The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	115272	200023	5213052	transposase,holin,portal,lysis,terminase,integrase,head,capsid,tail	Enterobacteria_phage(40.0%)	101	168944:168959	200561:200576
WP_001355499.1|115272_116481_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	1.4e-208
WP_000879833.1|117892_118690_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001394416.1|118699_119251_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|119419_119752_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|120085_120400_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994454.1|120614_122273_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|122265_123261_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282694.1|123253_123940_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213294.1|123939_125313_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|125331_125775_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620105.1|125771_126899_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133119.1|127003_127468_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|127472_128477_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|128473_128887_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001302429.1|128889_129255_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253450.1|129254_129992_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|130001_130271_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983970.1|130279_131065_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103981.1|131354_131978_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|132021_132264_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|132372_132600_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000491514.1|132897_133716_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001355498.1|133712_135407_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|135577_135760_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_110843881.1|135838_136756_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212240.1|136928_137849_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_001157238.1|138288_139707_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000365544.1|139773_140469_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001313057.1|140508_140874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824370.1|141440_142499_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	49.3	1.1e-92
WP_000218220.1|143090_143942_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826747.1|144049_145408_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_001362894.1|145407_146079_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	3.1e-32
WP_000920132.1|146211_146625_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740089.1|146733_147738_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_110843885.1|147738_148374_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007749.1|148630_149281_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079074.1|149623_150154_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_072740660.1|151146_151476_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000861763.1|151841_152417_-	DUF4376 domain-containing protein	NA	Q9MCI9	Enterobacteria_phage	59.7	2.9e-63
WP_110843889.1|152432_154166_-	hypothetical protein	NA	Q9LA62	Enterobacterial_phage	79.1	2.9e-45
WP_001339397.1|154299_154977_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|154976_155324_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_110843859.1|155343_156915_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.9	5.8e-170
WP_000457788.1|157215_157878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123891619.1|157877_158102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103809112.1|158137_159292_-	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	81.8	2.3e-30
WP_110843893.1|161914_162562_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	90.7	3.5e-105
WP_110843895.1|162459_163203_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	7.3e-147
WP_029490491.1|163207_163906_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.1	2.9e-129
WP_045147776.1|163905_164235_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	1.1e-57
WP_110843897.1|164231_166811_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	96.9	0.0e+00
WP_110843899.1|166803_167238_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_096986402.1|167219_167642_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	88.6	3.3e-64
WP_072721469.1|167655_168408_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	90.8	9.7e-123
WP_053287890.1|168415_168811_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	95.4	7.9e-68
WP_001007376.1|168807_169383_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	60.2	2.6e-51
168944:168959	attL	TGAATGGGAAGACGAT	NA	NA	NA	NA
WP_024211201.1|169394_169748_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	94.7	3.3e-57
WP_086795194.1|169743_170106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029400420.1|170157_171186_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	6.6e-114
WP_059236877.1|171243_171591_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
WP_001253937.1|171627_173133_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.0	4.3e-98
WP_024211202.1|173122_174715_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	1.3e-182
WP_000259002.1|174711_174918_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_110843901.1|174901_176830_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	8.8e-261
WP_000235436.1|176801_177311_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_032242945.1|177734_177929_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	93.8	3.7e-26
WP_000019440.1|178304_179285_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_097733771.1|179422_179872_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	84.6	6.9e-68
