The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	0	7877	5547427	protease	Pandoravirus(50.0%)	7	NA	NA
WP_002918366.1|905_1535_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002918367.1|1876_2428_+	membrane protein	NA	NA	NA	NA	NA
WP_002918368.1|2469_2718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918369.1|3111_3441_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_002918370.1|3670_5008_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_002918371.1|5000_5849_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	30.7	6.0e-20
WP_002918372.1|5942_7877_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	4.1e-117
>prophage 2
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	14475	15917	5547427		Indivirus(50.0%)	2	NA	NA
WP_002918380.1|14475_15447_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.0	1.0e-07
WP_002918381.1|15644_15917_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	63.5	3.1e-15
>prophage 3
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	19966	32897	5547427		Bacillus_virus(16.67%)	15	NA	NA
WP_004150950.1|19966_20779_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	28.8	1.6e-17
WP_002918397.1|20988_21966_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002918399.1|21980_22967_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	3.0e-39
WP_002918405.1|22981_23548_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	81.3	5.3e-57
WP_002918413.1|23544_24120_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002918415.1|24088_24634_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002918417.1|24640_25366_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
WP_002918420.1|25413_26847_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002918423.1|26869_27157_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_002918425.1|27227_27716_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002918428.1|27761_28616_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_002918431.1|28612_28885_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002918435.1|28948_29674_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_002918442.1|29670_30324_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_002918444.1|30557_32897_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	9.3e-39
>prophage 4
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	36841	37774	5547427		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002918455.1|36841_37774_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.8	3.4e-16
>prophage 5
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	45219	115797	5547427	capsid,portal,tRNA,integrase,head,tail,transposase,protease,terminase	uncultured_Caudovirales_phage(60.0%)	73	80978:80995	98173:98190
WP_002918465.1|45219_45714_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|45717_46356_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_135801240.1|46325_46610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829818.1|46667_47060_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|47075_47504_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|47769_48897_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|49087_49486_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_062954970.1|49659_51027_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|51114_52173_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|52309_53248_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|53662_54133_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|54508_54772_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|54870_55137_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|55187_55463_-	barstar family protein	NA	NA	NA	NA	NA
WP_002918632.1|55542_57510_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|57515_58448_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|58455_58659_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|58790_59720_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|59755_61201_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|61289_65087_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918644.1|65124_66594_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|66596_67178_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|67185_67674_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|67673_68666_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|68736_69780_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|70085_72026_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|72105_72297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|72525_73527_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|73526_74135_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|74358_74811_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|74833_75301_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|75311_76661_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|76771_77014_+	YhdT family protein	NA	NA	NA	NA	NA
WP_002918742.1|77003_78455_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|78466_79348_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|79705_80671_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|80695_80992_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
80978:80995	attL	TACGGCATGAACTGATAC	NA	NA	NA	NA
WP_004150954.1|81145_81337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|81339_83001_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|82984_83341_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150957.1|83471_83624_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_004150959.1|83616_84060_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|84059_84359_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|84355_84691_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|84687_85929_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|85930_86491_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|86542_87709_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|87972_88485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|88533_88869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|89211_91347_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|91346_91712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|91708_92077_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004150967.1|92073_92388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|92380_92569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|92561_92831_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_004150969.1|93282_94062_-	phage antirepressor KilAC domain-containing protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_001547839.1|94072_94357_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000019445.1|94673_95654_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_004150970.1|95738_96680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150971.1|96772_97999_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150972.1|98274_98925_-	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
98173:98190	attR	TACGGCATGAACTGATAC	NA	NA	NA	NA
WP_002919101.1|99303_100443_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002919102.1|100455_103566_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919103.1|103859_104081_+	membrane protein	NA	NA	NA	NA	NA
WP_002919123.1|109876_110431_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919125.1|110406_110664_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919126.1|110660_111479_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919132.1|111482_112055_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_004145330.1|112059_112602_-	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_002919137.1|112627_113101_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_002919139.1|113072_114197_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919144.1|114325_114835_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919147.1|114849_115797_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
>prophage 6
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	135700	139069	5547427		Tupanvirus(50.0%)	2	NA	NA
WP_004174069.1|135700_136885_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
WP_002920103.1|136954_139069_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.6	1.8e-57
>prophage 7
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	146914	156558	5547427		Tupanvirus(25.0%)	9	NA	NA
WP_002920148.1|146914_148819_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.9	6.5e-75
WP_072353984.1|149046_150045_+	hydrolase	NA	NA	NA	NA	NA
WP_002920151.1|150041_150260_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	37.3	4.0e-05
WP_002920153.1|150296_151166_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_002920158.1|151220_151625_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242758.1|151931_152564_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_004151402.1|152615_154694_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	84.8	4.1e-62
WP_002920226.1|154683_155904_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_002920229.1|155994_156558_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	58.4	8.1e-58
>prophage 8
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	167959	168787	5547427		Vibrio_phage(100.0%)	1	NA	NA
WP_002920260.1|167959_168787_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.0	6.1e-70
>prophage 9
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	183610	187382	5547427		Bacillus_phage(66.67%)	3	NA	NA
WP_002920331.1|183610_185233_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.3	1.0e-140
WP_062954950.1|185310_186666_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.7	1.6e-11
WP_001157751.1|186662_187382_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 10
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	200208	202599	5547427		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_004151407.1|200208_202599_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.1e-13
>prophage 11
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	205944	206703	5547427		Escherichia_phage(100.0%)	1	NA	NA
WP_002920548.1|205944_206703_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	2.3e-23
>prophage 12
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	210560	213008	5547427		Dickeya_phage(100.0%)	1	NA	NA
WP_002920561.1|210560_213008_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	2.7e-33
>prophage 13
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	230753	232561	5547427		Enterococcus_phage(50.0%)	2	NA	NA
WP_002920785.1|230753_231494_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	6.4e-10
WP_002920787.1|231490_232561_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
>prophage 14
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	235987	238220	5547427		Anomala_cuprea_entomopoxvirus(66.67%)	4	NA	NA
WP_002920800.1|235987_236356_-	type II toxin-antitoxin system death-on-curing family toxin	NA	E4ZFM2	Streptococcus_phage	30.1	3.5e-09
WP_002920802.1|236352_236574_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_004145133.1|236737_237451_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	1.7e-12
WP_002920803.1|237452_238220_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	5.8e-14
>prophage 15
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	245541	251342	5547427		Klosneuvirus(25.0%)	5	NA	NA
WP_002920814.1|245541_246807_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	1.0e-23
WP_004200671.1|246925_248449_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.2	1.4e-14
WP_002920815.1|248501_249356_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
WP_002920816.1|249625_250681_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_002920817.1|250673_251342_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	5.0e-14
>prophage 16
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	254426	258563	5547427		Dickeya_phage(50.0%)	4	NA	NA
WP_002920827.1|254426_255053_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	60.2	2.1e-30
WP_004151416.1|255131_257342_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	36.1	1.1e-113
WP_002920858.1|257445_257691_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	86.1	4.7e-10
WP_002920860.1|257897_258563_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.8	2.1e-57
>prophage 17
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	264863	268970	5547427		Tupanvirus(66.67%)	3	NA	NA
WP_002921032.1|264863_266849_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	5.7e-21
WP_002921035.1|266845_267829_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase ArnC	NA	A8CG95	Salmonella_phage	33.3	9.6e-38
WP_002921037.1|267830_268970_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.3	9.4e-29
>prophage 18
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	275072	275864	5547427		Bacillus_virus(100.0%)	1	NA	NA
WP_002921186.1|275072_275864_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	24.0	2.9e-13
>prophage 19
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	284405	286448	5547427		Indivirus(100.0%)	1	NA	NA
WP_004151426.1|284405_286448_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.8	3.8e-44
>prophage 20
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	330177	336150	5547427		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_002921733.1|330177_332289_-	UDP-forming cellulose synthase catalytic subunit	NA	M1I277	Paramecium_bursaria_Chlorella_virus	34.2	4.6e-37
WP_002921735.1|332308_333100_-	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
WP_004151436.1|333101_333641_-	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
WP_004145206.1|333958_334138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002921784.1|334156_335170_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	7.4e-17
WP_002921785.1|335166_336150_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	2.3e-15
>prophage 21
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	340473	341837	5547427	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_085955125.1|340473_341837_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 22
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	348656	351396	5547427		Streptococcus_phage(50.0%)	2	NA	NA
WP_002921915.1|348656_349097_+	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	32.9	1.7e-15
WP_004152428.1|349065_351396_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.3	5.7e-65
>prophage 23
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	356555	357527	5547427		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002921928.1|356555_357527_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.9	2.9e-18
>prophage 24
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	360930	364433	5547427	transposase	Morganella_phage(33.33%)	4	NA	NA
WP_000014594.1|360930_361143_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_004152429.1|361241_362861_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	24.7	4.0e-25
WP_002922102.1|363162_363315_-	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_023327762.1|363386_364433_+|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	22.9	1.0e-05
>prophage 25
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	368336	369332	5547427		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_004152039.1|368336_369332_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.3	3.6e-08
>prophage 26
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	374800	376342	5547427		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002922346.1|374800_376342_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	2.5e-16
>prophage 27
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	384315	386157	5547427		Tupanvirus(100.0%)	1	NA	NA
WP_002922367.1|384315_386157_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	24.7	1.2e-12
>prophage 28
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	401994	411144	5547427		Rhizobium_phage(20.0%)	9	NA	NA
WP_002922429.1|401994_402246_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	52.1	9.9e-16
WP_002922436.1|402350_402782_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_004152046.1|403027_404572_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002922458.1|404581_405853_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	3.5e-08
WP_002922459.1|405856_406804_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_002922460.1|406809_407598_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_110437834.1|407766_408792_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	3.6e-19
WP_002922462.1|408804_409998_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.5	1.7e-36
WP_002922463.1|410211_411144_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	2.2e-36
>prophage 29
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	423912	428654	5547427		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_002922501.1|423912_424392_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.3	2.8e-27
WP_002922508.1|424579_425389_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.1	2.9e-24
WP_002922510.1|425524_425692_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|425712_425949_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002922589.1|426165_426831_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_002922591.1|427003_428218_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.5	8.5e-44
WP_004145270.1|428195_428654_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	4.7e-48
>prophage 30
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	432113	447563	5547427	transposase	Staphylococcus_phage(16.67%)	13	NA	NA
WP_004152982.1|432113_433031_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	1.3e-23
WP_004216993.1|433023_433911_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004216995.1|433909_434041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073547080.1|435793_436774_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
WP_062955110.1|437478_438342_+	YicC family protein	NA	NA	NA	NA	NA
WP_004152903.1|438524_439271_+	isocitrate lyase/phosphoenolpyruvate mutase family protein	NA	NA	NA	NA	NA
WP_004151500.1|439273_440332_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.5	6.3e-19
WP_004151501.1|440387_441638_-	chloride channel protein	NA	NA	NA	NA	NA
WP_002922654.1|441912_442530_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_002922662.1|442535_444212_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.8	1.5e-22
WP_002922664.1|444470_445094_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	1.7e-19
WP_000135058.1|445148_445424_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_004151503.1|445442_447563_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 31
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	458544	459396	5547427		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002922941.1|458544_459396_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.2	2.2e-14
>prophage 32
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	462530	463922	5547427		environmental_Halophage(100.0%)	1	NA	NA
WP_002922950.1|462530_463922_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	95.2	1.4e-66
>prophage 33
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	477181	478231	5547427		Tupanvirus(100.0%)	1	NA	NA
WP_002922967.1|477181_478231_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	43.9	3.4e-73
>prophage 34
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	495491	496655	5547427		Salmonella_phage(100.0%)	1	NA	NA
WP_002923107.1|495491_496655_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	4.5e-26
>prophage 35
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	515090	516203	5547427		Bacillus_virus(100.0%)	1	NA	NA
WP_002923193.1|515090_516203_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.5	1.1e-26
>prophage 36
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	528380	533819	5547427		Micromonas_sp._RCC1109_virus(50.0%)	7	NA	NA
WP_004198592.1|528380_530069_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	1.7e-58
WP_002923286.1|530173_530269_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_014343455.1|530281_530449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004145059.1|530901_531021_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_002923294.1|531111_531558_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002923296.1|531625_532459_+	EamA family transporter	NA	NA	NA	NA	NA
WP_002923297.1|532634_533819_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	25.5	3.7e-12
>prophage 37
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	544828	546748	5547427		Morganella_phage(33.33%)	3	NA	NA
WP_004151522.1|544828_545653_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.4	8.2e-91
WP_004145074.1|545789_546218_-	heat shock chaperone IbpB	NA	A0A2H4N7P1	Lake_Baikal_phage	41.1	2.6e-16
WP_004151523.1|546334_546748_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 38
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	550843	553024	5547427	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_000019473.1|550843_551824_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_000019473.1|552043_553024_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 39
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	559499	567029	5547427		Bacillus_virus(33.33%)	7	NA	NA
WP_004173845.1|559499_561914_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.3	8.2e-115
WP_004151532.1|561942_563016_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004151533.1|563162_564263_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_004151534.1|564267_565671_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000831330.1|566292_566433_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_004151535.1|566448_566808_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_004151536.1|566771_567029_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	9.2e-17
>prophage 40
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	574521	575859	5547427		Moraxella_phage(100.0%)	1	NA	NA
WP_004145100.1|574521_575859_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.6	1.1e-63
>prophage 41
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	581635	589195	5547427		Bacillus_phage(25.0%)	6	NA	NA
WP_004145006.1|581635_582409_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.2	2.0e-14
WP_004151547.1|582456_583347_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_004145004.1|583346_584306_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_004150308.1|584434_585475_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.1	3.4e-49
WP_004151549.1|585811_587641_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	41.2	1.6e-123
WP_004151550.1|587824_589195_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.6	2.8e-35
>prophage 42
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	601545	602538	5547427		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_002882514.1|601545_602538_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.0	4.6e-48
>prophage 43
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	605703	611582	5547427		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_002882520.1|605703_607572_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	8.4e-67
WP_002882527.1|607757_608177_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_002882529.1|608187_609693_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.3	4.0e-19
WP_002882531.1|609698_610664_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_002882536.1|610691_611582_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	3.3e-05
>prophage 44
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	625876	628669	5547427		uncultured_virus(100.0%)	1	NA	NA
WP_002882729.1|625876_628669_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.5	6.4e-71
>prophage 45
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	632557	635025	5547427		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_002882749.1|632557_633967_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
WP_004146229.1|633975_635025_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.0e-08
>prophage 46
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	641847	642765	5547427		Pandoravirus(100.0%)	1	NA	NA
WP_002882812.1|641847_642765_-	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	28.8	7.9e-18
>prophage 47
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	665736	667248	5547427		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004151860.1|665736_667248_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	7.6e-18
>prophage 48
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	675586	679089	5547427		Bacillus_thuringiensis_phage(33.33%)	4	NA	NA
WP_002882894.1|675586_676207_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	3.5e-62
WP_002882896.1|676279_676954_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_002882898.1|677020_678394_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
WP_002882901.1|678390_679089_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
>prophage 49
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	683591	684926	5547427		Erwinia_phage(100.0%)	1	NA	NA
WP_002882917.1|683591_684926_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.5	2.1e-43
>prophage 50
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	695990	697547	5547427		Pandoravirus(100.0%)	1	NA	NA
WP_002882946.1|695990_697547_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	23.8	5.6e-08
>prophage 51
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	702318	702981	5547427		Cyanophage(100.0%)	1	NA	NA
WP_002882982.1|702318_702981_-	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	1.0e-27
>prophage 52
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	717611	719450	5547427		Acinetobacter_phage(100.0%)	1	NA	NA
WP_002883025.1|717611_719450_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.2	1.7e-08
>prophage 53
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	729513	731160	5547427		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002883142.1|729513_731160_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	3.1e-65
>prophage 54
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	739263	741285	5547427		Bacillus_phage(100.0%)	1	NA	NA
WP_004152491.1|739263_741285_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	1.1e-112
>prophage 55
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	745776	747713	5547427		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
WP_002883222.1|745776_747042_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.3	1.8e-41
WP_002883224.1|747383_747713_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	39.6	2.5e-14
>prophage 56
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	751763	757905	5547427		Catovirus(20.0%)	6	NA	NA
WP_002883297.1|751763_752894_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.2	9.7e-26
WP_002883302.1|752890_754153_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	25.9	3.8e-23
WP_002883303.1|754149_755217_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	2.4e-98
WP_002883307.1|755235_756117_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	67.4	6.0e-108
WP_004146507.1|756094_756769_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_002883310.1|756774_757905_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
