The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021167	Enterobacter hormaechei strain 388 chromosome, complete genome	4656223	1157058	1197765	4656223	capsid,terminase,coat,lysis	Enterobacteria_phage(28.3%)	65	NA	NA
WP_110108179.1|1157058_1157298_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	71.8	2.4e-27
WP_165835087.1|1157275_1157947_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	47.8	1.4e-43
WP_110108810.1|1157943_1158402_-	AP2 domain-containing protein	NA	A0A142IE12	Pseudomonas_phage	46.3	2.3e-26
WP_110108180.1|1158604_1158823_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	60.6	1.1e-15
WP_110108181.1|1158914_1159145_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	39.7	6.5e-06
WP_045357106.1|1159141_1159363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006176198.1|1159359_1159578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110108182.1|1159574_1161488_-	phage N-6-adenine-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	48.3	5.9e-116
WP_110108183.1|1161484_1161637_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	44.2	2.8e-05
WP_110108184.1|1161633_1162062_-	regulator	NA	G8C7S8	Escherichia_phage	95.1	2.2e-71
WP_110108185.1|1162070_1162553_-	siphovirus Gp157 family protein	NA	G8C7S9	Escherichia_phage	98.1	5.5e-79
WP_110108186.1|1162549_1163464_-	DNA recombinase	NA	G8C7T0	Escherichia_phage	97.7	3.2e-168
WP_110108187.1|1163473_1163752_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	77.4	3.1e-34
WP_110108188.1|1163759_1164731_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	98.2	6.7e-84
WP_110108189.1|1164801_1165011_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	91.3	8.2e-32
WP_165835088.1|1165007_1165166_-	hypothetical protein	NA	M9NZI5	Enterobacteria_phage	100.0	2.6e-22
WP_110108190.1|1165162_1165672_-	hypothetical protein	NA	G8C7T4	Escherichia_phage	97.0	1.1e-88
WP_110108191.1|1165831_1166269_-	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	97.2	1.4e-76
WP_110108192.1|1166770_1167124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110108193.1|1167148_1167787_-	LexA family transcriptional regulator	NA	K7PH71	Enterobacterial_phage	78.2	1.6e-94
WP_032676295.1|1167891_1168107_+	helix-turn-helix transcriptional regulator	NA	K7PMD5	Enterobacterial_phage	81.7	1.7e-27
WP_110108194.1|1168137_1168683_+	hypothetical protein	NA	G8C7U3	Escherichia_phage	82.3	2.1e-79
WP_015571544.1|1168772_1168919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047748420.1|1168911_1169811_+	hypothetical protein	NA	A0A0N7C1Z7	Escherichia_phage	55.0	1.4e-80
WP_110108195.1|1169800_1171234_+	AAA family ATPase	NA	Q716D2	Shigella_phage	87.1	1.8e-231
WP_110108196.1|1171233_1171533_+	protein ren	NA	M1FPD5	Enterobacteria_phage	53.7	7.4e-18
WP_110108197.1|1171529_1172066_+	hypothetical protein	NA	A0A0F6N6A6	Escherichia_phage	35.2	1.5e-05
WP_110108198.1|1172062_1172290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110108199.1|1172286_1172655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110108200.1|1173313_1173568_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	45.6	1.0e-07
WP_023330682.1|1173713_1173995_+	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	53.8	3.2e-23
WP_110108201.1|1174205_1174655_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	47.5	2.5e-33
WP_110108202.1|1174647_1174818_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	89.3	4.5e-20
WP_110108203.1|1174814_1175483_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	91.9	1.9e-122
WP_110108204.1|1175475_1176117_+	NinG family protein	NA	M9NYX8	Enterobacteria_phage	93.9	2.7e-105
WP_058671429.1|1176113_1176314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110108205.1|1176413_1177103_+	antiterminator	NA	I6PDF8	Cronobacter_phage	53.6	1.3e-57
WP_064138273.1|1177835_1178060_+|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	90.5	2.0e-31
WP_110108206.1|1178037_1178532_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	96.3	1.6e-89
WP_110108207.1|1178528_1178990_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	70.6	8.7e-50
WP_110108208.1|1179024_1179297_+	hypothetical protein	NA	K7P6G5	Enterobacteria_phage	67.8	6.7e-26
WP_110108209.1|1179447_1179666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110108210.1|1179662_1179869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110108211.1|1179872_1180523_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	97.7	1.1e-111
WP_110108212.1|1180519_1182082_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	92.5	1.3e-302
WP_165835094.1|1182110_1183568_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	61.6	5.2e-157
WP_110108214.1|1183494_1184505_+|capsid	minor capsid protein	capsid	F1C5D8	Cronobacter_phage	67.3	2.7e-112