WP_097733770.1|179995_180862_-	hypothetical protein	NA	A0A2I6TCU3	Escherichia_phage	93.9	2.1e-97
WP_000738425.1|181277_181571_+	increased serum survival lipoprotein Iss	NA	C6ZCX3	Enterobacteria_phage	91.8	1.6e-44
WP_123055739.1|181661_181844_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	76.7	5.5e-16
WP_097733768.1|182060_182594_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.0	5.3e-99
WP_032354427.1|182718_182958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045147643.1|182954_183266_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	53.4	3.1e-19
WP_000839601.1|183269_183485_-|holin	holin	holin	M1FN85	Enterobacteria_phage	91.5	1.3e-32
WP_103254017.1|183552_184605_-	site-specific DNA-methyltransferase	NA	K7PKK9	Enterobacteria_phage	95.7	3.0e-199
WP_045147648.1|184755_184953_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	96.9	2.0e-27
WP_072740635.1|185179_186001_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.7	1.7e-80
WP_045147659.1|185997_186372_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.5	1.4e-37
WP_072740636.1|186384_187431_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	5.9e-110
WP_032153165.1|187432_187705_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	6.1e-11
WP_039720016.1|187897_188290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000902684.1|188433_188646_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	2.0e-25
WP_123002322.1|188690_188798_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.0e-09
WP_000150294.1|188825_189491_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_072740638.1|189666_190092_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.3	8.3e-63
WP_072740639.1|190107_190878_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.0	6.7e-87
WP_162616993.1|190910_191453_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	3.7e-84
WP_059327933.1|191364_192375_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	91.7	1.4e-177
WP_072740791.1|192445_192871_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391948.1|192854_193136_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362152.1|193237_193657_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_000379575.1|193923_194079_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|194238_194457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123009167.1|194460_194625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072770401.1|195044_195896_+	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	61.8	1.8e-64
WP_077581044.1|195941_196163_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	89.0	2.1e-33
WP_077581043.1|196282_198736_+	exonuclease	NA	V5UQJ3	Shigella_phage	60.6	3.3e-172
WP_000096344.1|198794_198998_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533613.1|198997_200023_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	1.2e-102
200561:200576	attR	TGAATGGGAAGACGAT	NA	NA	NA	NA
>prophage 2
NZ_CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	352433	361874	5213052		Enterobacteria_phage(85.71%)	10	NA	NA
WP_106495079.1|352433_353570_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
WP_110843919.1|353566_355567_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001295429.1|355691_356153_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|356192_356663_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|356709_357429_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|357425_359111_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|359332_360064_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|360123_360231_+	protein YohO	NA	NA	NA	NA	NA
WP_000783115.1|360211_360943_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569357.1|360947_361874_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 3
NZ_CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	575203	621856	5213052	portal,head,terminase,integrase,plate,tRNA,capsid,tail	Enterobacteria_phage(82.05%)	52	578209:578228	615915:615934
WP_001283585.1|575203_576016_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289167.1|576015_577029_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000004836.1|577094_578252_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	6.0e-23
578209:578228	attL	TTTTCATCAACAAGGATTTT	NA	NA	NA	NA
WP_000023401.1|578410_579415_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	56.0	1.5e-99
WP_108990991.1|579511_580063_-	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	4.1e-14
WP_000004249.1|580211_580499_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
WP_000200501.1|580505_580712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106482574.1|580964_581306_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	88.2	5.4e-49
WP_032353946.1|581309_581564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000357024.1|581584_581827_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.5e-37
WP_000021656.1|581823_581937_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000985159.1|582023_582227_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000153674.1|582223_582469_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_032353947.1|582465_582765_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	4.8e-41
WP_110843944.1|582776_583394_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	46.7	5.3e-10
WP_032353727.1|583390_583780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106482647.1|583776_586617_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	87.6	0.0e+00
WP_097313401.1|586693_587653_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	94.4	2.7e-170
WP_032353509.1|587657_587969_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.6e-47
WP_032220883.1|588347_589430_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	8.4e-19