>prophage 57
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	774272	778117	5547427		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_002883396.1|774272_775175_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.4	5.9e-18
WP_002883397.1|775174_775891_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_002883398.1|775954_778117_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	6.0e-117
>prophage 58
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	781952	785414	5547427	transposase	Catovirus(50.0%)	3	NA	NA
WP_004152055.1|781952_783779_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	5.7e-84
WP_004152056.1|783840_784461_+	threonine export protein RhtC	NA	NA	NA	NA	NA
WP_002883410.1|784505_785414_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	6.3e-68
>prophage 59
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	797415	800759	5547427		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_002883424.1|797415_799056_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	2.2e-39
WP_002883425.1|799185_799437_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_002883426.1|799440_799977_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_002883427.1|799979_800759_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.7	7.4e-25
>prophage 60
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	809477	810092	5547427		Streptococcus_phage(100.0%)	1	NA	NA
WP_002883449.1|809477_810092_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.5	9.6e-20
>prophage 61
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	820025	823146	5547427		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_002883524.1|820025_820976_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	2.7e-29
WP_004174069.1|821961_823146_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
>prophage 62
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	827373	839817	5547427		Chrysochromulina_ericina_virus(33.33%)	6	NA	NA
WP_004152306.1|827373_831402_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.6	2.3e-21
WP_002884146.1|831478_835702_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	9.1e-69
WP_002884148.1|836102_837443_+	anaerobic C4-dicarboxylate transporter DcuB	NA	NA	NA	NA	NA
WP_002884149.1|837485_837803_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002884150.1|837806_838112_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_004171439.1|838284_839817_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.1	2.2e-12
>prophage 63
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	848242	850006	5547427		Klosneuvirus(50.0%)	3	NA	NA
WP_004152311.1|848242_848914_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	27.6	2.6e-18
WP_002884331.1|848956_849547_+	YjaG family protein	NA	NA	NA	NA	NA
WP_002884342.1|849733_850006_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	9.4e-20
>prophage 64
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	855427	857017	5547427		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_002884359.1|855427_857017_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.0	5.3e-70
>prophage 65
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	870560	874244	5547427		Dickeya_phage(100.0%)	1	NA	NA
WP_004151753.1|870560_874244_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 66
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	881445	882426	5547427	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000019473.1|881445_882426_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 67
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	899325	900435	5547427		Mycoplasma_phage(100.0%)	1	NA	NA
WP_002884743.1|899325_900435_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	3.6e-17
>prophage 68
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	907501	908110	5547427		Lactococcus_phage(100.0%)	1	NA	NA
WP_002884822.1|907501_908110_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	4.6e-14
>prophage 69
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	914105	916632	5547427		Escherichia_phage(50.0%)	2	NA	NA
WP_002884942.1|914105_915521_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.8	5.7e-201
WP_002884943.1|915552_916632_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.4	1.9e-26
>prophage 70
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	919813	925120	5547427		uncultured_Mediterranean_phage(33.33%)	3	NA	NA
WP_004146620.1|919813_922639_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
WP_004151744.1|922890_923415_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	95.4	5.1e-54
WP_002885017.1|923539_925120_-	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	6.3e-07
>prophage 71
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	937099	938131	5547427		Bacillus_virus(100.0%)	1	NA	NA
WP_004177837.1|937099_938131_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	2.3e-26
>prophage 72
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	945660	947010	5547427		Moraxella_phage(100.0%)	1	NA	NA
WP_002885079.1|945660_947010_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.1	1.5e-158
>prophage 73
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	959293	966078	5547427		Staphylococcus_phage(50.0%)	5	NA	NA
WP_002885145.1|959293_961252_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.3	3.0e-91
WP_004226113.1|961352_961553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004146659.1|961664_962978_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_004151733.1|963014_963701_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_077598858.1|963930_966078_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.3	2.0e-32
>prophage 74
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	972019	973540	5547427		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002885173.1|972019_973540_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	2.2e-17
>prophage 75
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	978920	980467	5547427		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_002885196.1|978920_979601_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.0	6.7e-06
WP_002885198.1|979708_980467_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.7	2.6e-14
>prophage 76
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	985827	987330	5547427		Burkholderia_virus(100.0%)	1	NA	NA
WP_002885227.1|985827_987330_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.7	1.1e-56
>prophage 77
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	991694	996781	5547427	transposase	Escherichia_phage(40.0%)	7	NA	NA
WP_004146678.1|991694_992651_+	recombinase	NA	A0A222YXF2	Escherichia_phage	78.0	1.3e-143
WP_004151723.1|992660_993032_+	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	53.7	2.8e-22
WP_085955125.1|993197_994561_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
WP_002885324.1|994729_995035_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_002885338.1|995034_995952_-	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	42.2	2.8e-07
WP_002885341.1|996027_996141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199298.1|996097_996781_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	42.2	5.1e-30
>prophage 78
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1008192	1009545	5547427		Escherichia_phage(100.0%)	1	NA	NA
WP_000549132.1|1008192_1009545_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	53.5	6.6e-122
>prophage 79
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1016404	1020778	5547427	transposase	Streptococcus_phage(50.0%)	3	NA	NA
WP_004239734.1|1016404_1018459_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	28.9	7.4e-40
WP_000202155.1|1019342_1019810_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_004239733.1|1019830_1020778_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	46.4	7.5e-56
>prophage 80
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1037203	1057902	5547427		Bacillus_phage(50.0%)	6	NA	NA
WP_000588838.1|1037203_1038931_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	7.8e-35
WP_001044024.1|1038923_1040690_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.0	1.8e-34
WP_004239723.1|1040708_1041482_-	thioesterase	NA	NA	NA	NA	NA
WP_000801189.1|1041481_1042570_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004239722.1|1042569_1051785_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	39.7	1.0e-48
WP_004239721.1|1051797_1057902_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	29.0	1.3e-36
>prophage 81
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1078658	1080884	5547427		Yersinia_phage(100.0%)	1	NA	NA
WP_004239700.1|1078658_1080884_+	trimeric autotransporter adhesin TaaP	NA	A0A1V0DXR3	Yersinia_phage	40.2	4.4e-06
>prophage 82
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1093156	1094131	5547427		Caulobacter_phage(100.0%)	1	NA	NA
WP_012368428.1|1093156_1094131_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.5	2.1e-45
>prophage 83
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1109462	1115936	5547427	transposase	Cronobacter_phage(25.0%)	6	NA	NA
WP_004152420.1|1109462_1109756_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	42.3	3.5e-12
WP_002885441.1|1109793_1111440_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	9.0e-190
WP_004152419.1|1111700_1112054_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_099143967.1|1112108_1112885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|1112935_1113640_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002885444.1|1113812_1115936_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.9	7.6e-32
>prophage 84
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1127115	1132309	5547427		Morganella_phage(33.33%)	6	NA	NA
WP_002885523.1|1127115_1127649_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	50.0	5.0e-41
WP_002885526.1|1127762_1128122_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_002885530.1|1128132_1128528_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_002885531.1|1128538_1129273_-	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_004152023.1|1129265_1131056_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.2	3.8e-16
WP_004146714.1|1131331_1132309_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.7	2.8e-29
>prophage 85
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1139663	1140209	5547427		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_002885538.1|1139663_1140209_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	42.1	1.2e-29
>prophage 86
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1145051	1148277	5547427		Vibrio_phage(50.0%)	2	NA	NA
WP_004152021.1|1145051_1146407_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	3.1e-18
WP_004152020.1|1146417_1148277_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.8	2.2e-59
>prophage 87
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1154207	1158551	5547427		Pithovirus(50.0%)	3	NA	NA
WP_002885665.1|1154207_1155506_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
WP_002885667.1|1155656_1156082_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_002885668.1|1156118_1158551_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.7	1.4e-66
>prophage 88
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1178148	1178973	5547427		Bordetella_phage(100.0%)	1	NA	NA
WP_002886699.1|1178148_1178973_-	AraC family transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	42.0	1.9e-07
>prophage 89
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1195472	1202051	5547427		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_002886766.1|1195472_1196003_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	2.7e-55
WP_002886769.1|1196406_1197363_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002886772.1|1197486_1198989_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	7.6e-10
WP_004152011.1|1198999_1200025_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002886825.1|1200011_1201010_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_002886827.1|1201052_1202051_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	1.3e-69
>prophage 90
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1218184	1221316	5547427		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_002886902.1|1218184_1218469_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.6	2.4e-26
WP_002886903.1|1218472_1218937_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	58.9	2.9e-53
WP_002886904.1|1219177_1221316_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.2	5.3e-267
>prophage 91
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1229073	1235131	5547427		Enterobacteria_phage(33.33%)	5	NA	NA
WP_002886919.1|1229073_1230021_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.6	1.5e-11
WP_062955043.1|1230400_1233109_+	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	26.7	1.4e-46
WP_002886926.1|1233181_1233568_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002886927.1|1233720_1234182_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002886928.1|1234195_1235131_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	1.3e-52
>prophage 92
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1245224	1254274	5547427	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_002886952.1|1245224_1248080_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.4	6.0e-141
WP_002886953.1|1248079_1248523_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_002886954.1|1248642_1250154_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	9.2e-48
WP_002886955.1|1250543_1251641_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_002886956.1|1251640_1252723_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_002886957.1|1252771_1254274_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.1	1.6e-84
>prophage 93
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1270165	1274991	5547427		Bacillus_virus(50.0%)	5	NA	NA
WP_002886975.1|1270165_1271239_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	5.2e-29
WP_002886979.1|1271244_1272069_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_002886980.1|1272079_1272967_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_004152194.1|1272956_1273841_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004177639.1|1273971_1274991_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.7	1.1e-44
>prophage 94
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1278452	1285748	5547427	transposase	Enterobacteria_phage(85.71%)	9	NA	NA
WP_000019445.1|1278452_1279433_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_004152202.1|1279923_1280490_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|1280507_1280753_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152204.1|1280749_1281487_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_000556592.1|1282047_1282314_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_072093163.1|1282316_1282859_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152205.1|1282855_1283083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152206.1|1283079_1283400_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152207.1|1283414_1285748_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
>prophage 95
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1306558	1311516	5547427		Enterobacteria_phage(33.33%)	4	NA	NA
WP_002887258.1|1306558_1307287_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	47.4	1.4e-46
WP_002887259.1|1307403_1307937_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	59.6	8.2e-52
WP_002887261.1|1307946_1308294_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002887262.1|1308366_1311516_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.4	6.4e-59
>prophage 96
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1314754	1316861	5547427		Bacillus_phage(50.0%)	2	NA	NA
WP_002887273.1|1314754_1315438_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	36.0	7.9e-31
WP_002887275.1|1315427_1316861_+	Cu(+)/Ag(+) sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.6	2.0e-12
>prophage 97
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1326617	1329362	5547427		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004152413.1|1326617_1329362_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	2.7e-21
>prophage 98
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1333278	1334763	5547427		Bacillus_virus(100.0%)	1	NA	NA
WP_002887350.1|1333278_1334763_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	3.2e-13
>prophage 99
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1350350	1351277	5547427	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_002887421.1|1350350_1351277_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	3.9e-73
>prophage 100
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1384155	1385178	5547427		Tupanvirus(100.0%)	1	NA	NA
WP_004151386.1|1384155_1385178_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	27.3	1.7e-13
>prophage 101
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1392182	1395350	5547427	transposase	Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_002887612.1|1392182_1393244_+	SIS domain-containing protein	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	22.5	2.5e-07
WP_002887615.1|1393261_1394272_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_004221130.1|1394405_1395350_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	2.9e-68
>prophage 102
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1398510	1399790	5547427		Shigella_phage(50.0%)	2	NA	NA
WP_002887623.1|1398510_1399248_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.7	1.2e-64
WP_002887624.1|1399250_1399790_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.4e-27
>prophage 103
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1413013	1415734	5547427		Streptococcus_phage(50.0%)	3	NA	NA
WP_002887711.1|1413013_1414603_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.9	5.3e-30
WP_004146042.1|1414822_1415443_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_002887716.1|1415572_1415734_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	67.9	1.2e-11
>prophage 104
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1420469	1421792	5547427		Geobacillus_virus(100.0%)	1	NA	NA
WP_002887787.1|1420469_1421792_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.9	2.0e-78
>prophage 105
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1428123	1433283	5547427		Enterococcus_phage(33.33%)	3	NA	NA
WP_002887802.1|1428123_1429356_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.3	1.3e-87
WP_002887805.1|1429449_1431117_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.8	2.9e-42
WP_002887806.1|1431345_1433283_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	2.7e-12
>prophage 106
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1450440	1451394	5547427		Cyanophage(100.0%)	1	NA	NA
WP_002887897.1|1450440_1451394_+	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	1.3e-10
>prophage 107
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1455765	1465718	5547427	tRNA	Chrysochromulina_ericina_virus(25.0%)	7	NA	NA
WP_004146997.1|1455765_1457682_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
WP_002887955.1|1457769_1458903_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	1.2e-28
WP_002887958.1|1459080_1460256_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.4	4.9e-89
WP_002887961.1|1460310_1461207_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_002887965.1|1461326_1461590_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_002887969.1|1461919_1462858_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_002887972.1|1462901_1465718_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.3	4.6e-77
>prophage 108
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1484515	1485664	5547427		Halovirus(100.0%)	1	NA	NA
WP_002888051.1|1484515_1485664_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.1	9.1e-48
>prophage 109
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1492005	1493589	5547427		Bacillus_phage(50.0%)	2	NA	NA
WP_002888320.1|1492005_1492485_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.2e-28
WP_002888321.1|1492740_1493589_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	48.4	3.4e-07
>prophage 110
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1506047	1511499	5547427		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_004151368.1|1506047_1508954_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.9	4.9e-21
WP_002888349.1|1509141_1511499_-	DNA polymerase II	NA	X5FTI3	Fish_lymphocystis_disease_virus	23.4	6.7e-13
>prophage 111
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1517795	1518497	5547427		Bacillus_virus(100.0%)	1	NA	NA
WP_004145970.1|1517795_1518497_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	36.2	8.1e-23
>prophage 112
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1527196	1527952	5547427		Streptococcus_phage(100.0%)	1	NA	NA
WP_004151365.1|1527196_1527952_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.5	5.5e-25
>prophage 113
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1539351	1541076	5547427		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_002888534.1|1539351_1541076_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.8	3.3e-33
>prophage 114
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1567268	1568312	5547427		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004145938.1|1567268_1568312_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.9	3.1e-103
>prophage 115
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1572579	1573143	5547427		Sphingobium_phage(100.0%)	1	NA	NA
WP_002888692.1|1572579_1573143_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.4	4.1e-09
>prophage 116
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1584483	1585908	5547427		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002888731.1|1584483_1585908_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	2.1e-41
>prophage 117
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1595557	1605435	5547427	transposase	Shigella_phage(25.0%)	9	NA	NA
WP_085955245.1|1595557_1596750_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_002888804.1|1597637_1598048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002888808.1|1598295_1598643_-	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_002888811.1|1598788_1600387_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	51.1	7.5e-16
WP_002888816.1|1600470_1602861_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_012542835.1|1602941_1603061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002888819.1|1603065_1603602_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.8	3.9e-17
WP_002888821.1|1603661_1604324_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_002888823.1|1604508_1605435_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.4	1.8e-22
>prophage 118
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1610839	1617610	5547427	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_071526609.1|1610839_1612234_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	36.9	1.6e-25
WP_004145903.1|1612296_1613178_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_002888845.1|1613237_1613693_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_002888848.1|1613855_1614572_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_004145901.1|1614571_1615108_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_004151944.1|1615180_1617610_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	31.0	5.1e-40
>prophage 119
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1639746	1640544	5547427		Planktothrix_phage(100.0%)	1	NA	NA
WP_002889212.1|1639746_1640544_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	9.2e-15
>prophage 120
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1646510	1646855	5547427		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_002889275.1|1646510_1646855_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.2e-27
>prophage 121
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1650810	1652244	5547427	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_002889286.1|1650810_1652244_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	3.9e-24
>prophage 122
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1663822	1664581	5547427		Flavobacterium_phage(100.0%)	1	NA	NA
WP_002889316.1|1663822_1664581_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	6.1e-24
>prophage 123
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1673412	1677512	5547427		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_002889376.1|1673412_1674012_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.6	1.6e-27
WP_002889378.1|1674029_1677512_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.4	9.1e-208
>prophage 124
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1690496	1691528	5547427		Planktothrix_phage(100.0%)	1	NA	NA
WP_002889450.1|1690496_1691528_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.3	9.4e-36
>prophage 125
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1698040	1698844	5547427		Indivirus(100.0%)	1	NA	NA
WP_002889598.1|1698040_1698844_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	37.0	8.4e-40
>prophage 126
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1702909	1707119	5547427		Lactobacillus_phage(33.33%)	5	NA	NA
WP_002889632.1|1702909_1704277_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	29.1	4.0e-10
WP_004152035.1|1704348_1705104_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_062955117.1|1705136_1705859_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002889686.1|1705855_1706323_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	56.6	8.0e-51
WP_004145831.1|1706378_1707119_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	36.9	7.2e-38
>prophage 127
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1712627	1713209	5547427		Caulobacter_phage(100.0%)	1	NA	NA
WP_004145825.1|1712627_1713209_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.8	2.2e-13
>prophage 128
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1730458	1731742	5547427		Klosneuvirus(100.0%)	1	NA	NA
WP_004147193.1|1730458_1731742_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.4	6.4e-34
>prophage 129
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1739275	1740271	5547427		Catovirus(100.0%)	1	NA	NA
WP_110437839.1|1739275_1740271_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	29.9	2.4e-28
>prophage 130
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1744918	1746316	5547427		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002889878.1|1744918_1746316_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.5	5.7e-44
>prophage 131
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1754772	1767767	5547427	integrase	Enterobacteria_phage(72.73%)	14	1742906:1742920	1765962:1765976
1742906:1742920	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_002889890.1|1754772_1757106_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_002889897.1|1757117_1757438_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889911.1|1757434_1757662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072028197.1|1757658_1758210_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|1758212_1758479_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_062956184.1|1759020_1759758_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