WP_094312733.1|1184505_1184853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110108215.1|1184905_1186276_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	51.9	1.8e-122
WP_110108216.1|1186275_1186737_+	hypothetical protein	NA	R9TR06	Aeromonas_phage	47.6	2.2e-29
WP_110108217.1|1186733_1187789_+|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.8	1.2e-102
WP_032668716.1|1187821_1188055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045332637.1|1188057_1188438_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	3.1e-29
WP_045341957.1|1188437_1188611_+	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	47.4	5.1e-11
WP_110108218.1|1188610_1188967_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	56.4	2.7e-27
WP_032652844.1|1188969_1189338_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	77.0	1.6e-46
WP_110108219.1|1189334_1189718_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	60.6	1.1e-37
WP_110108220.1|1189782_1190562_+	hypothetical protein	NA	F1C5E5	Cronobacter_phage	62.4	1.2e-54
WP_110108221.1|1190622_1191294_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	46.9	1.7e-49
WP_110108222.1|1191335_1193669_+	tape measure protein	NA	A0A1B1W284	Salmonella_phage	51.2	2.0e-150
WP_045344867.1|1193679_1193907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023300373.1|1193948_1194452_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	85.0	2.5e-82
WP_015571561.1|1194451_1194922_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	80.1	1.0e-66
WP_110108223.1|1194935_1195301_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	86.6	3.3e-60
WP_110108224.1|1195287_1197765_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	92.8	0.0e+00
>prophage 2
NZ_CP021167	Enterobacter hormaechei strain 388 chromosome, complete genome	4656223	1835896	1884663	4656223	terminase,tail,tRNA,portal,head,holin,integrase,capsid	Enterobacterial_phage(31.48%)	62	1831721:1831735	1891694:1891708
1831721:1831735	attL	CGCCCACCGCAATCG	NA	NA	NA	NA
WP_022650816.1|1835896_1836397_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_006809195.1|1836616_1837759_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	49.0	1.4e-93
WP_022650818.1|1837733_1837997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058687783.1|1838032_1838302_-	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	86.7	6.5e-13
WP_058687784.1|1838312_1838576_-	hypothetical protein	NA	A0A220NQU8	Salmonella_phage	85.1	4.3e-38
WP_096928926.1|1838578_1839100_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	84.7	1.7e-49
WP_058687785.1|1839086_1840109_-	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	90.4	2.7e-168
WP_058687786.1|1840108_1840522_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	81.6	1.1e-51
WP_058687787.1|1840795_1840987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032634713.1|1841327_1841984_-	LexA family transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	98.6	7.9e-121
WP_032634882.1|1842083_1842281_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	96.9	1.4e-28
WP_032634711.1|1842306_1842777_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	92.9	1.4e-74
WP_072203184.1|1843017_1843224_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	3.8e-13
WP_058687708.1|1843186_1844113_+	transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	83.4	4.9e-68
WP_058687709.1|1844109_1844604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058687710.1|1844603_1845356_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	90.0	2.0e-136
WP_058687711.1|1845360_1846026_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	78.8	5.6e-98
WP_023293907.1|1846022_1846250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023305906.1|1846246_1846567_+	hypothetical protein	NA	K7PHB4	Enterobacterial_phage	77.4	1.9e-43
WP_058687712.1|1846563_1846953_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	96.0	1.9e-66
WP_045332650.1|1846968_1847694_+	antirepressor	NA	G0ZND1	Cronobacter_phage	52.7	2.2e-55
WP_058687713.1|1847690_1848680_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	89.1	1.2e-178
WP_053504493.1|1848692_1849271_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.9	7.3e-46
WP_015570939.1|1849492_1849918_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	84.4	6.6e-60
WP_017384388.1|1849914_1850070_+	DUF3927 family protein	NA	S4TRP5	Salmonella_phage	68.8	5.0e-10
WP_023296244.1|1850180_1850567_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	89.8	1.2e-52
WP_063419965.1|1850553_1850835_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	2.6e-20
WP_058687714.1|1850834_1851464_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	88.5	3.5e-102
WP_058685277.1|1851471_1851741_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	80.5	3.2e-28