WP_032353510.1|589426_591631_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_032353914.1|592083_593133_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	78.0	4.7e-160
WP_062897631.1|593132_594875_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	72.2	2.0e-248
WP_032353542.1|595026_595896_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	61.7	5.8e-87
WP_032353543.1|595905_596967_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	65.0	3.1e-127
WP_097323789.1|597016_597844_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	78.0	1.2e-97
WP_016240831.1|597967_598462_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	65.2	2.4e-53
WP_032354034.1|598461_598662_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	80.0	6.7e-23
WP_021524210.1|598652_598946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097323787.1|598932_599475_+	lysozyme	NA	A0A1S5Q8G1	Aeromonas_phage	39.3	8.4e-28
WP_032353986.1|599471_599918_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	33.3	2.7e-08
WP_032353987.1|600012_600495_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.7	2.5e-47
WP_106482646.1|600475_601114_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	48.6	3.2e-50
WP_032353246.1|601110_601692_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	73.6	2.5e-78
WP_001546048.1|601688_602054_+|plate	phage baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	67.0	1.9e-39
WP_032353248.1|602040_602937_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	72.1	1.4e-112
WP_032353249.1|602929_603706_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	59.6	1.8e-55
WP_032353250.1|603702_605490_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	51.7	1.8e-122
WP_032353251.1|605486_605765_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	60.9	8.1e-27
WP_032353252.1|605777_606071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097323777.1|606905_607364_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	76.0	4.7e-64
WP_032142793.1|611371_611530_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.8	8.7e-10
WP_050594640.1|611535_611952_-	hypothetical protein	NA	B9A7B2	Serratia_phage	48.9	5.9e-13
WP_110843945.1|611997_612513_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	65.3	6.3e-57
WP_021524219.1|612513_613695_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	85.3	5.8e-191
WP_106482644.1|613856_614990_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	72.3	2.6e-148
WP_032354247.1|615040_615298_+	phage regulatory protein	NA	NA	NA	NA	NA
WP_000078916.1|615514_615655_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000615834.1|616035_617031_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
615915:615934	attR	TTTTCATCAACAAGGATTTT	NA	NA	NA	NA
WP_000127781.1|617027_618206_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|618470_619691_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_110843946.1|619849_621856_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	788477	834265	5213052	tail,terminase,integrase,holin	Escherichia_phage(66.04%)	57	790316:790332	831151:831167
WP_000017552.1|788477_788630_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|788647_788839_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001295476.1|789151_789670_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000755173.1|789685_790225_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
790316:790332	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_110843962.1|790419_790917_-	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	72.0	8.2e-54
WP_110843964.1|790913_791543_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.1	4.0e-114
WP_089619644.1|791532_791841_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	94.1	9.6e-45
WP_089619643.1|791830_792232_-	hypothetical protein	NA	T1SA79	Salmonella_phage	91.0	3.3e-61
WP_089619642.1|792647_795230_-	hypothetical protein	NA	G9L6E4	Escherichia_phage	67.1	1.7e-57
WP_001188261.1|795426_795684_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	98.8	4.9e-42
WP_110221350.1|795865_795952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093358.1|795997_796690_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	80.2	2.9e-97
WP_000508164.1|796804_797014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001550144.1|797016_797880_+	hypothetical protein	NA	I6PD67	Cronobacter_phage	35.2	2.1e-36
WP_000708858.1|797972_798134_+	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_069905260.1|798207_799152_-	antirepressor	NA	G9L6D8	Escherichia_phage	94.6	4.4e-173
WP_001167931.1|799224_799392_-	hypothetical protein	NA	G9L6D7	Escherichia_phage	100.0	2.3e-24
WP_000085730.1|799512_799944_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	100.0	1.6e-58
WP_023352470.1|800034_800598_+	hypothetical protein	NA	G9L6D5	Escherichia_phage	98.9	3.6e-98
WP_023352471.1|800609_803624_-	hypothetical protein	NA	G9L6D4	Escherichia_phage	99.4	0.0e+00
WP_023352472.1|803623_806341_-	transglycosylase SLT domain-containing protein	NA	G9L6D3	Escherichia_phage	99.1	0.0e+00
WP_000332877.1|806340_806916_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	95.3	7.0e-81
WP_073516398.1|806915_807380_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	4.2e-84
WP_110843966.1|807379_809851_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	98.9	0.0e+00
WP_021558017.1|809850_810456_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.5	1.1e-111
WP_000012377.1|810512_810848_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_110843968.1|810858_811296_-	hypothetical protein	NA	G9L6C6	Escherichia_phage	97.9	6.9e-73
WP_110843970.1|811347_812334_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	99.1	7.3e-187
WP_033551245.1|812348_813044_-	peptidase	NA	G9L6C4	Escherichia_phage	99.1	3.9e-94
WP_021517651.1|813046_813343_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	99.0	3.7e-46
WP_000852419.1|813339_815019_-|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.5	3.6e-303