WP_004152203.1|1759754_1760000_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|1760017_1760584_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152979.1|1761151_1761577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|1761576_1762527_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|1762514_1763705_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|1764057_1765311_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|1765321_1766425_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
1765962:1765976	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_004144576.1|1766714_1767767_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	57.9	1.4e-111
>prophage 132
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1774611	1775454	5547427		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002890003.1|1774611_1775454_-	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.2	2.4e-13
>prophage 133
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1784527	1788248	5547427		Anomala_cuprea_entomopoxvirus(66.67%)	5	NA	NA
WP_004151355.1|1784527_1785346_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	3.1e-34
WP_002890106.1|1785347_1786157_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002890108.1|1786490_1786661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002890126.1|1786777_1787473_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.9	1.1e-06
WP_004151354.1|1787465_1788248_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	8.8e-10
>prophage 134
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1799251	1800019	5547427		Planktothrix_phage(100.0%)	1	NA	NA
WP_002890194.1|1799251_1800019_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	4.3e-25
>prophage 135
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1807138	1808407	5547427	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_004152342.1|1807138_1808407_-|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
>prophage 136
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1829441	1837961	5547427		Bacillus_phage(60.0%)	6	NA	NA
WP_002890285.1|1829441_1830353_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	5.5e-104
WP_002890286.1|1830444_1831359_+	fructokinase	NA	NA	NA	NA	NA
WP_004151346.1|1831432_1834570_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	24.9	1.0e-08
WP_002890342.1|1834566_1835772_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	35.5	1.8e-06
WP_002890343.1|1835954_1836644_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.6	3.7e-36
WP_002890344.1|1836665_1837961_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.0	2.2e-26
>prophage 137
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1854766	1859105	5547427	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_002890395.1|1854766_1855894_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	1.6e-89
WP_002890398.1|1855916_1856249_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	4.9e-10
WP_002890400.1|1856275_1858123_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_002890403.1|1858133_1859105_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.1	3.6e-45
>prophage 138
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1862703	1867363	5547427		Indivirus(33.33%)	6	NA	NA
WP_002890420.1|1862703_1863807_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	6.5e-51
WP_001021161.1|1863894_1864365_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_002891356.1|1864384_1864804_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_002891357.1|1864875_1865847_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_004191729.1|1865839_1866343_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_002891359.1|1866388_1867363_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	21.2	1.2e-08
>prophage 139
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1880148	1881846	5547427		Lactobacillus_phage(100.0%)	1	NA	NA
WP_004151339.1|1880148_1881846_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	25.5	7.2e-17
>prophage 140
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1896152	1901321	5547427	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_002891804.1|1896152_1896776_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	3.8e-64
WP_002891807.1|1897026_1898301_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	7.3e-131
WP_004151336.1|1898484_1900839_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	2.7e-224
WP_002444653.1|1901048_1901321_+	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
>prophage 141
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1904551	1905253	5547427		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002891863.1|1904551_1905253_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.1e-88
>prophage 142
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1909680	1913224	5547427		Bacillus_phage(100.0%)	2	NA	NA
WP_002891876.1|1909680_1911453_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	9.1e-47
WP_002891880.1|1911445_1913224_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	6.0e-38
>prophage 143
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1924147	1925257	5547427		Planktothrix_phage(100.0%)	1	NA	NA
WP_002891989.1|1924147_1925257_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.5	1.1e-26
>prophage 144
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1934431	1946509	5547427	transposase	Enterobacteria_phage(25.0%)	14	NA	NA
WP_002892007.1|1934431_1935502_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	42.8	6.1e-70
WP_002892011.1|1935617_1935881_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002892018.1|1935880_1936021_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_002892021.1|1936017_1936716_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002892023.1|1936816_1938268_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	4.6e-12
WP_002892026.1|1938242_1938713_-	YlaC family protein	NA	NA	NA	NA	NA
WP_004147370.1|1938733_1938874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002892030.1|1938845_1939412_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_002892050.1|1939570_1939789_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_002892066.1|1939815_1940190_-	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_020326861.1|1940675_1943822_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.6	5.6e-47
WP_002892072.1|1943844_1945038_-	multidrug efflux RND transporter periplasmic adaptor subunit AcrA	NA	NA	NA	NA	NA
WP_049245342.1|1945180_1945483_+	multidrug efflux transporter transcriptional repressor AcrR	NA	NA	NA	NA	NA
WP_000019445.1|1945528_1946509_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 145
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1950543	1958354	5547427	transposase	Sodalis_phage(25.0%)	9	NA	NA
WP_002892131.1|1950543_1951443_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	2.1e-63
WP_002892136.1|1951510_1951684_-	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_002892142.1|1951696_1952224_-	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_002892144.1|1952293_1952671_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_002892145.1|1952821_1953373_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	3.9e-28
WP_004151328.1|1953465_1955373_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	2.3e-43
WP_002892173.1|1955430_1955763_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_002892177.1|1955762_1956368_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_002892181.1|1956479_1958354_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	6.4e-115
>prophage 146
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1968499	1973722	5547427		uncultured_virus(33.33%)	4	NA	NA
WP_004151326.1|1968499_1971001_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	1.6e-113
WP_110437840.1|1971107_1971617_+	MerR family DNA-binding transcriptional regulator	NA	A0A1W6JP29	Morganella_phage	43.7	1.0e-22
WP_002892402.1|1971717_1971990_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_002892260.1|1973044_1973722_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.5	7.8e-23
>prophage 147
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1976904	1977591	5547427		Planktothrix_phage(100.0%)	1	NA	NA
WP_004151324.1|1976904_1977591_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	2.1e-31
>prophage 148
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	1986136	1988648	5547427	tRNA	Moumouvirus(50.0%)	3	NA	NA
WP_004143010.1|1986136_1987522_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|1987567_1987780_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|1987781_1988648_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
>prophage 149
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2000336	2001257	5547427		Morganella_phage(100.0%)	1	NA	NA
WP_002892400.1|2000336_2001257_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
>prophage 150
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2007480	2012498	5547427	tRNA,transposase	Acinetobacter_phage(33.33%)	4	NA	NA
WP_004151795.1|2007480_2008956_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
WP_002892491.1|2009287_2010805_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
WP_002892494.1|2010881_2011307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|2011517_2012498_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 151
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2020246	2026047	5547427		Staphylococcus_phage(50.0%)	5	NA	NA
WP_004142660.1|2020246_2021731_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	3.8e-14
WP_170932064.1|2021750_2022773_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004151798.1|2022956_2023565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153625.1|2023612_2024623_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004199626.1|2024646_2026047_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	24.5	3.3e-15
>prophage 152
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2032669	2033467	5547427		Bacillus_virus(100.0%)	1	NA	NA
WP_002892698.1|2032669_2033467_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	6.0e-14
>prophage 153
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2048249	2049365	5547427		Tupanvirus(100.0%)	1	NA	NA
WP_004151809.1|2048249_2049365_+	class II histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	32.7	1.5e-39
>prophage 154
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2092258	2094982	5547427		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_004152949.1|2092258_2094982_+	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.1	2.1e-66
>prophage 155
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2099515	2100878	5547427	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_085955125.1|2099515_2100878_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 156
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2105385	2110065	5547427		Streptococcus_phage(50.0%)	5	NA	NA
WP_002893182.1|2105385_2106849_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.1e-16
WP_002893184.1|2107090_2107942_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002893187.1|2107989_2108631_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002893189.1|2108645_2109311_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004151676.1|2109303_2110065_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	1.3e-29
>prophage 157
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2113135	2114663	5547427		Planktothrix_phage(100.0%)	2	NA	NA
WP_004151674.1|2113135_2113840_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	3.9e-25
WP_004151673.1|2113826_2114663_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	1.5e-12
>prophage 158
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2119220	2125134	5547427	holin	Catovirus(50.0%)	4	NA	NA
WP_004142489.1|2119220_2120885_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	6.1e-61
WP_002893471.1|2120898_2122371_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004151671.1|2122384_2122972_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_004142478.1|2123100_2125134_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.7	5.8e-21
>prophage 159
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2131837	2133382	5547427		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002893593.1|2131837_2133382_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	4.6e-18
>prophage 160
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2144774	2149515	5547427		Tupanvirus(50.0%)	2	NA	NA
WP_004151663.1|2144774_2148656_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	27.6	3.1e-55
WP_002893737.1|2148720_2149515_-	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	25.7	1.5e-09
>prophage 161
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2161857	2166278	5547427		Burkholderia_phage(50.0%)	5	NA	NA
WP_002893905.1|2161857_2162262_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	34.1	4.7e-07
WP_002893907.1|2162236_2162539_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002893908.1|2162722_2163466_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_004151660.1|2163523_2164612_-	oxidoreductase	NA	NA	NA	NA	NA
WP_004151659.1|2164775_2166278_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	4.9e-17
>prophage 162
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2183389	2197104	5547427		Cedratvirus(20.0%)	12	NA	NA
WP_002894255.1|2183389_2184418_+	2-hydroxyacid dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	34.0	7.2e-28
WP_002894256.1|2184460_2185402_-	sugar kinase	NA	NA	NA	NA	NA
WP_002894258.1|2185413_2186418_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004147555.1|2186414_2187404_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152854.1|2187400_2188903_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	9.2e-16
WP_002894353.1|2188947_2189928_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004151652.1|2190336_2192646_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	33.6	1.0e-82
WP_002894357.1|2192753_2193296_-	1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase	NA	NA	NA	NA	NA
WP_002894359.1|2193292_2193982_-	acireductone synthase	NA	NA	NA	NA	NA
WP_004220148.1|2194123_2195269_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_004151651.1|2195269_2195896_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	48.2	1.1e-52
WP_002894369.1|2195880_2197104_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	34.1	4.1e-62
>prophage 163
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2200239	2202310	5547427		Bacillus_virus(50.0%)	2	NA	NA
WP_002894398.1|2200239_2201805_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	6.4e-44
WP_002894401.1|2201881_2202310_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.0	7.4e-19
>prophage 164
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2206400	2207061	5547427		Morganella_phage(50.0%)	2	NA	NA
WP_002439184.1|2206400_2206610_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	1.2e-22
WP_002894459.1|2206677_2207061_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	6.8e-24
>prophage 165
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2211939	2214426	5547427		Stx2-converting_phage(50.0%)	2	NA	NA
WP_002894539.1|2211939_2213139_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.0	6.5e-105
WP_004147579.1|2213277_2214426_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.1e-08
>prophage 166
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2221470	2229436	5547427	tRNA	Staphylococcus_phage(33.33%)	5	NA	NA
WP_002894696.1|2221470_2224053_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	5.2e-184
WP_002894699.1|2224279_2224762_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_002894701.1|2224807_2226601_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	35.9	9.6e-28
WP_002894704.1|2226666_2228337_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_002894706.1|2228710_2229436_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	1.2e-29
>prophage 167
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2235440	2236487	5547427		Pseudomonas_phage(100.0%)	1	NA	NA
WP_002894727.1|2235440_2236487_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	5.4e-47
>prophage 168
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2240527	2242192	5547427		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002894734.1|2240527_2242192_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.7	7.2e-86
>prophage 169
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2246945	2250747	5547427	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_004147599.1|2246945_2248901_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	6.4e-09
WP_002894753.1|2249079_2250747_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	93.5	0.0e+00
>prophage 170
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2255435	2256209	5547427		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004152229.1|2255435_2256209_-	esterase	NA	A0A286MQ79	Mycobacterium_phage	29.7	2.9e-05
>prophage 171
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2263035	2270465	5547427		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_004152227.1|2263035_2265084_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.3	6.0e-26
WP_004152226.1|2265104_2266784_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_020323459.1|2266783_2266873_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_004142243.1|2267179_2267389_+	DUF2517 family protein	NA	NA	NA	NA	NA
WP_004152225.1|2267572_2269015_+	deoxyribodipyrimidine photo-lyase	NA	F2Y1V1	Organic_Lake_phycodnavirus	33.1	1.1e-55
WP_004199663.1|2268986_2270465_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	29.3	6.5e-46
>prophage 172
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2276274	2277066	5547427		Kaumoebavirus(100.0%)	1	NA	NA
WP_002894935.1|2276274_2277066_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.2	2.1e-11
>prophage 173
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2301167	2304678	5547427		Vibriophage(33.33%)	4	NA	NA
WP_004151689.1|2301167_2301887_+	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	34.6	2.0e-24
WP_004147641.1|2301883_2302828_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.4	3.4e-24
WP_002895084.1|2302945_2303311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002895086.1|2303625_2304678_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.0	1.2e-81
>prophage 174
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2309039	2315562	5547427		Tupanvirus(33.33%)	7	NA	NA
WP_002895150.1|2309039_2310056_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.4	6.8e-79
WP_002895152.1|2310265_2311738_-	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	28.5	2.0e-10
WP_002895154.1|2311805_2312594_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002895156.1|2312746_2312896_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_004151692.1|2313038_2313812_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002895159.1|2313811_2314501_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002895161.1|2314503_2315562_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.2	1.5e-17
>prophage 175
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2320408	2321143	5547427		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004151694.1|2320408_2321143_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.3	1.8e-49
>prophage 176
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2331235	2336858	5547427		Catovirus(50.0%)	4	NA	NA
WP_002895420.1|2331235_2332762_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.0	2.9e-81
WP_004147672.1|2332860_2334243_+	amino acid permease	NA	NA	NA	NA	NA
WP_002895575.1|2335021_2335498_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_002895578.1|2335568_2336858_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	3.8e-18
>prophage 177
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2340661	2341384	5547427		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_004152853.1|2340661_2341384_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	2.9e-07
>prophage 178
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2347881	2348787	5547427		Streptococcus_phage(100.0%)	1	NA	NA
WP_002895662.1|2347881_2348787_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.2	5.7e-29
>prophage 179
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2358954	2360694	5547427		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_002895741.1|2358954_2360694_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	4.3e-17
>prophage 180
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2365899	2373864	5547427		Micromonas_pusilla_virus(20.0%)	8	NA	NA
WP_002895753.1|2365899_2366745_+	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	30.3	3.1e-08
WP_002895757.1|2366744_2367737_+	transketolase family protein	NA	NA	NA	NA	NA
WP_004151702.1|2367951_2369307_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	8.3e-48
WP_002895819.1|2369494_2371663_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.4	4.4e-43
WP_002895821.1|2371692_2372661_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_002895822.1|2372770_2373031_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_002895824.1|2373316_2373583_-	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	52.3	1.6e-16
WP_004176771.1|2373603_2373864_-	DUF1471 domain-containing protein	NA	A0A1B2IB27	Erwinia_phage	47.9	9.7e-06
>prophage 181
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2377938	2383090	5547427		Planktothrix_phage(33.33%)	6	NA	NA
WP_004142040.1|2377938_2378661_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	3.3e-35
WP_002895837.1|2378657_2379317_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_002895839.1|2379442_2380189_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_002895841.1|2380597_2381101_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222Z0F3	Streptomyces_phage	47.6	9.3e-05
WP_002895842.1|2381338_2382226_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_002895845.1|2382577_2383090_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.7e-14
>prophage 182
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2387091	2388468	5547427		Pandoravirus(100.0%)	1	NA	NA
WP_002895865.1|2387091_2388468_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	23.6	4.2e-23
>prophage 183
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2391477	2393070	5547427		Tupanvirus(100.0%)	1	NA	NA
WP_002895876.1|2391477_2393070_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	5.0e-60
>prophage 184
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2401049	2403482	5547427		Bacteriophage(100.0%)	1	NA	NA
WP_002895891.1|2401049_2403482_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A2K8HAT8	Bacteriophage	47.4	8.0e-09
>prophage 185
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2407725	2409585	5547427		Planktothrix_phage(100.0%)	1	NA	NA
WP_004151710.1|2407725_2409585_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.2	6.3e-14
>prophage 186
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2421290	2423290	5547427		Stx2-converting_phage(50.0%)	2	NA	NA
WP_004151716.1|2421290_2422493_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.6	5.0e-97
WP_004151717.1|2422531_2423290_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.6	2.4e-12
>prophage 187
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2428365	2479851	5547427	capsid,portal,integrase,head,tail,lysis,plate,terminase	Salmonella_phage(75.56%)	61	2428273:2428291	2465773:2465791
2428273:2428291	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_014342959.1|2428365_2429346_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
WP_004178082.1|2429833_2431321_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004150866.1|2431419_2432364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|2432375_2433254_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_000188448.1|2433399_2433621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|2433653_2434163_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956179.1|2434170_2434371_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000963473.1|2434334_2434676_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_004150864.1|2434743_2434977_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000752622.1|2434976_2435204_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150863.1|2435200_2436058_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_004150862.1|2436054_2438469_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001154434.1|2438622_2438811_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|2438821_2439055_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|2439169_2439847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|2440122_2441865_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|2441926_2442952_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|2442951_2444718_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|2444860_2445694_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|2445710_2446769_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|2446772_2447423_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|2447518_2447983_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|2447982_2448186_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|2448189_2448405_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|2448385_2448895_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|2448899_2449283_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|2449279_2449708_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896170.1|2449694_2449841_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896172.1|2449803_2450235_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|2450227_2450674_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004150857.1|2450670_2451363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|2451457_2452030_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_032441567.1|2452026_2452389_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
WP_002896182.1|2452375_2453284_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|2453276_2453876_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_019724930.1|2456094_2456829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171482189.1|2457189_2457564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896188.1|2457560_2457764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|2457793_2458870_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|2459008_2460181_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|2460190_2460706_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|2460758_2461058_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|2461072_2461192_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_014342962.1|2461418_2463812_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
WP_002896224.1|2463808_2464294_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|2464290_2465391_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|2465482_2465701_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_004179131.1|2465920_2467606_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