WP_058687715.1|1852729_1853596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087654025.1|1853789_1854614_+	hypothetical protein	NA	K7PH02	Enterobacteria_phage	77.4	2.9e-19
WP_032667396.1|1854626_1854854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059443714.1|1854870_1856328_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	90.3	4.6e-270
WP_063159276.1|1856339_1856675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058687853.1|1856628_1856886_-	hypothetical protein	NA	K7P7V5	Enterobacteria_phage	95.1	2.7e-32
WP_059443713.1|1857051_1857645_+	hypothetical protein	NA	S4TR53	Salmonella_phage	79.7	5.1e-95
WP_072203232.1|1857637_1858006_+	HNH endonuclease	NA	S4TTG9	Salmonella_phage	87.7	5.9e-57
WP_000954404.1|1858111_1858606_+|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	100.0	1.7e-83
WP_088566981.1|1858602_1860264_+|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	98.7	0.0e+00
WP_058687880.1|1860322_1862257_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	93.5	0.0e+00
WP_048243836.1|1862459_1863818_+|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	97.8	4.6e-256
WP_048243841.1|1863814_1864858_+|portal	phage portal protein	portal	S4TNN1	Salmonella_phage	77.8	9.7e-89
WP_048243843.1|1864854_1865181_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	86.1	1.9e-46
WP_048243845.1|1865189_1865540_+|head	phage head closure protein	head	S4TND9	Salmonella_phage	93.1	6.8e-55
WP_058687881.1|1865536_1865986_+	HK97 gp10 family phage protein	NA	K7PH84	Enterobacterial_phage	97.3	3.8e-74
WP_048243848.1|1865982_1866330_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	94.8	2.1e-56
WP_048243850.1|1866384_1866855_+|tail	phage tail protein	tail	A0A220NRQ0	Escherichia_phage	98.1	9.7e-81
WP_110108321.1|1866909_1867311_+|tail	phage tail protein	tail	K7P7C2	Enterobacteria_phage	94.7	2.9e-65
WP_032622502.1|1867334_1867598_+	DUF4035 domain-containing protein	NA	K7P7L5	Enterobacteria_phage	93.1	2.7e-40
WP_058687882.1|1867633_1870915_+|tail	phage tail tape measure protein	tail	A0A220NRN7	Escherichia_phage	93.8	0.0e+00
WP_058687883.1|1870917_1871256_+|tail	phage tail protein	tail	K7PHL4	Enterobacterial_phage	98.2	1.5e-62
WP_023305932.1|1871252_1872011_+|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	95.6	6.5e-143
WP_045347509.1|1872012_1872723_+	peptidase P60	NA	K7PGV2	Enterobacterial_phage	97.5	6.5e-145
WP_032622495.1|1872755_1873103_+	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	47.3	1.5e-06
WP_072203234.1|1873109_1873445_+	hypothetical protein	NA	Q6UAW3	Klebsiella_phage	48.6	5.6e-22
WP_047720006.1|1873500_1874100_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	74.8	3.2e-76
WP_110108322.1|1874153_1877735_+	DUF1983 domain-containing protein	NA	Q9MCR7	Enterobacteria_phage	91.6	0.0e+00
WP_058687885.1|1877736_1878702_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	39.9	2.2e-58
WP_165835090.1|1878761_1879898_+|tail	tail fiber domain-containing protein	tail	K7P6X7	Enterobacteria_phage	77.5	2.6e-71
WP_063619166.1|1880278_1882258_+	acyltransferase	NA	C6ZR20	Salmonella_phage	31.0	8.9e-67
WP_045329653.1|1882797_1883118_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	56.6	5.5e-27
WP_023299884.1|1883379_1884663_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.1e-09
1891694:1891708	attR	CGCCCACCGCAATCG	NA	NA	NA	NA
>prophage 3
NZ_CP021167	Enterobacter hormaechei strain 388 chromosome, complete genome	4656223	2452843	2514705	4656223	terminase,tail,plate,tRNA,holin,integrase	Escherichia_phage(23.4%)	65	2501260:2501275	2515627:2515642
WP_071785691.1|2452843_2453044_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U2JGI6	Escherichia_phage	71.7	1.1e-20
WP_110108420.1|2454146_2454464_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	48.1	1.5e-21
WP_110108422.1|2455002_2456982_-	acyltransferase	NA	C6ZR20	Salmonella_phage	30.7	1.7e-65
WP_110108423.1|2457362_2458499_-|tail	tail fiber domain-containing protein	tail	K7P6X7	Enterobacteria_phage	79.6	1.4e-72
WP_017382566.1|2458557_2458791_-	hypothetical protein	NA	E4WL42	Enterobacteria_phage	78.9	3.9e-30
WP_110108424.1|2458898_2459570_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.1	9.9e-87
WP_110108425.1|2459570_2459885_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	68.6	7.8e-34
WP_110108426.1|2459927_2463479_-|tail	phage tail protein	tail	Q9MCU0	Escherichia_phage	87.7	0.0e+00
WP_110108427.1|2463531_2464155_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.4	2.1e-54
WP_110108428.1|2464242_2464902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110108429.1|2464939_2465653_-	peptidase P60	NA	K7PJV6	Enterobacteria_phage	84.1	6.8e-126
WP_110108430.1|2465654_2466410_-|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	79.2	5.0e-119
WP_110108431.1|2466406_2466754_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	63.5	2.9e-37
