109989990.1|32040_33240_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.8	1.6e-66
WP_076652371.1|33699_34581_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_076652373.1|34597_34957_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_076652374.1|35035_35707_+	class A sortase	NA	NA	NA	NA	NA
WP_109990513.1|35841_36039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109990514.1|36040_37066_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.1	1.3e-42
WP_109990515.1|46737_46989_+|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	7.8e-37
WP_109990516.1|47042_47885_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.9	1.1e-156
WP_109990517.1|48063_48327_+|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	88.0	2.6e-30
WP_109990518.1|48521_49223_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.3	2.7e-127
WP_003563273.1|49665_50064_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_003563277.1|50176_50548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|50751_51672_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	3.4e-37
WP_109990519.1|51661_51961_-	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_016364568.1|51966_52617_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	37.6	1.5e-18
WP_109990520.1|53460_53667_+|bacteriocin	garvicin Q family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_011017209.1|53666_53978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002816607.1|54253_54937_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.1e-60
WP_003600691.1|55324_56191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109990521.1|56261_56942_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