2465773:2465791	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_002896351.1|2467872_2468256_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_002896352.1|2468262_2468526_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896354.1|2468728_2469016_+	YbjC family protein	NA	NA	NA	NA	NA
WP_002896363.1|2469837_2470740_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896365.1|2470828_2471308_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896368.1|2471656_2472769_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896370.1|2472932_2474066_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896371.1|2474076_2475030_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896372.1|2475026_2475872_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896376.1|2475929_2476418_+	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896378.1|2476459_2477587_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896380.1|2477665_2478382_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896382.1|2478378_2479851_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
>prophage 188
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2482951	2487301	5547427		Planktothrix_phage(50.0%)	4	NA	NA
WP_032419144.1|2482951_2483680_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896394.1|2483906_2484422_-	lipoprotein	NA	NA	NA	NA	NA
WP_004150851.1|2485299_2486439_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896397.1|2486470_2487301_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
>prophage 189
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2500117	2530248	5547427	tRNA,protease	uncultured_Mediterranean_phage(13.33%)	21	NA	NA
WP_002896440.1|2500117_2501233_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|2501229_2503170_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|2503246_2503468_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|2503793_2504111_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|2504141_2506421_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|2506541_2506760_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|2507113_2507815_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004150847.1|2507859_2509581_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898017.1|2509581_2511348_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_002898019.1|2511462_2512431_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_000228469.1|2512963_2513458_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004150846.1|2513593_2517847_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_002898132.1|2517969_2518581_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_002898137.1|2518589_2519933_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898139.1|2520023_2521316_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898141.1|2521516_2523955_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.2	2.8e-219
WP_004150845.1|2523965_2524583_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
WP_004150844.1|2524584_2525448_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_004150843.1|2525722_2526871_+	MFS transporter	NA	NA	NA	NA	NA
WP_002898145.1|2527033_2527774_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.4e-20
WP_002898148.1|2527965_2530248_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	8.4e-162
>prophage 190
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2534298	2535387	5547427		Streptococcus_phage(100.0%)	1	NA	NA
WP_002898155.1|2534298_2535387_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	1.0e-80
>prophage 191
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2539560	2544103	5547427		Bacillus_phage(100.0%)	3	NA	NA
WP_002898165.1|2539560_2539848_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.2e-10
WP_002898168.1|2540053_2542318_+	ComEC family protein	NA	NA	NA	NA	NA
WP_002898170.1|2542354_2544103_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	4.6e-59
>prophage 192
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2563136	2564537	5547427	tRNA	Bandra_megavirus(100.0%)	1	NA	NA
WP_002898206.1|2563136_2564537_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.8	1.0e-80
>prophage 193
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2570599	2575722	5547427		Agrobacterium_phage(33.33%)	3	NA	NA
WP_002898217.1|2570599_2571802_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.5	5.1e-41
WP_002898220.1|2572128_2574744_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	1.7e-20
WP_004150838.1|2574948_2575722_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	2.9e-29
>prophage 194
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2584488	2586396	5547427		Tupanvirus(100.0%)	1	NA	NA
WP_004150837.1|2584488_2586396_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	2.1e-49
>prophage 195
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2599088	2601143	5547427		Bacillus_phage(100.0%)	1	NA	NA
WP_002898429.1|2599088_2601143_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.0	1.8e-14
>prophage 196
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2606085	2606745	5547427	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002898458.1|2606085_2606745_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
>prophage 197
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2630883	2634402	5547427		Enterobacteria_phage(100.0%)	4	NA	NA
WP_002898708.1|2630883_2631057_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
WP_002898712.1|2631266_2632157_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002898810.1|2632563_2633886_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.6	1.8e-201
WP_002898812.1|2633907_2634402_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	75.0	6.9e-37
>prophage 198
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2651224	2652013	5547427		Cronobacter_phage(100.0%)	1	NA	NA
WP_002898923.1|2651224_2652013_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.6	6.4e-93
>prophage 199
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2660114	2660642	5547427		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
WP_002898953.1|2660114_2660642_+	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.3	1.3e-28
>prophage 200
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2668993	2669914	5547427		Morganella_phage(100.0%)	1	NA	NA
WP_004150825.1|2668993_2669914_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.9	5.6e-56
>prophage 201
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2673155	2673407	5547427		Salmonella_phage(100.0%)	1	NA	NA
WP_002898994.1|2673155_2673407_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	5.1e-12
>prophage 202
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2692562	2693744	5547427		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_002899294.1|2692562_2693297_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.0e-15
WP_000103754.1|2693507_2693744_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 203
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2697023	2697665	5547427		Pseudomonas_phage(100.0%)	1	NA	NA
WP_002900674.1|2697023_2697665_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	37.0	3.8e-27
>prophage 204
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2717389	2723455	5547427		Planktothrix_phage(33.33%)	6	NA	NA
WP_002900798.1|2717389_2718091_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.4	7.8e-34
WP_002900801.1|2718090_2719335_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_004150816.1|2719383_2720295_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_004176563.1|2720309_2721140_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	5.3e-21
WP_002900906.1|2721230_2721575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150815.1|2721826_2723455_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	1.5e-27
>prophage 205
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2727887	2729024	5547427		Bacillus_virus(100.0%)	1	NA	NA
WP_004150811.1|2727887_2729024_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.0	2.6e-31
>prophage 206
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2735589	2838525	5547427	capsid,portal,tRNA,integrase,head,holin,tail,terminase	Klebsiella_phage(39.22%)	112	2733957:2733971	2792077:2792091
2733957:2733971	attL	GGTGACGCAGCAGGG	NA	NA	NA	NA
WP_004150804.1|2735589_2736960_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.6e-107
WP_004140557.1|2736963_2737605_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_004150803.1|2737659_2738766_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004150802.1|2738822_2739281_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150801.1|2739297_2739948_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|2740188_2741439_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_032418030.1|2741556_2742684_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	58.4	4.4e-119
WP_012542206.1|2742664_2742910_-	excisionase	NA	NA	NA	NA	NA
WP_062954978.1|2742962_2745101_-	exonuclease	NA	S4TNL0	Salmonella_phage	42.7	5.6e-99
WP_014228879.1|2745242_2745587_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_023279538.1|2745629_2745824_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_040234937.1|2746214_2746529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077257742.1|2746850_2747288_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
WP_071561166.1|2747376_2747601_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
WP_046622349.1|2747603_2748158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072353967.1|2748202_2749222_+	helix-turn-helix domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.1e-31
WP_047667474.1|2749214_2749679_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
WP_032443841.1|2749692_2750133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062954977.1|2750481_2751873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062954989.1|2751961_2752831_-	bacteriophage abortive infection AbiH family protein	NA	NA	NA	NA	NA
WP_062954976.1|2753182_2753896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062954975.1|2754069_2755431_+	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_004178082.1|2756268_2757756_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_025368263.1|2757834_2758068_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
WP_071531363.1|2758130_2758370_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	58.6	1.9e-16
WP_025861428.1|2758410_2758803_+	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_110437844.1|2759002_2760034_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.3	1.8e-95
WP_025861432.1|2760050_2760653_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
WP_004147997.1|2760896_2761100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004147999.1|2761837_2761987_-	small membrane protein	NA	NA	NA	NA	NA
WP_016160648.1|2762904_2763120_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_032432826.1|2763119_2763617_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
WP_016160650.1|2763613_2763964_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_049115059.1|2764913_2765351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032749552.1|2765389_2765614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162838183.1|2765792_2765957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|2765940_2766303_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_023297386.1|2766254_2766578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014907818.1|2766574_2767006_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_012542168.1|2767254_2767689_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_021462603.1|2767688_2769410_+|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
WP_017898992.1|2769403_2769583_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_023279520.1|2769582_2770842_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
WP_014907815.1|2770878_2771799_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_023328094.1|2771876_2773163_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
WP_049010370.1|2773221_2773482_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
WP_020317538.1|2773462_2773780_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_023328092.1|2773776_2774115_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
WP_017880258.1|2774095_2774485_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_168895379.1|2774490_2774883_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	93.8	7.1e-61
WP_023328090.1|2774914_2775376_+	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_014228914.1|2775433_2775799_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_023328089.1|2776031_2779367_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
WP_023328088.1|2779366_2779705_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
WP_023328087.1|2779701_2780457_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
WP_047666389.1|2780458_2781169_+	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
WP_047666390.1|2781210_2781633_+	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
WP_023328085.1|2781659_2782253_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
WP_062955111.1|2782315_2795020_+	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
2792077:2792091	attR	GGTGACGCAGCAGGG	NA	NA	NA	NA
WP_023328083.1|2795088_2796585_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
WP_004892953.1|2796739_2796892_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_004150799.1|2797164_2797878_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150798.1|2797874_2798267_-	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150797.1|2798259_2798583_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004225560.1|2798701_2798878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004140530.1|2799019_2799247_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004140529.1|2799359_2800553_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004150795.1|2801174_2801360_+	general stress protein	NA	NA	NA	NA	NA
WP_004150794.1|2801450_2801945_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140514.1|2801971_2802478_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140512.1|2802494_2803382_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004150793.1|2803437_2804844_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140509.1|2804840_2805851_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140506.1|2805966_2806164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|2806730_2807363_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140501.1|2807402_2807582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|2807979_2808666_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004150789.1|2808778_2808943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004140497.1|2808976_2810485_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150788.1|2810605_2811496_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004150787.1|2811502_2813287_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150785.1|2813360_2814569_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150784.1|2814871_2815915_+	type II asparaginase	NA	NA	NA	NA	NA
WP_004148038.1|2816576_2817491_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150783.1|2817580_2818219_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004140489.1|2818349_2818613_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|2818672_2818798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099119317.1|2818915_2818990_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|2818989_2819091_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004150781.1|2819148_2820162_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150780.1|2820462_2820702_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_014343000.1|2820691_2821030_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_004150778.1|2821034_2821544_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004140471.1|2821689_2822382_+	CTP synthase	NA	NA	NA	NA	NA
WP_014343001.1|2822413_2823589_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140469.1|2823696_2824491_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901080.1|2824474_2824921_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901088.1|2825037_2825538_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_004198512.1|2825784_2826921_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_002901096.1|2827091_2827334_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	72.2	4.1e-27
WP_004178082.1|2827948_2829436_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901192.1|2829514_2829934_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	5.5e-35
WP_004152360.1|2829936_2831202_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	79.6	7.6e-197
WP_004140447.1|2831208_2832114_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002901225.1|2832280_2833030_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.1	4.3e-14
WP_004152361.1|2833026_2834244_-	MFS transporter	NA	NA	NA	NA	NA
WP_004152362.1|2834419_2835301_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004220356.1|2835371_2835491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002901229.1|2835558_2835870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002901230.1|2835991_2836474_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	39.1	1.6e-17
WP_002901231.1|2836632_2837196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152363.1|2837241_2838525_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.7e-10
>prophage 207
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2846338	2847592	5547427		Artogeia_rapae_granulovirus(100.0%)	1	NA	NA
WP_002901255.1|2846338_2847592_-	glycoside hydrolase family 18 protein	NA	D2J4H7	Artogeia_rapae_granulovirus	25.6	2.6e-24
>prophage 208
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2853284	2857343	5547427		Staphylococcus_phage(50.0%)	4	NA	NA
WP_002901272.1|2853284_2854268_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.1	1.5e-06
WP_002901274.1|2854405_2855164_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002901278.1|2855305_2856664_+	MFS transporter	NA	NA	NA	NA	NA
WP_002901282.1|2856701_2857343_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	37.1	3.2e-18
>prophage 209
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2861217	2867231	5547427	transposase	Bacillus_phage(50.0%)	4	NA	NA
WP_085955203.1|2861217_2862580_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
WP_002901387.1|2863264_2864011_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002901388.1|2864236_2865280_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_002901390.1|2865284_2867231_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.3	8.2e-41
>prophage 210
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2872533	2873166	5547427		Bacillus_phage(100.0%)	1	NA	NA
WP_004151926.1|2872533_2873166_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.3	1.3e-08
>prophage 211
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2879223	2880444	5547427		Klosneuvirus(100.0%)	1	NA	NA
WP_002901489.1|2879223_2880444_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	8.0e-26
>prophage 212
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2887127	2887955	5547427		Bacillus_virus(100.0%)	1	NA	NA
WP_004151921.1|2887127_2887955_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.5	2.7e-70
>prophage 213
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2894219	2899953	5547427		Tupanvirus(50.0%)	5	NA	NA
WP_002901554.1|2894219_2896478_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.4	1.0e-143
WP_004140343.1|2896590_2896923_+	cell division activator CedA	NA	NA	NA	NA	NA
WP_004151918.1|2896982_2898374_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_002901611.1|2898509_2899100_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002901621.1|2899191_2899953_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	1.8e-15
>prophage 214
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2907247	2907925	5547427		Cyanophage(100.0%)	1	NA	NA
WP_004151914.1|2907247_2907925_-	PKHD-type hydroxylase YbiX	NA	A0A127KM56	Cyanophage	33.8	3.3e-21
>prophage 215
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2920169	2923127	5547427		Acinetobacter_phage(100.0%)	2	NA	NA
WP_002901733.1|2920169_2921528_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.4	3.3e-36
WP_004148109.1|2921531_2923127_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.5	2.8e-47
>prophage 216
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	2930246	2985353	5547427	holin,integrase,transposase,protease	Enterobacteria_phage(28.57%)	64	2945188:2945203	2968027:2968042
WP_002901754.1|2930246_2931008_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	1.6e-08
WP_004148112.1|2931002_2931218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002901758.1|2931262_2932309_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_002901761.1|2932356_2932608_-	YciN family protein	NA	NA	NA	NA	NA
WP_002901763.1|2933014_2935612_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
WP_002901772.1|2935957_2936932_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_002901776.1|2937177_2937345_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_002901777.1|2937733_2940406_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_002901778.1|2940452_2941055_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
WP_002901779.1|2941218_2941986_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_002901780.1|2942121_2942430_+	LapA family protein	NA	NA	NA	NA	NA
WP_002901781.1|2942436_2943606_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_004151907.1|2943797_2944535_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_002901782.1|2944534_2944861_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_002901783.1|2944992_2945211_-	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
2945188:2945203	attL	CATTTTTTTGCTCGTT	NA	NA	NA	NA
WP_002901785.1|2945486_2946236_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002901786.1|2946307_2946487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002901787.1|2946645_2948580_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
WP_004151905.1|2948661_2949819_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004140277.1|2950009_2950798_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004152967.1|2950996_2951539_-	HutD family protein	NA	NA	NA	NA	NA
WP_004151902.1|2951786_2953166_+	cytosine permease	NA	NA	NA	NA	NA
WP_004140269.1|2953210_2954020_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|2954021_2955014_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|2955013_2955904_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004151900.1|2956050_2957268_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	8.6e-121
WP_004151899.1|2957475_2958138_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151898.1|2958134_2958563_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004201102.1|2958559_2959240_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_088224434.1|2959241_2959529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201103.1|2959525_2960371_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_004201105.1|2960386_2960671_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004135674.1|2960759_2960954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004219883.1|2960946_2961072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201108.1|2961382_2961586_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004201109.1|2961667_2962744_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201113.1|2963031_2963730_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_004201115.1|2963841_2964069_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_001548453.1|2964109_2964331_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201117.1|2964416_2965277_+	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_004201118.1|2965273_2966122_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004218528.1|2966118_2966421_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004196831.1|2966476_2966722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218530.1|2966929_2967958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243011.1|2968067_2968346_+	hypothetical protein	NA	NA	NA	NA	NA
2968027:2968042	attR	AACGAGCAAAAAAATG	NA	NA	NA	NA
WP_004218531.1|2968478_2968946_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004243010.1|2968926_2969094_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218532.1|2969090_2969759_+	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004218533.1|2969751_2970390_+	recombination protein NinG	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218534.1|2970386_2970527_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004232548.1|2970526_2971216_+	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_049106548.1|2971439_2972486_+|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	22.9	1.0e-05
WP_024940884.1|2972964_2973264_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_004218565.1|2973260_2973800_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_062955100.1|2973796_2974084_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	95.4	4.4e-36
WP_001067855.1|2974120_2974825_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001261740.1|2975806_2976598_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|2976761_2977109_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001067855.1|2977724_2978429_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004178082.1|2980338_2981826_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901812.1|2981905_2982325_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_002901813.1|2982326_2983592_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_071531199.1|2983667_2984495_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901815.1|2984681_2985353_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
>prophage 217
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3015358	3089934	5547427	integrase,holin,transposase,plate,terminase	uncultured_Caudovirales_phage(32.69%)	87	3016367:3016381	3025307:3025321
WP_004152141.1|3015358_3016228_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
WP_004218009.1|3016252_3016390_-	glycosyl hydrolase family 2	NA	NA	NA	NA	NA
3016367:3016381	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004176439.1|3016774_3016963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152143.1|3017263_3018178_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152144.1|3018286_3019048_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|3019264_3020797_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|3020995_3021544_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|3021740_3022922_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|3022902_3023145_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004198245.1|3023104_3023251_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_014343018.1|3023323_3023557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152150.1|3023799_3024012_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152151.1|3024008_3024233_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|3024222_3024933_-	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|3024938_3025457_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