WP_063149549.1|2466815_2467172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110108432.1|2467292_2470205_-|tail	phage tail tape measure protein	tail	I6PCW3	Cronobacter_phage	38.7	3.1e-153
WP_032618388.1|2470201_2470516_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	66.7	5.1e-17
WP_110108433.1|2470512_2470824_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	67.0	5.3e-35
WP_049136381.1|2470889_2471561_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	47.7	2.6e-50
WP_110108434.1|2471629_2472040_-	hypothetical protein	NA	I6PDJ8	Cronobacter_phage	51.4	2.5e-32
WP_110108435.1|2472036_2472621_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	53.7	1.2e-48
WP_110108436.1|2472622_2472973_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	57.8	1.6e-32
WP_047363536.1|2472974_2473457_-	hypothetical protein	NA	A0A2I7RR81	Vibrio_phage	31.3	5.1e-08
WP_165835095.1|2473493_2473793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110108437.1|2473774_2474728_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	75.0	2.6e-133
WP_022651278.1|2474739_2475510_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.6	6.3e-69
WP_110108438.1|2475590_2476688_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	57.9	2.3e-117
WP_110108439.1|2476689_2478078_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.9	1.5e-124
WP_110108440.1|2478079_2479387_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	57.5	1.3e-143
WP_058659700.1|2479364_2480363_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	43.4	1.1e-38
WP_032645635.1|2480409_2480859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032645710.1|2482579_2482855_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	84.4	3.7e-32
WP_058652917.1|2482862_2483492_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.6	4.6e-102
WP_022651286.1|2483491_2483773_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	1.3e-19
WP_015570936.1|2483759_2484146_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	78.1	3.2e-45
WP_110108442.1|2484931_2485123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110108443.1|2485648_2486482_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	78.3	2.8e-123
WP_032645711.1|2486478_2486841_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	83.1	5.2e-50
WP_110108444.1|2487048_2487651_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	82.0	4.4e-94
WP_022651294.1|2488039_2488264_-	DinI family protein	NA	H6WRY5	Salmonella_phage	62.3	1.8e-21
WP_022651295.1|2488634_2489081_-	VOC family protein	NA	NA	NA	NA	NA
WP_058674972.1|2489567_2490749_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_014832179.1|2491613_2492063_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_110108445.1|2492339_2493026_-	phage replication protein	NA	G8C7U6	Escherichia_phage	63.0	1.2e-82
WP_165835091.1|2493022_2493940_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	72.0	5.5e-112
WP_110108447.1|2494024_2494567_-	regulator	NA	M9NZI6	Enterobacteria_phage	85.6	1.6e-82
WP_110108448.1|2494596_2494848_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	53.3	9.9e-16
WP_110108449.1|2494975_2495668_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	53.3	4.1e-59
WP_110108450.1|2495681_2496056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046885673.1|2496633_2497125_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	29.3	5.3e-13
WP_110108451.1|2497628_2500766_+	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	62.8	0.0e+00
WP_110108452.1|2500775_2501861_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	63.6	7.4e-124
2501260:2501275	attL	TGCTGGCTCAGGCCCG	NA	NA	NA	NA
WP_020882485.1|2501899_2502142_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	93.6	1.3e-33
WP_014884030.1|2502206_2502419_+	DUF1233 family excisionase	NA	A0A0U2RY08	Escherichia_phage	64.8	4.3e-20
WP_110108453.1|2502420_2503659_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	70.5	3.5e-170
WP_003856923.1|2503708_2504644_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	95.7	3.0e-142
WP_110108454.1|2504687_2506061_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.9	3.6e-51
WP_015570430.1|2506118_2506271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023324756.1|2506545_2507529_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_022651306.1|2507619_2508750_-	methyl-accepting chemotaxis sensory transducer	NA	NA	NA	NA	NA
WP_110108456.1|2509066_2509555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058663422.1|2509583_2510900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058663421.1|2510923_2511379_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_032648436.1|2511378_2511924_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_110108457.1|2511901_2512987_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_110108458.1|2512950_2514705_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