WP_000335899.1|815033_815240_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_001600316.1|815942_816365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032153863.1|816408_817884_-	hypothetical protein	NA	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.2	2.2e-296
WP_001090112.1|817880_818555_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.6	3.4e-119
WP_089619638.1|818595_818934_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	94.6	4.3e-54
WP_000002086.1|818926_819208_-	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	97.8	2.6e-49
WP_110843972.1|819207_819468_-	eaa protein	NA	A0A077SLR0	Escherichia_phage	97.7	2.1e-40
WP_110843974.1|819464_820154_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	46.5	1.1e-51
WP_110843975.1|820308_820818_-	ead/Ea22-like family protein	NA	A0A2D1GLY5	Escherichia_phage	74.3	1.5e-63
WP_110843976.1|820814_821348_-	ead/Ea22-like family protein	NA	G9L6B1	Escherichia_phage	65.5	4.1e-43
WP_001231251.1|821409_821754_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	97.4	4.1e-60
WP_001416842.1|821871_822657_-	replication P family protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.2	6.1e-152
WP_001531880.1|822653_823445_-	hypothetical protein	NA	Q286X4	Escherichia_phage	90.9	8.3e-117
WP_001282458.1|823811_824042_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	98.7	1.0e-38
WP_000836290.1|824196_824781_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_047629890.1|825091_826126_+	hypothetical protein	NA	A0A1B0VN89	Pseudomonas_phage	48.2	7.2e-36
WP_110843977.1|826133_826433_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	97.0	3.8e-46
WP_023145215.1|826429_827251_+	hypothetical protein	NA	G9L6A3	Escherichia_phage	97.8	2.6e-161
WP_000064070.1|827247_828165_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	49.7	1.2e-69
WP_000675390.1|828214_828463_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_001341620.1|828620_828872_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	98.8	5.2e-41
WP_089619632.1|828864_829515_+	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	97.7	3.6e-126
WP_001077940.1|829511_829706_+	DUF1382 family protein	NA	A0A0F6R7M7	Escherichia_coli_O157_typing_phage	100.0	3.3e-27
WP_020231273.1|829709_830960_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.3	8.0e-239
WP_000138270.1|831152_832730_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
831151:831167	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_001299507.1|832798_834265_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
>prophage 5
NZ_CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	1029626	1043392	5213052	transposase	Escherichia_phage(50.0%)	12	NA	NA
WP_001272895.1|1029626_1032188_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	4.6e-31
WP_001141322.1|1032293_1032950_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272547.1|1033000_1033798_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_000847985.1|1033963_1034872_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590403.1|1034868_1036131_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|1036127_1036766_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|1036770_1037547_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|1037635_1039000_+	GntP family transporter	NA	NA	NA	NA	NA
WP_089616101.1|1039093_1039972_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	5.4e-32
WP_001352368.1|1040044_1041253_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001272590.1|1041486_1042626_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|1042765_1043392_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
>prophage 6
NZ_CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	1259548	1314405	5213052	tRNA,transposase,protease,integrase	Ralstonia_phage(18.18%)	57	1291560:1291574	1299909:1299923
WP_000858396.1|1259548_1260046_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|1260140_1260848_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001605848.1|1260927_1261659_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_001605849.1|1261671_1262622_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000126441.1|1262658_1263294_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|1263293_1263710_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001605850.1|1263884_1264865_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|1264882_1265587_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|1265604_1266171_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|1266167_1266458_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174738.1|1266465_1267059_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239950.1|1267051_1268188_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001605851.1|1268252_1269260_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394132.1|1269376_1270423_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|1270598_1271318_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_023154029.1|1271338_1271479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107564.1|1271501_1271828_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|1271827_1272547_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001605855.1|1272707_1273760_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|1273787_1274063_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298916.1|1274127_1275207_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|1275408_1276665_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_001605856.1|1276710_1278846_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|1279243_1279951_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001696146.1|1280328_1281318_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_077884138.1|1281371_1282973_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001696148.1|1282986_1284495_-	AAA family ATPase	NA	A0A2D1GN12	Pseudoalteromonas_phage	31.3	2.6e-42