3025307:3025321	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|3025561_3026389_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|3026385_3026580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|3026576_3027002_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|3026998_3027217_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152157.1|3027188_3027443_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152158.1|3027435_3027801_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|3027970_3028159_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|3028151_3028466_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|3028636_3029305_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|3029402_3029624_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|3030200_3031859_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|3031860_3032823_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|3032819_3033296_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|3033292_3034075_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004146526.1|3034480_3034729_+|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004152169.1|3034731_3035262_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|3035258_3035648_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|3035882_3036203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218030.1|3036568_3037057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152172.1|3037007_3038408_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|3038645_3040097_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|3040152_3040701_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|3040752_3041955_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|3041958_3042453_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|3042464_3043406_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|3043445_3043727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3043695_3044115_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|3044111_3044618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|3044617_3045004_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|3045098_3045539_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|3045542_3046688_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004199809.1|3046698_3047139_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152564.1|3047142_3047568_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|3047603_3047756_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|3047745_3049749_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152567.1|3049748_3050348_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004217362.1|3050423_3050651_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152569.1|3050653_3051676_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|3051675_3052017_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004199301.1|3052066_3052249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152571.1|3052291_3052858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|3052911_3053565_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|3053566_3053920_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|3053919_3055116_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|3055112_3055886_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152576.1|3055885_3056752_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152577.1|3056751_3056949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218487.1|3059299_3060028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171482183.1|3060395_3060770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902131.1|3060766_3060976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902133.1|3061080_3061365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902136.1|3061587_3061836_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_000019473.1|3062431_3063412_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_002902144.1|3063881_3064373_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002902148.1|3064415_3065960_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004218490.1|3065969_3067313_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004151603.1|3067309_3067999_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004151602.1|3067995_3069702_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002902160.1|3069706_3070198_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002902163.1|3070462_3073117_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_004228410.1|3073118_3075488_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
WP_002902169.1|3075488_3076268_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_002902172.1|3076331_3076862_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902174.1|3076930_3077461_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902176.1|3077528_3078059_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902178.1|3078127_3078658_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902180.1|3078725_3079256_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_004151601.1|3079243_3081661_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_002902252.1|3081705_3081963_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_002902254.1|3081959_3083099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151599.1|3083082_3086508_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004151598.1|3088179_3089934_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 218
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3104414	3105428	5547427		Planktothrix_phage(100.0%)	1	NA	NA
WP_004152912.1|3104414_3105428_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.1	1.7e-29
>prophage 219
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3113035	3120182	5547427	tRNA	Escherichia_phage(40.0%)	7	NA	NA
WP_002902419.1|3113035_3113779_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	3.5e-16
WP_004148192.1|3114058_3115042_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_004151591.1|3115567_3116941_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
WP_002902422.1|3116986_3117922_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
WP_004140161.1|3118155_3118590_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	50.7	3.2e-30
WP_002902432.1|3118671_3118884_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_002902433.1|3119027_3120182_-	porin OmpK37	NA	Q1MVN1	Enterobacteria_phage	58.9	4.8e-113
>prophage 220
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3125300	3126290	5547427		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002902515.1|3125300_3126290_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.9	2.5e-70
>prophage 221
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3152470	3157108	5547427		Catovirus(50.0%)	2	NA	NA
WP_004198150.1|3152470_3156373_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	30.0	8.4e-53
WP_004151576.1|3156433_3157108_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	52.5	4.6e-31
>prophage 222
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3165794	3167000	5547427		Klosneuvirus(100.0%)	1	NA	NA
WP_004151572.1|3165794_3167000_+	bifunctional succinylornithine transaminase/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.7	2.6e-21
>prophage 223
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3179174	3182702	5547427		Enterobacteria_phage(50.0%)	6	NA	NA
WP_002903231.1|3179174_3179567_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	38.5	2.3e-19
WP_002903233.1|3179817_3180051_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_002903234.1|3180047_3181256_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_002903236.1|3181359_3181713_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_004151567.1|3181949_3182429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151566.1|3182498_3182702_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	73.1	2.6e-22
>prophage 224
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3195522	3196824	5547427		Bacillus_phage(100.0%)	1	NA	NA
WP_004151564.1|3195522_3196824_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.9e-18
>prophage 225
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3208067	3208583	5547427		Streptococcus_phage(100.0%)	1	NA	NA
WP_002903396.1|3208067_3208583_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
>prophage 226
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3227928	3230706	5547427		Lactobacillus_phage(100.0%)	1	NA	NA
WP_004152245.1|3227928_3230706_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.1	6.2e-66
>prophage 227
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3240149	3241109	5547427		Salmonella_phage(100.0%)	1	NA	NA
WP_004148291.1|3240149_3241109_-	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
>prophage 228
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3258233	3260360	5547427		Escherichia_phage(100.0%)	3	NA	NA
WP_004152236.1|3258233_3258842_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.3	3.2e-23
WP_002903710.1|3258883_3259741_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.9	9.0e-24
WP_004152235.1|3259742_3260360_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
>prophage 229
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3265119	3269292	5547427		uncultured_virus(33.33%)	4	NA	NA
WP_004219442.1|3265119_3265482_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.9	1.6e-22
WP_002903724.1|3265595_3266879_+	MFS transporter	NA	NA	NA	NA	NA
WP_002903726.1|3267132_3268596_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.3	7.8e-44
WP_002903728.1|3268860_3269292_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	40.7	2.7e-21
>prophage 230
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3274430	3275105	5547427		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002903739.1|3274430_3275105_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	62.1	2.5e-82
>prophage 231
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3284248	3300143	5547427		Escherichia_phage(70.0%)	15	NA	NA
WP_002210516.1|3284248_3284869_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|3284861_3286127_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|3286138_3287041_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|3287301_3288063_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|3288083_3288944_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|3289241_3289502_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|3289588_3290677_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004151612.1|3290707_3291973_-	MFS transporter	NA	NA	NA	NA	NA
WP_004151613.1|3292027_3295135_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151614.1|3295331_3296396_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	44.5	2.0e-65
WP_002904139.1|3296650_3297091_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004205985.1|3297143_3297359_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_004198831.1|3297327_3298425_-	transcriptional regulator FtrA	NA	NA	NA	NA	NA
WP_002904247.1|3298492_3298891_+	rhodanese	NA	NA	NA	NA	NA
WP_002904248.1|3299039_3300143_+	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	48.9	3.1e-101
>prophage 232
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3304294	3305800	5547427		Brazilian_cedratvirus(50.0%)	2	NA	NA
WP_002904321.1|3304294_3305092_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.9	2.4e-10
WP_004151618.1|3305101_3305800_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.2e-15
>prophage 233
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3309046	3309421	5547427		Streptococcus_phage(100.0%)	1	NA	NA
WP_002904397.1|3309046_3309421_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	2.3e-08
>prophage 234
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3321369	3322131	5547427		Escherichia_phage(100.0%)	1	NA	NA
WP_002904489.1|3321369_3322131_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	36.2	2.7e-32
>prophage 235
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3327527	3328952	5547427		Bacillus_phage(100.0%)	1	NA	NA
WP_002904600.1|3327527_3328952_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.7	3.0e-16
>prophage 236
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3341986	3342778	5547427		Bacillus_virus(100.0%)	1	NA	NA
WP_004176216.1|3341986_3342778_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.0	1.6e-19
>prophage 237
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3353271	3354651	5547427		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004199850.1|3353271_3354651_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.6	9.1e-18
>prophage 238
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3380430	3381606	5547427		Streptococcus_phage(100.0%)	1	NA	NA
WP_004199865.1|3380430_3381606_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.1	6.1e-39
>prophage 239
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3388968	3390525	5547427		Catovirus(100.0%)	1	NA	NA
WP_004199868.1|3388968_3390525_-	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.2	1.5e-16
>prophage 240
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3397805	3398579	5547427		Escherichia_phage(100.0%)	1	NA	NA
WP_002904861.1|3397805_3398579_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.6	2.0e-22
>prophage 241
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3410869	3411388	5547427		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004199889.1|3410869_3411388_-	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	38.2	3.4e-26
>prophage 242
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3417913	3419176	5547427	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_000608644.1|3417913_3419176_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 243
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3427388	3428135	5547427		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004198552.1|3427388_3428135_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	2.3e-15
>prophage 244
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3442808	3443861	5547427		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004151868.1|3442808_3443861_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.6	1.2e-14
>prophage 245
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3459439	3460177	5547427		Planktothrix_phage(100.0%)	1	NA	NA
WP_004143660.1|3459439_3460177_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.9	5.1e-36
>prophage 246
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3487931	3489188	5547427		Bacillus_phage(100.0%)	1	NA	NA
WP_014343088.1|3487931_3489188_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.9	1.5e-19
>prophage 247
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3495134	3499252	5547427		Bacillus_virus(50.0%)	4	NA	NA
WP_004180001.1|3495134_3495863_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	9.6e-19
WP_004143673.1|3495859_3496600_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004199983.1|3496624_3497560_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004199985.1|3497866_3499252_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.0	7.4e-28
>prophage 248
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3503232	3505313	5547427		Bacillus_phage(100.0%)	2	NA	NA
WP_014343090.1|3503232_3504576_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	24.3	1.8e-10
WP_004199992.1|3504572_3505313_-	response regulator	NA	W8CYM9	Bacillus_phage	37.6	8.5e-31
>prophage 249
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3521835	3522516	5547427		Bacillus_virus(100.0%)	1	NA	NA
WP_002906011.1|3521835_3522516_-	MgtC family protein	NA	G3MA03	Bacillus_virus	41.9	2.1e-15
>prophage 250
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3528678	3531291	5547427		Rathayibacter_phage(100.0%)	1	NA	NA
WP_014343099.1|3528678_3531291_-	family 78 glycoside hydrolase catalytic domain	NA	A0A1P8VV88	Rathayibacter_phage	21.5	2.4e-11
>prophage 251
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3541318	3541723	5547427		Stx_converting_phage(100.0%)	1	NA	NA
WP_002906035.1|3541318_3541723_-	YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	41.6	2.0e-10
>prophage 252
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3546530	3548867	5547427		Mycobacterium_phage(50.0%)	3	NA	NA
WP_004143717.1|3546530_3546746_-	hypothetical protein	NA	H9NCK9	Mycobacterium_phage	48.0	9.4e-07
WP_004143718.1|3547111_3547297_-	general stress protein	NA	NA	NA	NA	NA
WP_004151242.1|3547952_3548867_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	58.6	1.4e-83
>prophage 253
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3555355	3560098	5547427		Tupanvirus(66.67%)	4	NA	NA
WP_004200033.1|3555355_3557071_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	24.0	4.7e-32
WP_019725529.1|3557107_3558061_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002906218.1|3558235_3558835_-	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	5.0e-21
WP_002906221.1|3559087_3560098_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.8	4.9e-29
>prophage 254
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3563686	3565303	5547427		Planktothrix_phage(100.0%)	1	NA	NA
WP_004200039.1|3563686_3565303_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	2.5e-19
>prophage 255
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3576574	3577348	5547427		Bacillus_phage(100.0%)	1	NA	NA
WP_004143751.1|3576574_3577348_-	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	W8CYX9	Bacillus_phage	48.5	3.8e-05
>prophage 256
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3583827	3585327	5547427		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004175980.1|3583827_3585327_-	efflux MFS transporter KmrA	NA	A0A0M3UL24	Mycobacterium_phage	29.3	7.8e-31
>prophage 257
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3591434	3592979	5547427		Escherichia_phage(100.0%)	1	NA	NA
WP_004200061.1|3591434_3592979_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.4e-19
>prophage 258
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3598621	3599326	5547427		Bacillus_virus(100.0%)	1	NA	NA
WP_014343115.1|3598621_3599326_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	9.6e-32
>prophage 259
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3608762	3609542	5547427		Bacillus_virus(100.0%)	1	NA	NA
WP_004200076.1|3608762_3609542_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.6e-19
>prophage 260
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3615480	3616032	5547427		Leuconostoc_phage(100.0%)	1	NA	NA
WP_004200078.1|3615480_3616032_-	hypothetical protein	NA	A0A097BYE2	Leuconostoc_phage	33.7	8.1e-10
>prophage 261
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3620597	3622703	5547427		Salmonella_phage(100.0%)	1	NA	NA
WP_004200083.1|3620597_3622703_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.6	1.6e-138
>prophage 262
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3638391	3639405	5547427		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004200094.1|3638391_3639405_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	56.4	2.1e-24
>prophage 263
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3646313	3648275	5547427		Phage_TP(100.0%)	1	NA	NA
WP_002907469.1|3646313_3648275_-	U32 family peptidase	NA	Q6DW11	Phage_TP	28.0	5.1e-22
>prophage 264
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3658707	3661348	5547427		Moumouvirus(100.0%)	2	NA	NA
WP_004200104.1|3658707_3659796_+	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	25.9	9.1e-05
WP_004200105.1|3659842_3661348_-	carboxylesterase/lipase family protein	NA	M1PNU1	Moumouvirus	38.5	2.5e-29
>prophage 265
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3668173	3670225	5547427		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_004189749.1|3668173_3669292_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.8	1.8e-32
WP_002907563.1|3669316_3669592_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_002907640.1|3669697_3670225_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	46.8	5.9e-18
>prophage 266
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3675776	3677147	5547427		Pandoravirus(100.0%)	1	NA	NA
WP_004180160.1|3675776_3677147_+	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	35.1	2.1e-67
>prophage 267
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3688402	3689677	5547427	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_002907740.1|3688402_3689677_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.0	1.1e-86
>prophage 268
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3693013	3694375	5547427		Bacillus_phage(100.0%)	1	NA	NA
WP_004200121.1|3693013_3694375_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.7	6.9e-18
>prophage 269
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3698181	3699669	5547427		Salmonella_phage(50.0%)	2	NA	NA
WP_004184268.1|3698181_3698703_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	58.0	2.3e-51
WP_004200125.1|3698772_3699669_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	28.7	2.3e-06
>prophage 270
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3703856	3704729	5547427		Bacillus_phage(100.0%)	1	NA	NA
WP_004151204.1|3703856_3704729_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	39.5	1.7e-17
>prophage 271
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3708000	3719042	5547427		Enterobacteria_phage(20.0%)	11	NA	NA
WP_002907778.1|3708000_3709026_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	30.9	1.2e-30
WP_002907780.1|3708952_3709957_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002907785.1|3710069_3711251_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_002907788.1|3711543_3712692_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	1.2e-84
WP_004200129.1|3712728_3713364_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	1.6e-22
WP_004200136.1|3713593_3714967_+	MdtK family multidrug efflux MATE transporter	NA	NA	NA	NA	NA
WP_004200137.1|3715142_3715550_+	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_004200138.1|3715689_3716268_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	35.5	5.9e-19
WP_072769241.1|3716947_3717175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065928302.1|3717171_3717633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004180176.1|3718157_3719042_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.3	4.3e-21
>prophage 272
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3724516	3725287	5547427		Escherichia_phage(100.0%)	1	NA	NA
WP_002907813.1|3724516_3725287_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.4	3.2e-12
>prophage 273
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3730471	3732420	5547427		Bacillus_virus(50.0%)	2	NA	NA
WP_004200151.1|3730471_3731452_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	9.0e-12
WP_004200153.1|3731448_3732420_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SJ29	Klosneuvirus	25.5	2.4e-09
>prophage 274
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3751340	3752171	5547427		Bacillus_virus(100.0%)	1	NA	NA
WP_004180245.1|3751340_3752171_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.4e-26
>prophage 275
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3769502	3774091	5547427	transposase	Leptospira_phage(50.0%)	2	NA	NA
WP_004200176.1|3769502_3772619_-	multidrug efflux RND transporter permease subunit KexD	NA	S5VTK5	Leptospira_phage	22.4	1.2e-54
WP_000019473.1|3773110_3774091_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 276
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3786749	3787373	5547427		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004200196.1|3786749_3787373_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	23.4	4.0e-05
>prophage 277
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3792230	3793301	5547427		Bacillus_virus(100.0%)	1	NA	NA
WP_004200198.1|3792230_3793301_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	4.1e-26
>prophage 278
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3812826	3817227	5547427		Planktothrix_phage(50.0%)	3	NA	NA
WP_004200218.1|3812826_3813648_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	6.6e-16
WP_004200219.1|3814153_3816226_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_002908439.1|3816453_3817227_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.2	3.1e-31
>prophage 279
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3827877	3829841	5547427		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_004200233.1|3827877_3828894_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.4	3.3e-41
WP_004200234.1|3828890_3829841_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.3	2.1e-34
>prophage 280
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3837278	3838028	5547427		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004200241.1|3837278_3838028_+	ABC transporter ATP-binding protein	NA	A0A2I4R674	Erysipelothrix_phage	29.4	2.8e-05
>prophage 281
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3847948	3851161	5547427		environmental_halophage(50.0%)	3	NA	NA
WP_062955033.1|3847948_3849169_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.3	2.6e-93
WP_002908869.1|3849165_3850440_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_002908876.1|3850414_3851161_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.5	3.0e-07
>prophage 282
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3865660	3866422	5547427		Indivirus(100.0%)	1	NA	NA
WP_004200259.1|3865660_3866422_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	1.8e-15
>prophage 283
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3876401	3884368	5547427		Hokovirus(25.0%)	8	NA	NA
WP_002909055.1|3876401_3878780_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	1.4e-172
WP_002909058.1|3878855_3878975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002909061.1|3879119_3879953_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_002909064.1|3880107_3881154_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	46.6	2.3e-82
WP_002909070.1|3881261_3881489_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_004184566.1|3881518_3882961_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	37.0	2.0e-55
WP_002909082.1|3883074_3883539_-	lipoprotein	NA	NA	NA	NA	NA
WP_004200263.1|3883618_3884368_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.4	8.4e-10
>prophage 284
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3891436	3898605	5547427	tRNA	Geobacillus_virus(25.0%)	8	NA	NA
WP_002909098.1|3891436_3891736_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_002909101.1|3891740_3894128_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002909105.1|3894143_3895127_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	4.9e-34
WP_001386830.1|3895265_3895310_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|3895433_3895790_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|3895840_3896038_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004189469.1|3896130_3896673_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	6.3e-15
WP_002910026.1|3896676_3898605_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.3e-128