2515627:2515642	attR	CGGGCCTGAGCCAGCA	NA	NA	NA	NA
>prophage 4
NZ_CP021167	Enterobacter hormaechei strain 388 chromosome, complete genome	4656223	2990866	2997144	4656223		Enterobacteria_phage(50.0%)	6	NA	NA
WP_110108543.1|2990866_2991403_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	59.6	1.4e-51
WP_045341336.1|2991406_2992285_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	3.9e-107
WP_045617132.1|2992337_2993237_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	35.0	9.7e-29
WP_032659367.1|2993236_2994322_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	51.5	3.7e-99
WP_017383282.1|2994681_2995578_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	1.8e-43
WP_110108544.1|2995752_2997144_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	4.8e-19
>prophage 5
NZ_CP021167	Enterobacter hormaechei strain 388 chromosome, complete genome	4656223	3435464	3514607	4656223	tail,plate,lysis,tRNA,terminase,portal,integrase,capsid	Salmonella_phage(70.21%)	83	3480406:3480455	3514816:3514865
WP_045894642.1|3435464_3436202_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003860725.1|3436334_3437663_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.5	4.7e-48
WP_003860727.1|3437715_3438099_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	2.1e-33
WP_045349762.1|3438414_3439104_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	51.6	1.8e-54
WP_022651671.1|3439143_3440229_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_003860733.1|3440433_3440853_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	37.2	1.2e-13
WP_003860734.1|3440923_3441622_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_023325080.1|3441657_3444321_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_026094276.1|3444430_3445786_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_003860739.1|3445832_3446156_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_003860741.1|3446152_3447460_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.6	2.7e-43
WP_006811623.1|3447611_3448064_-	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	50.0	3.9e-34
WP_003863168.1|3453596_3456170_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_003863167.1|3456299_3457031_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_023314684.1|3457027_3458008_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_003863164.1|3458139_3458877_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_003863162.1|3459144_3459486_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100229775.1|3459591_3459639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110108611.1|3459746_3460907_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_023323575.1|3460903_3461776_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_022649060.1|3461836_3462958_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_110108612.1|3462968_3464039_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	3.4e-89
WP_023323612.1|3464251_3464626_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_003863149.1|3464779_3465316_+	YfiR family protein	NA	NA	NA	NA	NA
WP_110108614.1|3465308_3466529_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	39.8	1.2e-05
WP_047654140.1|3466541_3467027_+	OmpA family protein	NA	NA	NA	NA	NA
WP_110108616.1|3467029_3468400_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_045346112.1|3468438_3468843_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|3468975_3469323_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_058659737.1|3469366_3470134_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003863136.1|3470165_3470705_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003863133.1|3470720_3470969_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003863132.1|3471085_3472447_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_020883913.1|3472538_3473405_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_026094274.1|3473424_3474711_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003863126.1|3474763_3475357_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003863124.1|3475479_3476358_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_045337470.1|3476443_3478105_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_071524123.1|3478079_3478262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003863121.1|3478243_3478582_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_003863119.1|3478643_3478931_-	RnfH family protein	NA	NA	NA	NA	NA
WP_006811645.1|3478920_3479397_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_003863115.1|3479514_3479997_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
3480406:3480455	attL	ATGTAGAAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAATAA	NA	NA	NA	NA