WP_000127557.1|1285021_1285240_+	DUF1187 family protein	NA	NA	NA	NA	NA
WP_001696149.1|1285292_1286018_+	type IV pilus biogenesis outer membrane protein precursor PilL	NA	NA	NA	NA	NA
WP_000539880.1|1286020_1286458_+	type IV pilus biogenesis protein PilM	NA	NA	NA	NA	NA
WP_001696150.1|1286647_1288273_+	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
WP_110844005.1|1288296_1289592_+	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_000543769.1|1289581_1290043_+	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
WP_001696152.1|1290052_1291573_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
1291560:1291574	attL	CGCTGCTGCACTGAT	NA	NA	NA	NA
WP_001696153.1|1291574_1292675_+	type IV pilus integral inner membrane protein	NA	NA	NA	NA	NA
WP_001696154.1|1292724_1293261_+	major pilin subunit	NA	NA	NA	NA	NA
WP_000871803.1|1293319_1293796_+	lytic transglycosylase domain-containing protein	NA	A0A0A8J856	Ralstonia_phage	37.0	1.7e-08
WP_021577917.1|1293808_1294459_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_097338125.1|1294455_1295670_+	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_097342483.1|1296358_1296664_-	pilus assembly protein PilV	NA	NA	NA	NA	NA
WP_024139585.1|1297220_1298345_+|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	38.8	9.9e-39
WP_001696722.1|1298557_1299379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006859750.1|1299480_1300683_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
1299909:1299923	attR	CGCTGCTGCACTGAT	NA	NA	NA	NA
WP_023154733.1|1300753_1300963_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	78.0	1.3e-13
WP_001696719.1|1301120_1301402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019443.1|1302597_1303590_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	3.2e-182
WP_001353740.1|1303994_1304234_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_000777554.1|1305730_1306204_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000704156.1|1306298_1306823_+	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
WP_001206315.1|1306880_1307669_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001444089.1|1307744_1308242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119696.1|1308302_1308674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064149665.1|1308987_1310196_-|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	9.6e-48
WP_001271300.1|1310406_1310784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004018134.1|1311994_1312414_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	95.9	2.2e-47
WP_000624710.1|1312410_1312761_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	3.6e-40
WP_110844009.1|1312791_1314405_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.4	1.1e-176
>prophage 7
NZ_CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	2119275	2174809	5213052	tRNA,transposase,integrase,holin	Stx2-converting_phage(24.14%)	45	2112962:2112976	2176387:2176401
2112962:2112976	attL	CATGATTTATTTCCT	NA	NA	NA	NA
WP_001555742.1|2119275_2120535_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.1	3.0e-193
WP_001555743.1|2120630_2121596_+	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	51.2	3.0e-07
WP_001090781.1|2121710_2121914_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000412546.1|2121913_2122345_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	48.6	1.1e-27
WP_097733587.1|2122357_2123191_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	46.7	1.2e-20
WP_000042977.1|2123183_2123366_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000958754.1|2123359_2124388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|2124380_2124575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110844061.1|2124571_2124835_+|holin	nicotinic acetylcholine receptor subunit beta	holin	NA	NA	NA	NA
WP_000181940.1|2124831_2125053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096847510.1|2125045_2125648_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	5.7e-25
WP_000628967.1|2125658_2126000_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_001208878.1|2125992_2126364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001555747.1|2126350_2129107_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.0	3.4e-298
WP_000420674.1|2129869_2130331_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
WP_000909176.1|2130324_2131002_+	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
WP_021527466.1|2131001_2132321_+	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	43.2	1.2e-35
WP_016231879.1|2132317_2135038_+	lytic transglycosylase domain-containing protein	NA	A5VW64	Enterobacteria_phage	60.9	7.5e-149
WP_000594596.1|2135188_2135887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290520.1|2136782_2137745_+	abortive infection protein	NA	A0A059NT88	Lactococcus_phage	29.4	4.2e-14
WP_000230717.1|2137746_2138202_-	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	67.2	2.9e-45
WP_000617439.1|2138461_2138749_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300958.1|2139494_2140319_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	76.6	2.4e-90
WP_000924289.1|2140608_2141226_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_110844063.1|2141222_2142905_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.1	1.5e-22
WP_001295237.1|2143162_2143786_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|2143840_2144116_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|2144134_2146243_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_001070177.1|2146249_2146939_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_000678419.1|2146944_2149026_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_000468833.1|2149194_2150400_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001295238.1|2150679_2152071_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