>prophage 285
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3908280	3911178	5547427		Lactobacillus_phage(33.33%)	3	NA	NA
WP_002910080.1|3908280_3909108_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	3.9e-08
WP_002910083.1|3909163_3910168_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	29.6	2.6e-14
WP_004200274.1|3910164_3911178_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	3.8e-13
>prophage 286
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3919437	3925707	5547427		Citrobacter_phage(25.0%)	8	NA	NA
WP_002910100.1|3919437_3920055_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.2e-54
WP_004145401.1|3920062_3920194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910103.1|3920616_3921024_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_002910105.1|3921145_3922048_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	1.8e-59
WP_004175574.1|3922245_3923259_-	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	29.4	1.1e-07
WP_002910108.1|3923348_3924251_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_002910109.1|3924363_3924822_+	YchJ family protein	NA	NA	NA	NA	NA
WP_004151854.1|3924864_3925707_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	43.1	8.3e-14
>prophage 287
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3929720	3931256	5547427		Escherichia_phage(100.0%)	1	NA	NA
WP_002910193.1|3929720_3931256_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	2.8e-20
>prophage 288
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3947749	3948538	5547427		Bacillus_virus(100.0%)	1	NA	NA
WP_004200289.1|3947749_3948538_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	2.6e-30
>prophage 289
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3954050	3959764	5547427		Mythimna_unipuncta_granulovirus(33.33%)	7	NA	NA
WP_002910389.1|3954050_3954281_-	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	48.0	5.4e-08
WP_002910392.1|3954544_3955645_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_002910393.1|3955731_3956586_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.2	2.3e-48
WP_002910395.1|3956625_3957438_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004145428.1|3957441_3957834_-	SirB family protein	NA	NA	NA	NA	NA
WP_004180387.1|3957833_3958682_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002910403.1|3958681_3959764_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.9e-07
>prophage 290
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	3962976	3965728	5547427		Tupanvirus(50.0%)	2	NA	NA
WP_002910407.1|3962976_3963924_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004200291.1|3964048_3965728_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
>prophage 291
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4000213	4010957	5547427		Staphylococcus_phage(40.0%)	11	NA	NA
WP_014907357.1|4000213_4000912_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910657.1|4001102_4001585_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004152315.1|4001694_4002594_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004899032.1|4002568_4003378_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004175494.1|4003389_4004685_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
WP_004189341.1|4004988_4005915_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004189338.1|4006013_4006490_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004148802.1|4006539_4008183_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910720.1|4008466_4009360_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175491.1|4009365_4010085_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_004148803.1|4010081_4010957_-	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.5	1.5e-10
>prophage 292
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4014819	4017114	5547427		Tetraselmis_virus(100.0%)	1	NA	NA
WP_062955027.1|4014819_4017114_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	3.0e-159
>prophage 293
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4033235	4033847	5547427		Geobacillus_virus(100.0%)	1	NA	NA
WP_002910846.1|4033235_4033847_-	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
>prophage 294
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4049471	4056839	5547427	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
WP_002910904.1|4049471_4051157_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.7e-34
WP_002910905.1|4051362_4051944_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_004151443.1|4051982_4052678_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_004175456.1|4052823_4054734_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.0	1.1e-90
WP_002910910.1|4054864_4055209_+	RidA family protein	NA	NA	NA	NA	NA
WP_004145519.1|4055209_4055395_-	YoaH family protein	NA	NA	NA	NA	NA
WP_004189289.1|4055483_4056839_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	40.4	2.3e-42
>prophage 295
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4060747	4062307	5547427		Moraxella_phage(100.0%)	1	NA	NA
WP_004145524.1|4060747_4062307_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.0	1.1e-40
>prophage 296
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4069747	4072272	5547427	transposase	Morganella_phage(50.0%)	5	NA	NA
WP_001062678.1|4069747_4069957_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_071526670.1|4070039_4070114_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
WP_002911374.1|4070704_4070995_-	YebO family protein	NA	NA	NA	NA	NA
WP_110437854.1|4071069_4071168_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_000019445.1|4071291_4072272_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 297
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4076394	4078443	5547427		Moraxella_phage(100.0%)	1	NA	NA
WP_004145536.1|4076394_4078443_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	3.0e-86
>prophage 298
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4085950	4086604	5547427		Escherichia_phage(100.0%)	1	NA	NA
WP_004180432.1|4085950_4086604_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	8.0e-57
>prophage 299
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4090327	4091296	5547427		Pectobacterium_phage(50.0%)	2	NA	NA
WP_002911406.1|4090327_4090558_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	57.4	5.9e-15
WP_002911407.1|4090636_4091296_+	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	31.7	2.2e-14
>prophage 300
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4098721	4100197	5547427		Cyanophage(100.0%)	1	NA	NA
WP_002911427.1|4098721_4100197_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.2e-77
>prophage 301
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4104122	4120669	5547427	tRNA	Tupanvirus(25.0%)	18	NA	NA
WP_062955024.1|4104122_4105442_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	38.2	5.3e-15
WP_004180437.1|4105457_4106402_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_002911449.1|4106480_4107233_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.4	6.7e-15
WP_004212745.1|4107232_4108018_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_004148860.1|4108081_4109092_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	1.4e-07
WP_002911454.1|4109100_4109712_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002911456.1|4109791_4110313_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	3.4e-10
WP_002911459.1|4110347_4111088_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002911477.1|4111115_4111559_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002911479.1|4111560_4113348_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
WP_004145564.1|4113615_4114182_+	hydrolase	NA	NA	NA	NA	NA
WP_002911483.1|4114178_4114997_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
WP_002911484.1|4115049_4115445_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_002911486.1|4115484_4116228_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
WP_004151451.1|4116224_4117229_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_032438218.1|4117310_4118054_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002911491.1|4118130_4118700_-	VOC family protein	NA	NA	NA	NA	NA
WP_004151452.1|4118935_4120669_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
>prophage 302
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4127607	4129122	5547427		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002911516.1|4127607_4129122_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	5.7e-13
>prophage 303
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4145729	4146482	5547427		Bacillus_virus(100.0%)	1	NA	NA
WP_004151455.1|4145729_4146482_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	2.2e-26
>prophage 304
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4153083	4161527	5547427		Burkholderia_phage(40.0%)	8	NA	NA
WP_024622768.1|4153083_4154763_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	6.9e-20
WP_002911591.1|4154878_4155790_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_016529443.1|4155973_4156885_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_004200342.1|4156859_4157354_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	5.7e-31
WP_072353978.1|4157334_4158735_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	6.7e-101
WP_002911594.1|4158811_4159519_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_004151461.1|4159561_4159843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002911596.1|4160381_4161527_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
>prophage 305
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4178758	4203414	5547427	integrase	Bacillus_phage(40.0%)	8	4167206:4167220	4195595:4195609
4167206:4167220	attL	GCTCGCACTGGCGCA	NA	NA	NA	NA
WP_000059623.1|4178758_4180021_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.3	4.8e-74
WP_000703040.1|4180214_4181519_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_001286280.1|4181546_4182827_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_001446633.1|4182819_4184622_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.6	2.1e-22
WP_001327262.1|4184608_4186321_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.0	1.8e-31
WP_000140406.1|4186577_4187537_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_047669472.1|4187727_4193835_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
WP_047669470.1|4193922_4203414_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
4195595:4195609	attR	GCTCGCACTGGCGCA	NA	NA	NA	NA
>prophage 306
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4210981	4211167	5547427		Vibrio_phage(100.0%)	1	NA	NA
WP_000205185.1|4210981_4211167_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	42.1	5.6e-08
>prophage 307
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4221440	4221746	5547427		Klebsiella_phage(100.0%)	1	NA	NA
WP_001168332.1|4221440_4221746_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	41.8	4.9e-09
>prophage 308
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4225263	4226208	5547427		Caulobacter_phage(100.0%)	1	NA	NA
WP_000155898.1|4225263_4226208_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	40.8	1.2e-53
>prophage 309
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4236947	4237928	5547427	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000019473.1|4236947_4237928_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 310
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4241856	4242693	5547427		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004180471.1|4241856_4242693_-	alpha/beta hydrolase	NA	A0A2D1GKK1	Mycobacterium_phage	28.8	4.8e-14
>prophage 311
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4258120	4265220	5547427		Pseudomonas_phage(33.33%)	4	NA	NA
WP_004178082.1|4258120_4259608_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004153104.1|4260125_4261289_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	80.6	2.2e-182
WP_021313318.1|4261469_4262894_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_023278835.1|4263117_4265220_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.2	1.7e-63
>prophage 312
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4269727	4270627	5547427		Cellulophaga_phage(100.0%)	1	NA	NA
WP_002912152.1|4269727_4270627_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	1.4e-11
>prophage 313
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4282566	4298312	5547427		Escherichia_phage(33.33%)	15	NA	NA
WP_062955125.1|4282566_4283898_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	6.9e-15
WP_062955124.1|4283887_4284721_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015958692.1|4284749_4285580_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_015958693.1|4285666_4286221_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_048996045.1|4286235_4287126_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_063002077.1|4287157_4288027_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_073547076.1|4288040_4289105_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.6e-105
WP_062955151.1|4289944_4290949_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	4.0e-31
WP_016947628.1|4291349_4291469_+	small membrane protein	NA	NA	NA	NA	NA
WP_000704907.1|4291897_4293064_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_004175260.1|4293243_4293798_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_048996045.1|4293812_4294703_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_062956182.1|4294734_4295604_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	3.4e-111
WP_062955056.1|4295617_4296682_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	4.4e-105
WP_062955058.1|4296905_4298312_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
>prophage 314
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4302119	4304577	5547427		Catovirus(50.0%)	2	NA	NA
WP_062955066.1|4302119_4302890_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	34.1	5.2e-07
WP_062955068.1|4302921_4304577_-	hypothetical protein	NA	A0A0U3C9T3	Klebsiella_phage	32.6	2.6e-80
>prophage 315
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4314953	4321926	5547427		Bacillus_phage(25.0%)	5	NA	NA
WP_001741945.1|4314953_4315844_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.0	5.6e-45
WP_062955079.1|4316609_4318193_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	3.8e-36
WP_062955080.1|4318734_4320582_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_004151145.1|4320612_4321194_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
WP_002912442.1|4321284_4321926_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.0e-36
>prophage 316
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4339047	4345953	5547427	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_062955084.1|4339047_4340526_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|4340522_4341245_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|4341563_4342925_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004151134.1|4343167_4344064_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004899467.1|4344305_4345079_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004175147.1|4345089_4345953_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 317
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4354586	4355954	5547427		Micromonas_pusilla_virus(100.0%)	1	NA	NA
WP_032421574.1|4354586_4355954_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	28.3	4.3e-44
>prophage 318
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4372972	4380026	5547427	tRNA	Enterobacteria_phage(50.0%)	7	NA	NA
WP_002912753.1|4372972_4375006_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	8.9e-54
WP_002912756.1|4375120_4375591_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	74.4	6.6e-61
WP_002912758.1|4375638_4376358_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_002912760.1|4376351_4378040_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.1	5.5e-259
WP_002912762.1|4378269_4378383_+	protein YohO	NA	NA	NA	NA	NA
WP_004151128.1|4378357_4379095_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_020956604.1|4379078_4380026_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	6.9e-25
>prophage 319
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4386560	4387115	5547427		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002912829.1|4386560_4387115_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.8	1.3e-20
>prophage 320
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4403138	4404659	5547427		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002912876.1|4403138_4404659_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
>prophage 321
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4408423	4414137	5547427	transposase	Cellulophaga_phage(33.33%)	4	NA	NA
WP_004184878.1|4408423_4409092_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	3.4e-55
WP_004151123.1|4409452_4410286_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_021463900.1|4410356_4412330_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.5	4.8e-12
WP_087794312.1|4412773_4414137_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 322
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4418177	4419032	5547427		Catovirus(100.0%)	1	NA	NA
WP_002912937.1|4418177_4419032_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.2	1.5e-23
>prophage 323
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4424741	4432715	5547427		Serratia_phage(33.33%)	8	NA	NA
WP_014343350.1|4424741_4425428_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	41.3	2.1e-39
WP_004151121.1|4425959_4426214_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_002912951.1|4426361_4426934_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_002912952.1|4427004_4428195_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_032411974.1|4428402_4429869_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.2	4.2e-45
WP_032411976.1|4429990_4430968_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_002912965.1|4431005_4431719_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002912967.1|4432145_4432715_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.0	3.1e-12
>prophage 324
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4438470	4444557	5547427		Planktothrix_phage(33.33%)	5	NA	NA
WP_004175056.1|4438470_4440060_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	4.5e-21
WP_002912974.1|4440063_4440408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002912975.1|4440739_4441936_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.2	2.6e-21
WP_002912977.1|4441932_4442652_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_004144263.1|4442799_4444557_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	6.4e-101
>prophage 325
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4448793	4449801	5547427		Vibrio_phage(100.0%)	1	NA	NA
WP_004144267.1|4448793_4449801_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.8	2.4e-84
>prophage 326
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4456166	4457327	5547427		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_072159513.1|4456166_4457327_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.2	5.0e-78
>prophage 327
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4461247	4464666	5547427		Acanthamoeba_polyphaga_mimivirus(50.0%)	3	NA	NA
WP_062954992.1|4461247_4462312_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	52.9	2.0e-17
WP_062954994.1|4462385_4463438_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_062955002.1|4463541_4464666_-	porin OmpK36	NA	Q1MVN1	Enterobacteria_phage	59.8	4.1e-117
>prophage 328
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4468806	4480937	5547427		Pseudomonas_phage(33.33%)	7	NA	NA
WP_002913009.1|4468806_4471647_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.9	8.3e-42
WP_022644761.1|4471778_4474412_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.1	9.3e-96
WP_002913014.1|4474558_4475287_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_062955004.1|4475631_4477917_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.5	7.4e-283
WP_004140835.1|4478018_4479149_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.7	1.0e-176
WP_002913017.1|4479148_4479403_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	65.3	8.2e-26
WP_004214637.1|4479866_4480937_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	52.6	2.1e-09
>prophage 329
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4489559	4490765	5547427		Oenococcus_phage(100.0%)	1	NA	NA
WP_004175029.1|4489559_4490765_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.0	7.9e-26
>prophage 330
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4493881	4494835	5547427	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_002913072.1|4493881_4494835_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.1	1.1e-67
>prophage 331
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4522861	4523461	5547427		Salmonella_phage(100.0%)	1	NA	NA
WP_002913188.1|4522861_4523461_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	2.4e-07
>prophage 332
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4535863	4536637	5547427		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002913206.1|4535863_4536637_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.9e-09
>prophage 333
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4540928	4542446	5547427		Mollivirus(100.0%)	1	NA	NA
WP_002913213.1|4540928_4542446_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.6	1.0e-86
>prophage 334
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4548888	4550025	5547427		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002913228.1|4548888_4550025_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
>prophage 335
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4558507	4559593	5547427		Pandoravirus(100.0%)	1	NA	NA
WP_002913342.1|4558507_4559593_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
>prophage 336
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4568708	4573291	5547427		Enterobacteria_phage(25.0%)	5	NA	NA
WP_002913363.1|4568708_4569638_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.1	4.4e-133
WP_002913367.1|4570050_4570533_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_071177718.1|4570900_4571722_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.4e-05
WP_002913369.1|4571791_4572700_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	7.8e-10
WP_002913370.1|4572832_4573291_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	32.3	1.2e-11
>prophage 337
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4576561	4579008	5547427		Enterobacteria_phage(50.0%)	2	NA	NA
WP_004149230.1|4576561_4578259_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
WP_002913374.1|4578270_4579008_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
>prophage 338
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4593498	4603425	5547427		Lactobacillus_phage(25.0%)	9	NA	NA
WP_002913438.1|4593498_4594425_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.3	4.1e-06
WP_002913439.1|4594513_4595512_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_002913440.1|4595508_4595727_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_002913442.1|4595728_4597744_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.5	2.8e-145
WP_004151995.1|4597813_4598875_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_002913495.1|4599105_4599867_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_002913498.1|4600043_4601015_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	3.3e-75
WP_002913505.1|4601395_4601653_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_002913506.1|4601697_4603425_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.6	3.3e-17
>prophage 339
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4607033	4609158	5547427		Lactococcus_phage(50.0%)	2	NA	NA
WP_002913621.1|4607033_4607945_-	cysteine synthase CysM	NA	A0A1W6JHY1	Lactococcus_phage	40.3	2.8e-52
WP_002913623.1|4608063_4609158_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	1.6e-30
>prophage 340
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4612511	4616088	5547427		Pandoravirus(50.0%)	5	NA	NA
WP_004145614.1|4612511_4613411_-	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	32.6	3.8e-25
WP_002913630.1|4613505_4614081_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_002913635.1|4614142_4614592_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_002913637.1|4614578_4615004_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_002913639.1|4615215_4616088_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.2e-17
>prophage 341
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4647979	4731220	5547427	tRNA,integrase,holin,tail,transposase,protease,terminase	Salmonella_phage(33.9%)	86	4653621:4653638	4728659:4728676
WP_004152006.1|4647979_4649983_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_002913800.1|4649992_4650868_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_002913801.1|4650987_4651701_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
WP_002913802.1|4651916_4652951_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_002913803.1|4652967_4653846_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
4653621:4653638	attL	CAGCGATAACCGGAATAC	NA	NA	NA	NA
WP_002913804.1|4653999_4654566_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_002913805.1|4654569_4655040_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_002913806.1|4655101_4656163_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_004221267.1|4656217_4656334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002913807.1|4656385_4657849_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_002913810.1|4657858_4658218_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_002913812.1|4658345_4659257_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_020947395.1|4659253_4659955_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913824.1|4660053_4661340_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_002913827.1|4661435_4662062_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913829.1|4662279_4663713_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913833.1|4663722_4664616_-	ROK family protein	NA	NA	NA	NA	NA
WP_002913836.1|4664879_4665917_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_004152007.1|4665913_4666555_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
WP_002913838.1|4666735_4668796_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_002913839.1|4668799_4670332_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913841.1|4670385_4672614_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_004174861.1|4672984_4673158_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	78.8	1.4e-16
WP_004221278.1|4673254_4674166_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002913847.1|4674239_4675472_+	MFS transporter	NA	NA	NA	NA	NA
WP_004162150.1|4675765_4676944_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_004152009.1|4676927_4678796_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_062955008.1|4678982_4679483_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