WP_045334934.1|3480567_3480786_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	94.4	5.7e-36
WP_110108618.1|3480854_3481955_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	91.5	4.6e-182
WP_045356110.1|3481951_3482437_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	91.9	1.0e-72
WP_110108620.1|3482439_3485880_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	72.0	0.0e+00
WP_007848878.1|3485872_3485992_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	3.3e-14
WP_014884889.1|3486006_3486309_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	3.1e-40
WP_007848874.1|3486363_3486879_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	93.0	7.6e-87
WP_007848866.1|3486888_3488061_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	92.8	9.5e-210
WP_110108621.1|3488141_3488699_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	87.2	5.9e-85
WP_032665794.1|3489245_3489719_-|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	59.6	6.6e-53
WP_110108622.1|3491202_3491808_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	93.5	2.3e-111
WP_110108623.1|3491800_3492709_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	1.6e-143
WP_110108660.1|3492695_3493055_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	89.8	2.9e-53
WP_033487479.1|3493051_3493630_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	96.4	1.6e-104
WP_110108661.1|3493750_3494854_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	27.7	1.9e-18
WP_110108662.1|3494856_3495342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110108663.1|3495362_3495812_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	73.9	2.4e-52
WP_110108664.1|3495804_3496236_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	86.7	1.5e-67
WP_110108666.1|3496331_3496760_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.9	4.4e-56
WP_110108667.1|3496756_3497272_-	lysozyme	NA	E5G6N1	Salmonella_phage	75.3	4.5e-71
WP_110108668.1|3497252_3497468_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	64.8	4.4e-20
WP_110108669.1|3497471_3497675_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	98.5	2.5e-33
WP_110108670.1|3498231_3498882_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	96.3	1.1e-111
WP_110108671.1|3498885_3499968_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.6	3.4e-185
WP_110108672.1|3499984_3500818_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	83.4	2.5e-111
WP_110108673.1|3500960_3502727_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	94.4	0.0e+00
WP_110108674.1|3502726_3503761_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	90.7	2.2e-173
WP_110108675.1|3503763_3504468_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_110108676.1|3506207_3508601_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.7	0.0e+00
WP_110108677.1|3508597_3509449_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	71.6	4.8e-118
WP_110108678.1|3509445_3509673_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	66.7	2.4e-21
WP_110108679.1|3509672_3509900_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	65.3	1.6e-17
WP_110108680.1|3509967_3510309_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	82.3	1.5e-46
WP_110108681.1|3510272_3510473_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	78.5	2.1e-24
WP_110108682.1|3510480_3510990_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.9	6.0e-84
WP_032636666.1|3511022_3511265_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	4.0e-38
WP_110108683.1|3511384_3512017_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	91.9	1.1e-106
WP_110108684.1|3512018_3513044_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.2	2.6e-187
WP_110108685.1|3513064_3513847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110108686.1|3513839_3514607_+	FAD-dependent thymidylate synthase	NA	A0A0E3T7Y3	Gordonia_phage	34.0	2.5e-25
3514816:3514865	attR	ATGTAGAAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAATAA	NA	NA	NA	NA
>prophage 1
NZ_CP021168	Enterobacter hormaechei strain 388 plasmid p388, complete sequence	79064	0	76921	79064	integrase,transposase	Escherichia_phage(31.03%)	70	33650:33666	72044:72060
WP_001277466.1|1494_1860_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|1856_2093_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|2076_2196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|2158_2371_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|2496_3057_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_015344976.1|3059_6011_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_046788546.1|6019_6421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|6505_7210_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_001447541.1|8134_9019_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|9235_10450_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_000743213.1|10723_10948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|10944_11682_-	recombinase family protein	NA	NA	NA	NA	NA