WP_001300954.1|2152191_2153901_+	AsmA family protein	NA	NA	NA	NA	NA
WP_000702897.1|2154019_2156272_-	alpha-xylosidase	NA	NA	NA	NA	NA
WP_110844065.1|2158349_2159534_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.7	1.7e-161
WP_000343728.1|2160760_2161969_+|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	7.4e-48
WP_001360336.1|2162049_2165547_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.8	2.7e-98
WP_000422741.1|2167759_2168185_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624717.1|2168181_2168532_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.2e-40
WP_059328229.1|2168562_2170155_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.2	1.3e-180
WP_000612556.1|2170250_2170598_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	4.8e-61
WP_001171523.1|2170594_2170975_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001339397.1|2172193_2172871_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2172870_2173218_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_110843859.1|2173237_2174809_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.9	5.8e-170
2176387:2176401	attR	CATGATTTATTTCCT	NA	NA	NA	NA
>prophage 8
NZ_CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	2639117	2682044	5213052	portal,lysis,terminase,integrase,tail,tRNA,protease	Enterobacteria_phage(59.18%)	54	2679349:2679363	2684780:2684794
WP_001093916.1|2639117_2639399_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_001061345.1|2639435_2640008_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	100.0	2.4e-110
WP_063268630.1|2640007_2640820_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	47.1	2.7e-54
WP_063268629.1|2640829_2641018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063268628.1|2641014_2641497_-	hypothetical protein	NA	Q08J60	Stx2-converting_phage	63.0	1.7e-35
WP_001242714.1|2641496_2641859_-	phage protein	NA	K7PH61	Enterobacteria_phage	97.4	1.7e-64
WP_000008174.1|2641849_2642386_-	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
WP_000081287.1|2642513_2643338_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135680.1|2643403_2643766_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000357060.1|2644227_2644731_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	47.6	1.2e-31
WP_000450740.1|2645098_2645725_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	3.2e-47
WP_000205494.1|2645822_2646023_+	cell division protein	NA	NA	NA	NA	NA
WP_000514174.1|2646060_2646645_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
WP_001250270.1|2646820_2647033_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	5.4e-15
WP_000128176.1|2647613_2647982_+	hypothetical protein	NA	U5P0A0	Shigella_phage	98.4	3.9e-69
WP_110844089.1|2647978_2648473_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.6	1.9e-87
WP_021543097.1|2648472_2648799_+	LexA repressor	NA	A0A291AWY9	Escherichia_phage	98.1	1.7e-52
WP_000767115.1|2648795_2649185_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	99.2	3.5e-68
WP_074468732.1|2649204_2650014_+	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	99.6	1.8e-151
WP_096917132.1|2650021_2651011_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
WP_001047105.1|2651024_2651777_+	antitermination protein	NA	A0A291AWZ5	Escherichia_phage	100.0	1.3e-138
WP_000217632.1|2652057_2652483_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
WP_000595432.1|2652706_2652910_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	97.0	3.0e-31
WP_000799675.1|2653060_2654113_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.7	8.0e-208
WP_000839596.1|2654179_2654395_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000075159.1|2654394_2654892_+	lysozyme RrrD	NA	A5LH83	Enterobacteria_phage	100.0	1.3e-91
WP_001228685.1|2655108_2655294_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_000232224.1|2655377_2655740_+	hypothetical protein	NA	A5LH85	Enterobacteria_phage	99.2	8.9e-66
WP_077881733.1|2656191_2656731_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	98.9	4.4e-93
WP_063268624.1|2656739_2658839_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	98.7	0.0e+00
WP_001072975.1|2658835_2659048_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_077625506.1|2658975_2660556_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	2.1e-289
WP_001360054.1|2660500_2662528_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_001097045.1|2662614_2662938_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_001283153.1|2662930_2663206_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677120.1|2663217_2663808_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	7.2e-81
WP_001079410.1|2663804_2664206_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	2.4e-72
WP_000211120.1|2664216_2664960_+|tail	tail protein	tail	A5LH35	Enterobacteria_phage	99.6	1.0e-132
WP_001300035.1|2665020_2665407_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|2665415_2665745_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_110844091.1|2665716_2668782_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.4	0.0e+00
WP_000447253.1|2668781_2669111_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_052979527.1|2669120_2669819_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	5.6e-133
WP_110844093.1|2669824_2670568_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	5.7e-152
WP_052167187.1|2670504_2671113_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.5	3.1e-103
WP_110844095.1|2671172_2674652_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_110844097.1|2674719_2675319_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	90.5	7.0e-100
WP_110844099.1|2675383_2677741_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	50.1	1.7e-117
WP_001204892.1|2677740_2678010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094284486.1|2678022_2679063_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.3	9.3e-124