WP_062955009.1|4679479_4680109_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_023339240.1|4680098_4680404_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_062955010.1|4680390_4680795_-	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
WP_077265603.1|4680881_4682198_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
WP_000608644.1|4683306_4684569_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_073547080.1|4685437_4686418_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
WP_153233543.1|4686399_4687665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062955131.1|4687705_4687969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062955133.1|4690796_4691093_+	hypothetical protein	NA	T1SA06	Salmonella_phage	63.9	6.9e-24
WP_071787028.1|4691191_4691344_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	2.5e-14
WP_062955135.1|4691569_4694326_-	hypothetical protein	NA	Q858F8	Salmonella_phage	95.4	0.0e+00
WP_062955136.1|4694325_4696236_-	hypothetical protein	NA	Q858F9	Salmonella_phage	82.7	5.4e-287
WP_062955137.1|4696235_4698770_-	hypothetical protein	NA	Q858G0	Salmonella_phage	84.1	0.0e+00
WP_032447858.1|4698780_4699320_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
WP_004152438.1|4699319_4699784_-	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_062955138.1|4699783_4702261_-	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
WP_062955139.1|4702260_4702866_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
WP_004152441.1|4702865_4703189_-	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_062955141.1|4703239_4703581_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
WP_020953461.1|4703591_4704029_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
WP_004200546.1|4704082_4705069_-	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_032441397.1|4705083_4705764_-	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
WP_004152446.1|4705766_4706063_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_032441398.1|4706059_4707742_-|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
WP_004141368.1|4707756_4707963_-	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_004200550.1|4708716_4709088_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
WP_062955142.1|4709131_4710607_-	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	6.4e-280
WP_032441400.1|4710603_4711188_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
WP_032418540.1|4711265_4711523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|4711923_4713411_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_023339258.1|4713507_4713846_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_032441458.1|4713838_4714042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050491799.1|4714041_4714662_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
WP_029602865.1|4714658_4714952_-	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_072200041.1|4714951_4715419_-	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
WP_032441401.1|4715712_4716357_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
WP_032441402.1|4716353_4716545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062955107.1|4716528_4716939_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
WP_048328152.1|4717131_4717479_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
WP_032418532.1|4717598_4718384_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_004207253.1|4718380_4719148_-	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152537.1|4719147_4719357_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004152538.1|4719503_4719737_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004144290.1|4719891_4720473_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004164037.1|4720693_4720843_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_004164029.1|4720839_4721139_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_062955106.1|4721135_4721957_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
WP_062955105.1|4721953_4722835_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
WP_062955104.1|4722883_4723132_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
WP_009485475.1|4723241_4723535_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_048264082.1|4723527_4723686_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
WP_062955103.1|4723682_4724345_+	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
WP_004197356.1|4724341_4724935_+	MT-A70 family protein	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
WP_063002073.1|4724931_4725174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062955102.1|4725116_4726367_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
WP_004151979.1|4726558_4728136_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004151980.1|4728203_4729670_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
4728659:4728676	attR	CAGCGATAACCGGAATAC	NA	NA	NA	NA
WP_004151981.1|4729828_4731220_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	6.3e-35
>prophage 342
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4741540	4741972	5547427		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_004144312.1|4741540_4741972_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 343
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4752484	4758805	5547427		Mycoplasma_phage(20.0%)	8	NA	NA
WP_002913953.1|4752484_4753771_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	9.9e-35
WP_002913954.1|4753841_4754042_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_002913956.1|4754043_4754379_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_004151987.1|4754380_4756231_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.5	1.9e-103
WP_002913974.1|4756246_4756762_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_002913979.1|4756836_4757160_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
WP_002913991.1|4757177_4757564_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_002913992.1|4757590_4758805_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.8	3.2e-35
>prophage 344
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4774052	4796120	5547427	tRNA	Bacillus_phage(25.0%)	19	NA	NA
WP_002914027.1|4774052_4775306_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	1.9e-99
WP_002914028.1|4775631_4776822_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914032.1|4776895_4777234_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_004149357.1|4777299_4778637_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	35.0	1.0e-10
WP_002914033.1|4778623_4779310_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_072353999.1|4779339_4780761_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	1.1e-13
WP_004185139.1|4781351_4785239_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	5.0e-130
WP_002914046.1|4785414_4787031_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_002914049.1|4787027_4787570_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	2.6e-05
WP_002914050.1|4787599_4788235_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_002914052.1|4788448_4789297_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002914053.1|4789353_4789614_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	6.5e-18
WP_004144351.1|4789626_4790007_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002914059.1|4790006_4790738_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_002914062.1|4790749_4791487_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_002914063.1|4791498_4792404_-	GTPase Era	NA	NA	NA	NA	NA
WP_002914065.1|4792400_4793081_-	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.6e-20
WP_002914067.1|4793330_4794305_-	signal peptidase I	NA	NA	NA	NA	NA
WP_002914069.1|4794320_4796120_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	5.5e-23
>prophage 345
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4801020	4883530	5547427	capsid,portal,tRNA,integrase,head,tail,lysis,transposase,plate,terminase	Salmonella_phage(69.23%)	89	4856898:4856914	4889209:4889225
WP_002914079.1|4801020_4801758_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|4801889_4803221_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|4803266_4803650_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|4803963_4804653_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|4804710_4805796_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|4805999_4806425_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|4806494_4807193_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_004188841.1|4807227_4809879_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|4809999_4811355_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|4811396_4811720_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914097.1|4811723_4813022_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_004150973.1|4818987_4821561_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914109.1|4821690_4822422_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|4822418_4823399_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|4823530_4824268_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|4824538_4824874_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|4824980_4825028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150975.1|4825128_4826289_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914112.1|4826285_4827158_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|4827220_4828342_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|4828351_4829422_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|4829764_4830274_+	YfiR family protein	NA	NA	NA	NA	NA
WP_002914116.1|4830266_4831490_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_002914117.1|4831503_4831986_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|4831994_4833365_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|4833421_4833880_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|4833999_4834347_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|4834386_4835154_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|4835185_4835734_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|4835752_4836001_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|4836260_4837625_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|4837788_4838580_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|4838599_4839886_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|4840005_4840596_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|4840720_4841599_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914159.1|4841685_4843347_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914160.1|4843494_4843836_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914161.1|4843902_4844193_-	RnfH family protein	NA	NA	NA	NA	NA
WP_004188817.1|4844182_4844659_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|4844769_4845252_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_004150980.1|4845855_4846233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150981.1|4846260_4846479_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150982.1|4846545_4847640_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150983.1|4847636_4848122_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_072093161.1|4848118_4850515_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
WP_002896220.1|4850741_4850861_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150985.1|4850875_4851175_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_004150986.1|4851227_4851743_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150987.1|4851752_4852925_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150988.1|4853073_4854147_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004200602.1|4854198_4855317_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150990.1|4855326_4857276_-	CotH kinase family protein	NA	Q6QI97	Burkholderia_phage	38.9	1.0e-06
4856898:4856914	attL	CCAGCTGCTGGCGCAGG	NA	NA	NA	NA
WP_004152935.1|4857277_4857949_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150992.1|4857941_4858850_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004150993.1|4858836_4859199_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150994.1|4859195_4859768_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150995.1|4859862_4860729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150996.1|4860751_4861198_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150997.1|4861190_4861613_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_072093160.1|4861575_4861734_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150998.1|4861708_4862137_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150999.1|4862133_4862517_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004151000.1|4862521_4863031_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004134639.1|4863011_4863227_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151001.1|4863230_4863434_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004151002.1|4863433_4863898_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004134644.1|4863993_4864647_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151003.1|4864650_4865703_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004151004.1|4865719_4866553_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_019405037.1|4866693_4868457_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151006.1|4868456_4869500_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_024940854.1|4869556_4869826_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151007.1|4870347_4871349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|4871348_4872428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151009.1|4872414_4873098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151010.1|4873193_4873427_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151011.1|4873438_4873627_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004178082.1|4873734_4875222_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151012.1|4875699_4878084_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151013.1|4878080_4878932_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151014.1|4878928_4879156_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151016.1|4879155_4879389_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004144796.1|4879456_4879795_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151017.1|4879758_4879959_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004151018.1|4879966_4880476_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_001397669.1|4880508_4880751_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151019.1|4880873_4881503_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_062955148.1|4881505_4882504_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
WP_000019473.1|4882549_4883530_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
4889209:4889225	attR	CCTGCGCCAGCAGCTGG	NA	NA	NA	NA
>prophage 346
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4887670	4889191	5547427		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004151026.1|4887670_4889191_+	amino acid ABC transporter permease/ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	1.7e-17
>prophage 347
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4911349	4912252	5547427		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002914281.1|4911349_4912252_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
>prophage 348
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4917433	4922732	5547427		Lactobacillus_phage(25.0%)	5	NA	NA
WP_002914320.1|4917433_4917679_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	41.1	5.5e-11
WP_002914321.1|4917675_4918086_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_002914325.1|4918058_4920200_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	46.4	2.5e-184
WP_002914327.1|4920210_4921173_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.2	1.5e-131
WP_002914328.1|4921529_4922732_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.8	1.2e-26
>prophage 349
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4937450	4945688	5547427	tRNA	Vibrio_phage(20.0%)	8	NA	NA
WP_000906486.1|4937450_4937636_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_002914765.1|4937999_4940627_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	4.9e-81
WP_002914767.1|4940877_4941378_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_002914769.1|4941445_4942504_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	2.3e-114
WP_002914771.1|4942594_4943092_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.0	8.3e-30
WP_002914773.1|4943231_4944110_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002914775.1|4944117_4944981_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_004217109.1|4944977_4945688_-	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	29.3	2.4e-06
>prophage 350
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4951440	4952406	5547427		Tetraselmis_virus(100.0%)	1	NA	NA
WP_002914818.1|4951440_4952406_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.6	1.6e-37
>prophage 351
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4979347	4980748	5547427		Pandoravirus(100.0%)	1	NA	NA
WP_002914970.1|4979347_4980748_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.3	5.2e-45
>prophage 352
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	4991113	4991935	5547427		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002915033.1|4991113_4991935_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	2.1e-14
>prophage 353
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5003679	5008843	5547427		Cedratvirus(50.0%)	5	NA	NA
WP_004151058.1|5003679_5004459_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.4	1.2e-11
WP_002915094.1|5004737_5005220_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004188736.1|5005231_5005681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002915096.1|5005665_5006013_+	DUF1493 family protein	NA	NA	NA	NA	NA
WP_004151059.1|5006281_5008843_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	1.3e-30
>prophage 354
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5012312	5018731	5547427		uncultured_Mediterranean_phage(40.0%)	7	NA	NA
WP_004151061.1|5012312_5013200_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.3	2.5e-05
WP_004151062.1|5013308_5014511_+	MFS transporter	NA	NA	NA	NA	NA
WP_002915104.1|5014507_5014885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002915106.1|5014937_5015930_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	4.6e-32
WP_002915107.1|5016087_5017224_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
WP_002915108.1|5017349_5017976_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	6.3e-35
WP_002915109.1|5017969_5018731_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	1.7e-58
>prophage 355
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5021801	5023834	5547427		Tupanvirus(50.0%)	2	NA	NA
WP_002915158.1|5021801_5022407_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.6	6.1e-27
WP_002915159.1|5022406_5023834_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.9	1.4e-34
>prophage 356
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5032600	5037937	5547427		Vibrio_phage(33.33%)	4	NA	NA
WP_002915210.1|5032600_5033272_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	32.1	2.5e-13
WP_002915212.1|5033746_5034856_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002915213.1|5034919_5036218_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	57.5	7.5e-131
WP_002915214.1|5036299_5037937_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	1.8e-153
>prophage 357
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5041479	5046945	5547427		Erysipelothrix_phage(33.33%)	3	NA	NA
WP_002915220.1|5041479_5042784_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	1.7e-34
WP_004151066.1|5042897_5045648_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	28.9	6.4e-47
WP_002915222.1|5045805_5046945_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.9	3.4e-47
>prophage 358
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5054359	5055205	5547427		Vibrio_phage(100.0%)	1	NA	NA
WP_002915255.1|5054359_5055205_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.4	1.9e-42
>prophage 359
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5065460	5066483	5547427		Bacillus_phage(100.0%)	1	NA	NA
WP_004151072.1|5065460_5066483_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	33.0	1.3e-13
>prophage 360
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5072887	5073643	5547427		Bacillus_phage(100.0%)	1	NA	NA
WP_004142871.1|5072887_5073643_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.6	1.7e-10
>prophage 361
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5085187	5087688	5547427	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_002915551.1|5085187_5086393_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.5	4.4e-69
WP_004151086.1|5086392_5086824_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_002915577.1|5086866_5087688_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	31.7	1.6e-14
>prophage 362
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5092634	5093459	5547427		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_002915614.1|5092634_5093459_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.3	4.3e-07
>prophage 363
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5126110	5137790	5547427		Deep-sea_thermophilic_phage(25.0%)	6	NA	NA
WP_002915870.1|5126110_5127364_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	1.5e-14
WP_004149616.1|5127591_5128923_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_002915873.1|5129152_5129473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188670.1|5129530_5131375_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.8	5.3e-21
WP_004151968.1|5131371_5134908_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.1	2.2e-07
WP_002915886.1|5134904_5137790_-	pitrilysin	NA	A0A1V0SH69	Hokovirus	22.1	2.2e-45
>prophage 364
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5143303	5155221	5547427		Cronobacter_phage(25.0%)	11	NA	NA
WP_002915933.1|5143303_5144098_-	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.8	2.4e-119
WP_002915934.1|5144104_5144980_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_062954963.1|5145225_5147472_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	23.3	5.6e-09
WP_002915936.1|5147484_5148015_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_004218186.1|5148468_5148612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004143967.1|5148697_5149393_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_002915973.1|5149456_5150170_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	4.5e-45
WP_002915974.1|5150293_5150512_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_002915975.1|5150732_5151773_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_062954964.1|5151875_5153069_-	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_002915977.1|5153061_5155221_-	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.1	6.4e-18
>prophage 365
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5161208	5162210	5547427		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004229436.1|5161208_5162210_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.5	5.9e-27
>prophage 366
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5167924	5169052	5547427		Bacillus_phage(100.0%)	1	NA	NA
WP_002915997.1|5167924_5169052_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	4.7e-12
>prophage 367
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5174815	5178286	5547427		Enterobacteria_phage(33.33%)	3	NA	NA
WP_004149647.1|5174815_5175811_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.2	2.8e-13
WP_002916001.1|5175807_5177229_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.3	1.1e-23
WP_002916003.1|5177524_5178286_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.0e-18
>prophage 368
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5198882	5200562	5547427	integrase	Escherichia_phage(100.0%)	2	5196748:5196762	5206536:5206550
5196748:5196762	attL	CGGCACCACGCTGAA	NA	NA	NA	NA
WP_004151951.1|5198882_5199488_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.4	6.1e-51
WP_002916189.1|5199953_5200562_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.0	1.5e-49
5206536:5206550	attR	CGGCACCACGCTGAA	NA	NA	NA	NA
>prophage 369
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5215023	5219155	5547427		uncultured_Caudovirales_phage(75.0%)	4	NA	NA
WP_002916277.1|5215023_5216577_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.1	9.5e-157
WP_002916278.1|5217049_5217472_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	66.4	4.5e-45
WP_002916279.1|5217481_5218774_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.2	1.0e-164
WP_002916281.1|5218825_5219155_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	54.0	2.9e-23
>prophage 370
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5222233	5223253	5547427		Klosneuvirus(100.0%)	1	NA	NA
WP_002916289.1|5222233_5223253_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	31.8	3.8e-05
>prophage 371
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5227221	5235123	5547427	tRNA	Clostridium_phage(20.0%)	7	NA	NA
WP_004157874.1|5227221_5227935_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	35.8	1.7e-12
WP_002916298.1|5228251_5228806_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_002916299.1|5229040_5230558_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.2	1.5e-85
WP_095858446.1|5230567_5231666_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
WP_004151783.1|5231751_5233485_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.2	8.3e-61
WP_002916301.1|5233490_5234204_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004144729.1|5234226_5235123_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	7.9e-31
>prophage 372
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5239816	5241250	5547427		Pandoravirus(100.0%)	1	NA	NA
WP_002916322.1|5239816_5241250_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	3.6e-33
>prophage 373
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5245825	5248699	5547427		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_002916478.1|5245825_5248699_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.6	5.7e-264
>prophage 374
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5256642	5257875	5547427		Catovirus(100.0%)	1	NA	NA
WP_002916493.1|5256642_5257875_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.6	3.1e-102
>prophage 375
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5269594	5270575	5547427	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000019473.1|5269594_5270575_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 376
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5276328	5277123	5547427		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_002916526.1|5276328_5277123_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.7	1.4e-07
>prophage 377
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5290878	5292033	5547427		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004149807.1|5290878_5292033_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	1.4e-128
>prophage 378