WP_020324562.1|12313_13018_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_000113282.1|13029_13686_-	tetracycline resistance transcriptional repressor TetR(D)	NA	NA	NA	NA	NA
WP_108996614.1|13781_14966_+	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
WP_000842134.1|15060_16170_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
WP_020324562.1|16659_17364_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_004201232.1|19270_19957_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_004201234.1|20094_20832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749988.1|23576_24146_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_000845048.1|24538_25552_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_063840321.1|25843_26398_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001749986.1|26494_26947_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_001749985.1|27079_27553_+	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	G3MBI7	Bacillus_virus	29.1	1.4e-15
WP_001749984.1|27733_28579_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA16	NA	NA	NA	NA	NA
WP_000679427.1|28695_29043_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|29036_29876_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|30280_31822_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_004201169.1|32134_33166_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201168.1|33176_33815_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
33650:33666	attL	CGATCTGGCCAGCTGCG	NA	NA	NA	NA
WP_004201167.1|33819_34185_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_023408309.1|34188_35001_-	subclass B1 metallo-beta-lactamase NDM-5	NA	NA	NA	NA	NA
WP_001067855.1|35559_36264_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001083725.1|37329_37827_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_071523897.1|37983_38229_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|38234_39026_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|39189_39537_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|39530_40370_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|40774_42316_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001749994.1|43779_44424_-	quinolone resistance pentapeptide repeat protein QnrB6	NA	NA	NA	NA	NA
WP_000679427.1|44654_45002_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|44995_45835_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|45962_46463_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|46969_47734_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|47994_49209_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_072094655.1|49242_50646_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_001749967.1|51057_51264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549088.1|51268_51781_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_020324562.1|51805_52510_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_001039463.1|53271_53658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000861580.1|53666_53858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807690.1|54855_55611_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_094686392.1|57277_58459_-	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_032621004.1|59775_60822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032413492.1|60818_62627_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000493378.1|63251_63602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000129823.1|63652_64396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|64392_65169_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000764642.1|65226_65484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409716.1|65612_65717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|66251_67118_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000339857.1|67474_67744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000368714.1|68158_69364_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000064120.1|69363_70338_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_004118291.1|70419_71691_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000776034.1|71690_72122_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
72044:72060	attR	CGCAGCTGGCCAGATCG	NA	NA	NA	NA
WP_004178082.1|72527_74015_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001776122.1|74484_75450_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
WP_001776120.1|75929_76361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001776119.1|76393_76921_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