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5306907	5307990	5547427		Geobacillus_virus(100.0%)	1	NA	NA
WP_002916629.1|5306907_5307990_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	9.9e-12
>prophage 379
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5315536	5316517	5547427		Caulobacter_phage(100.0%)	1	NA	NA
WP_004151764.1|5315536_5316517_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.4	1.3e-47
>prophage 380
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5323216	5324752	5547427		Vibrio_phage(100.0%)	4	NA	NA
WP_004152614.1|5323216_5323477_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	65.7	1.1e-17
WP_004152613.1|5323617_5324073_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004155677.1|5324151_5324397_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004152612.1|5324500_5324752_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	64.2	4.0e-17
>prophage 381
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5335146	5336514	5547427		Morganella_phage(100.0%)	1	NA	NA
WP_004150873.1|5335146_5336514_+	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	34.2	5.9e-62
>prophage 382
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5358068	5358824	5547427		Lactobacillus_prophage(100.0%)	1	NA	NA
WP_022644655.1|5358068_5358824_-	DUF2321 domain-containing protein	NA	Q6SEF3	Lactobacillus_prophage	34.7	6.9e-12
>prophage 383
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5365104	5366472	5547427		Escherichia_phage(100.0%)	1	NA	NA
WP_004150905.1|5365104_5366472_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.0	3.7e-120
>prophage 384
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5371355	5372732	5547427		Lactococcus_phage(100.0%)	1	NA	NA
WP_004217775.1|5371355_5372732_+	pyridoxal-phosphate dependent enzyme	NA	A0A1W6JHY1	Lactococcus_phage	36.7	8.7e-45
>prophage 385
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5392441	5402344	5547427		Staphylococcus_phage(25.0%)	8	NA	NA
WP_002916796.1|5392441_5393269_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	3.4e-60
WP_004150920.1|5393304_5393832_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002916798.1|5393889_5396073_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.0e-103
WP_004144547.1|5396196_5397609_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_002916826.1|5397692_5398430_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_002916828.1|5398621_5400880_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.1	1.8e-84
WP_002916831.1|5401001_5401871_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002916833.1|5401948_5402344_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	42.5	9.8e-18
>prophage 386
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5405655	5407551	5547427		Bacillus_virus(100.0%)	1	NA	NA
WP_002916844.1|5405655_5407551_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.7	5.9e-92
>prophage 387
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5411893	5418774	5547427		Erwinia_phage(25.0%)	9	NA	NA
WP_002916849.1|5411893_5412565_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	48.3	9.7e-42
WP_002916850.1|5412570_5413731_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.9	1.4e-88
WP_002916851.1|5413775_5414567_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_002916852.1|5414753_5415524_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_002916855.1|5415585_5416239_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.8e-45
WP_002916856.1|5416616_5416889_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_002916857.1|5416924_5417122_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_004144536.1|5417113_5417263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002916858.1|5417340_5418774_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	2.0e-39
>prophage 388
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5423885	5425127	5547427		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_002916864.1|5423885_5425127_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	50.1	5.2e-89
>prophage 389
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5434420	5448780	5547427	tRNA	Moraxella_phage(20.0%)	13	NA	NA
WP_002916879.1|5434420_5435434_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|5435671_5435887_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002917631.1|5435998_5437744_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_004174339.1|5437962_5439804_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_002917636.1|5439903_5440410_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_002917638.1|5441145_5441418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004144804.1|5441486_5441852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002917647.1|5442153_5442768_+	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_004150925.1|5442772_5446015_+	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	3.3e-34
WP_004188513.1|5446105_5446777_-	YfdX family protein	NA	NA	NA	NA	NA
WP_002917651.1|5447017_5447593_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_002917655.1|5447619_5447925_+	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_002917658.1|5447976_5448780_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	1.2e-14
>prophage 390
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5466858	5468238	5547427		Klosneuvirus(100.0%)	1	NA	NA
WP_004174227.1|5466858_5468238_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.5e-31
>prophage 391
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5472509	5473997	5547427		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002917730.1|5472509_5473997_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.4e-19
>prophage 392
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5483560	5484532	5547427		Escherichia_phage(100.0%)	1	NA	NA
WP_002917893.1|5483560_5484532_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.4	2.0e-35
>prophage 393
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5501555	5502701	5547427		Streptococcus_phage(100.0%)	1	NA	NA
WP_002917950.1|5501555_5502701_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.9	6.7e-51
>prophage 394
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5518807	5528505	5547427		Escherichia_phage(20.0%)	12	NA	NA
WP_002918124.1|5518807_5519581_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.3	1.2e-22
WP_004150941.1|5519615_5520506_-	Fic family protein	NA	NA	NA	NA	NA
WP_004144878.1|5520620_5521484_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.5	2.1e-49
WP_004160309.1|5521547_5523665_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_002918206.1|5523622_5524009_+	YraN family protein	NA	NA	NA	NA	NA
WP_002918211.1|5524034_5524625_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
WP_002918214.1|5524634_5525210_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_002918216.1|5525331_5526372_-	permease	NA	NA	NA	NA	NA
WP_002918218.1|5526447_5527095_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002918221.1|5527223_5527760_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	9.3e-11
WP_002918223.1|5527721_5528165_-	YhbP family protein	NA	NA	NA	NA	NA
WP_002918226.1|5528214_5528505_+	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	52.6	3.1e-13
>prophage 395
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5534198	5536130	5547427		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004150943.1|5534198_5536130_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	2.1e-52
>prophage 396
NZ_CP023722	Klebsiella pneumoniae strain TVGHCRE225 chromosome, complete genome	5547427	5541544	5544235	5547427		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_002918250.1|5541544_5544235_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.4	5.1e-25
>prophage 1
NZ_CP023723	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence	297984	0	3013	297984		Yersinia_phage(100.0%)	3	NA	NA
WP_014386579.1|432_888_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_004026392.1|948_1113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110437857.1|1771_3013_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	28.9	6.7e-12
>prophage 2
NZ_CP023723	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence	297984	7203	9078	297984		Bacillus_phage(100.0%)	1	NA	NA
WP_016947078.1|7203_9078_+	DEAD/DEAH box helicase	NA	A0A127AW80	Bacillus_phage	27.1	5.2e-08
>prophage 3
NZ_CP023723	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence	297984	12122	13816	297984		Morganella_phage(50.0%)	2	NA	NA
WP_004181893.1|12122_12545_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.3	6.3e-31
WP_004181894.1|12544_13816_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	58.3	3.9e-140
>prophage 4
NZ_CP023723	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence	297984	21755	23668	297984		Clostridioides_phage(50.0%)	2	NA	NA
WP_016947085.1|21755_22529_-	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	48.0	2.3e-10
WP_014386569.1|22531_23668_-	S49 family peptidase	NA	G0YPK2	Erwinia_phage	32.2	5.7e-10
>prophage 5
NZ_CP023723	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence	297984	58748	61950	297984		Tupanvirus(50.0%)	3	NA	NA
WP_011251272.1|58748_59750_-	TGS domain-containing protein	NA	A0A2K9L6B6	Tupanvirus	41.5	9.7e-54
WP_004214540.1|60179_61004_+	DUF1460 domain-containing protein	NA	NA	NA	NA	NA
WP_004214541.1|61020_61950_-	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	25.2	1.5e-11
>prophage 6
NZ_CP023723	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence	297984	76223	77899	297984		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_004212810.1|76223_77069_+	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	26.0	1.9e-10
WP_004212808.1|77065_77899_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.0	1.1e-10
>prophage 7
NZ_CP023723	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence	297984	83977	86364	297984		Staphylococcus_phage(50.0%)	3	NA	NA
WP_004212797.1|83977_84817_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	35.7	3.7e-46
WP_004212796.1|85134_85533_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004212794.1|85869_86364_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	38.6	5.9e-20
>prophage 8
NZ_CP023723	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence	297984	91810	92032	297984		Streptococcus_phage(100.0%)	1	NA	NA
WP_004213643.1|91810_92032_-	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	63.5	3.6e-17
>prophage 9
NZ_CP023723	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence	297984	96315	108060	297984	transposase	Shigella_phage(20.0%)	8	NA	NA
WP_011154590.1|96315_96522_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	52.2	2.7e-11
WP_004213628.1|96978_98211_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	34.0	6.3e-63
WP_004213626.1|98195_98840_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.7	5.6e-55
WP_074160420.1|98946_99174_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004213623.1|99189_100305_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_110437862.1|100447_104092_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	29.7	2.5e-46
WP_004902400.1|104196_105426_+	esterase family protein	NA	NA	NA	NA	NA
WP_004213617.1|105885_108060_+	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	30.6	2.8e-05
>prophage 10
NZ_CP023723	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence	297984	113414	115910	297984	transposase	Salmonella_phage(50.0%)	2	NA	NA
WP_004225014.1|113414_114383_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.2e-172
WP_004213252.1|115082_115910_+	ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.4	2.2e-11
>prophage 11
NZ_CP023723	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence	297984	122487	122997	297984		Synechococcus_phage(100.0%)	1	NA	NA
WP_004145290.1|122487_122997_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	8.8e-19
>prophage 12
NZ_CP023723	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence	297984	134741	135002	297984		Erwinia_phage(100.0%)	1	NA	NA
WP_004213925.1|134741_135002_+	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	51.0	1.1e-06
>prophage 13
NZ_CP023723	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence	297984	150511	171004	297984	transposase,protease	Caulobacter_phage(27.27%)	16	NA	NA
WP_004225018.1|150511_151507_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
WP_004210218.1|151712_152726_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
WP_077250518.1|153379_156337_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.8	2.3e-50
WP_004144375.1|157178_158039_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.7	9.0e-08
WP_004026615.1|159770_160418_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_024198108.1|160753_161995_-	VWA domain-containing protein	NA	A0A2D1GNA9	Pseudoalteromonas_phage	25.1	4.8e-10
WP_004026611.1|162079_162655_-	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	42.6	9.6e-30
WP_004026609.1|162741_163320_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_004026607.1|163358_164399_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
WP_004026604.1|164422_164878_-	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_004026603.1|164900_166052_-	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_004026602.1|166048_166633_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	29.9	1.8e-12
WP_004026600.1|166944_168003_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_004026599.1|168014_169157_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.2	6.3e-33
WP_004026598.1|169149_169923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026596.1|169924_171004_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	1.7e-40
>prophage 14
NZ_CP023723	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence	297984	174797	175439	297984		Streptomyces_phage(100.0%)	1	NA	NA
WP_004026586.1|174797_175439_+	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
>prophage 15
NZ_CP023723	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence	297984	186205	187090	297984		Salmonella_phage(100.0%)	1	NA	NA
WP_004186900.1|186205_187090_+	hypothetical protein	NA	J9Q7H0	Salmonella_phage	43.2	2.6e-50
>prophage 16
NZ_CP023723	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence	297984	196593	197838	297984		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004181767.1|196593_197838_-	toprim domain-containing protein	NA	A0A0H5AWB1	Pseudomonas_phage	25.5	1.8e-09
>prophage 17
NZ_CP023723	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence	297984	205189	206989	297984		Bacillus_phage(100.0%)	1	NA	NA
WP_094339776.1|205189_206989_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	23.1	2.4e-26
>prophage 18
NZ_CP023723	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence	297984	235624	236803	297984		Salmonella_phage(100.0%)	1	NA	NA
WP_004196657.1|235624_236803_+	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	33.0	9.1e-19
>prophage 19
NZ_CP023723	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence	297984	243103	244351	297984		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004181813.1|243103_244351_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	23.0	1.4e-12
>prophage 20
NZ_CP023723	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence	297984	256607	271283	297984		Burkholderia_phage(20.0%)	24	NA	NA
WP_004196710.1|256607_257186_+	HNH endonuclease	NA	W0LI46	Edwardsiella_phage	57.6	1.2e-40
WP_004181824.1|257176_257491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120493.1|257615_258026_+	hypothetical protein	NA	Q71TH9	Escherichia_phage	60.8	4.6e-42
WP_004196726.1|258210_258570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026468.1|258800_259244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026466.1|259497_259758_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	41.0	5.9e-11
WP_004196690.1|259790_260225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110437876.1|260221_260965_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	49.6	3.0e-60
WP_075043065.1|261121_262507_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	3.1e-106
WP_110437877.1|262596_263799_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.1	1.1e-35
WP_004181828.1|264376_264625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181829.1|264652_264970_+	DUF3846 domain-containing protein	NA	A0A2H4P7A4	Pseudomonas_phage	46.5	6.0e-10
WP_124036897.1|265090_265369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196694.1|265412_265706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016947056.1|265766_266429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026456.1|266583_266892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032287591.1|267186_267549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016947058.1|267849_268470_-	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	47.0	3.6e-51
WP_085858953.1|268536_268755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074167815.1|268790_269039_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	46.4	5.6e-11
WP_004181835.1|269340_269652_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004026449.1|269663_269981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016947060.1|270010_270400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196719.1|270776_271283_+	hypothetical protein	NA	K7PM35	Enterobacteria_phage	34.7	6.3e-09
>prophage 21
NZ_CP023723	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence	297984	277004	279858	297984		Bacillus_phage(50.0%)	2	NA	NA
WP_004026443.1|277004_277796_+	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	32.5	1.4e-10
WP_024198088.1|278769_279858_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	41.4	4.4e-60
>prophage 22
NZ_CP023723	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence	297984	286570	297451	297984		Salmonella_phage(40.0%)	18	NA	NA
WP_004026417.1|286570_286891_+	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.2e-28
WP_004026416.1|286971_287286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197205.1|287406_287658_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
WP_004026415.1|287823_288042_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
WP_004026414.1|288134_288632_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	67.1	2.6e-23
WP_004026413.1|288628_288817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197209.1|289294_289522_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.5e-10
WP_004026412.1|289518_290163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024198083.1|290579_290966_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
WP_040222757.1|291663_291879_+	hypothetical protein	NA	J9Q804	Salmonella_phage	51.4	4.7e-14
WP_032451279.1|293115_293310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197220.1|293611_293818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197207.1|293901_294174_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	48.9	1.5e-12
WP_162138575.1|294237_294399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883232.1|294454_294742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197199.1|295195_295720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197222.1|295783_296551_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	62.7	3.5e-43
WP_004026395.1|297001_297451_+	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	45.2	2.9e-18
>prophage 1
NZ_CP023725	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed3, complete sequence	103454	0	7714	103454		Cronobacter_phage(16.67%)	10	NA	NA
WP_015493081.1|1057_2329_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
WP_015493080.1|2328_2751_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_015493079.1|2930_3602_-	SOS response-associated peptidase family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
WP_002211749.1|3960_4638_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_015493077.1|4637_4859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493076.1|4869_5289_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_015493075.1|5342_6122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493074.1|6526_7033_+	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
WP_015493073.1|7075_7267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493072.1|7459_7714_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	46.2	5.2e-12
>prophage 2
NZ_CP023725	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed3, complete sequence	103454	12197	17590	103454	transposase	Klebsiella_phage(33.33%)	9	NA	NA
WP_008324183.1|12197_12521_+	hypothetical protein	NA	I3UM57	Rhodobacter_phage	38.1	6.0e-13
WP_015493069.1|12582_12942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008324180.1|13567_13942_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	62.7	2.2e-27
WP_001067855.1|14442_15147_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152721.1|16056_16335_-	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_014343498.1|16324_16645_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	1.5e-08
WP_014343499.1|16725_16950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343500.1|16960_17173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343501.1|17233_17590_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	7.5e-25
>prophage 3
NZ_CP023725	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed3, complete sequence	103454	22414	26777	103454		Emiliania_huxleyi_virus(33.33%)	4	NA	NA
WP_015493064.1|22414_24472_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	1.2e-21
WP_001568055.1|24541_24790_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_015065513.1|24838_25381_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	77.5	1.6e-50
WP_004152756.1|26213_26777_-	methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
>prophage 4
NZ_CP023725	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed3, complete sequence	103454	29815	83598	103454	transposase,protease,integrase	Escherichia_phage(39.13%)	55	42636:42695	90111:90932
WP_011977779.1|29815_30070_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.8	4.0e-12
WP_001568047.1|30257_30449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214014.1|30491_30998_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.4	1.2e-07
WP_013023797.1|31040_31706_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_013214013.1|32149_32917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|32970_33390_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568042.1|33399_33621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568041.1|33620_34322_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
WP_001568040.1|34758_34989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214012.1|35051_35723_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_004152353.1|35725_36697_-	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004178082.1|36945_38433_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001568036.1|38839_39271_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_013214011.1|39270_40542_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
WP_011977819.1|40623_41598_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
42636:42695	attL	ACGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACAT	NA	NA	NA	NA
WP_001067855.1|42689_43394_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004118283.1|44172_45039_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_014343462.1|45574_45688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013214010.1|45816_46074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013214009.1|46119_46899_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
WP_011977814.1|47082_48087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977813.1|48116_48320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214008.1|48365_48887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977811.1|48944_49337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977810.1|49373_50318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343465.1|50478_50940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|50896_51127_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|51123_51540_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004206609.1|51613_53176_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361404.1|53160_54183_+	helicase UvrD	NA	NA	NA	NA	NA
WP_001312851.1|55440_55590_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083837.1|55873_56122_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001375168.1|56366_56441_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_032495102.1|56433_57291_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|58229_58883_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|58975_59233_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|59165_59567_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|60877_61582_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|62692_63397_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_101862740.1|63436_63997_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	41.1	6.5e-31
WP_020324153.1|65200_66676_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_013263795.1|68599_69319_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	30.0	1.3e-20
WP_000057569.1|69878_70220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004248792.1|70234_71026_-	SprT-like domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|71814_72519_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|73629_74334_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014343468.1|74373_74847_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
WP_013213985.1|74969_75950_+|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
WP_004199234.1|76225_77107_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_013213987.1|78341_78638_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_013213988.1|78683_78839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013213989.1|78966_79392_-	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
WP_013213990.1|79502_79781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161490.1|81323_81884_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001067855.1|82893_83598_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
90111:90932	attR	ACGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 5
NZ_CP023725	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed3, complete sequence	103454	90164	90869	103454	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001067855.1|90164_90869_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 6
NZ_CP023725	Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed3, complete sequence	103454	97931	103408	103454	transposase	Escherichia_phage(25.0%)	7	NA	NA
WP_001067855.1|97931_98636_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_015493087.1|98856_99252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493086.1|99248_99860_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_015493085.1|99856_100807_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.6	6.6e-76
WP_040219232.1|100953_101154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652286.1|101207_101840_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.9	2.5e-07
WP_015493083.1|102202_103408_+	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