WP_021568063.1|2679105_2679393_+	hypothetical protein	NA	NA	NA	NA	NA
2679349:2679363	attL	GTGCCGGTGGTGGCG	NA	NA	NA	NA
WP_001217553.1|2679510_2679759_-	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000332274.1|2679820_2680918_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	6.2e-211
WP_110844101.1|2681006_2682044_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
2684780:2684794	attR	GTGCCGGTGGTGGCG	NA	NA	NA	NA
>prophage 9
NZ_CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	2911364	2956618	5213052	transposase	Stx2-converting_phage(35.71%)	39	NA	NA
WP_064149665.1|2911364_2912573_-|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	9.6e-48
WP_000175256.1|2912655_2913447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110844126.1|2915164_2915896_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_162616992.1|2916103_2916253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065898583.1|2916267_2916840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958153.1|2916908_2917145_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001167455.1|2917345_2917894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001323514.1|2917911_2918160_-	osmoprotectant transport activator ProQ	NA	Q2A0A1	Sodalis_phage	39.1	8.3e-07
WP_131501864.1|2918391_2918505_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	71.4	3.4e-08
WP_110844128.1|2919357_2921031_+	immunoglobulin-binding protein	NA	Q9MCI8	Enterobacteria_phage	76.1	6.9e-20
WP_001300563.1|2921240_2922353_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000884152.1|2922441_2922897_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_053287872.1|2926168_2927131_-	carbamate kinase family protein	NA	NA	NA	NA	NA
WP_001084509.1|2927157_2928708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045145387.1|2928820_2930239_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000027750.1|2930238_2931786_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000531854.1|2931745_2932594_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000066154.1|2932679_2933285_-	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	26.0	1.7e-05
WP_053287873.1|2933672_2934602_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001334006.1|2935275_2935596_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024210520.1|2936843_2937068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823671.1|2937196_2937721_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	62.4	3.0e-62
WP_029490360.1|2937816_2938893_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_029490361.1|2938914_2939751_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_029490362.1|2939747_2940614_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_029490363.1|2940610_2941678_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	1.4e-26
WP_000885207.1|2941893_2942724_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_000991223.1|2942739_2943852_+	ROK family protein	NA	NA	NA	NA	NA
WP_106418077.1|2943946_2944126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000577803.1|2944126_2944300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053287690.1|2945350_2946910_+	AbgT family transporter	NA	NA	NA	NA	NA
WP_053287691.1|2947221_2951097_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	32.2	9.3e-169
WP_162617000.1|2951599_2951896_+	hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	98.4	1.0e-27
WP_110843859.1|2951816_2953388_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.9	5.8e-170
WP_000624622.1|2953407_2953755_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2953754_2954432_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_110844130.1|2954393_2954627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000624722.1|2954623_2954974_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_110844132.1|2955004_2956618_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	3.0e-182
>prophage 10
NZ_CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	2991072	3054040	5213052	tRNA,transposase,protease,integrase	Vibrio_phage(14.29%)	57	2989670:2989684	3049715:3049729
2989670:2989684	attL	ATGCTGGCGGAAAAA	NA	NA	NA	NA
WP_000811566.1|2991072_2991348_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001295190.1|2991464_2993090_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943964.1|2993173_2994337_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_000101685.1|2994339_2994978_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|2994987_2995386_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012550.1|2995403_2996063_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|2996113_2996812_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|2996830_2997232_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|2997358_2998090_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076332.1|2998269_3000711_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
WP_001177644.1|3000749_3001175_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|3001379_3002678_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|3002781_3002979_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|3003060_3004065_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|3004067_3005327_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|3005412_3006693_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|3006768_3007077_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|3007162_3008113_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122513.1|3008105_3009953_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	2.6e-60
WP_000990333.1|3009962_3011300_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|3011318_3011780_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001355561.1|3011751_3013299_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294219.1|3013297_3014437_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|3014419_3014473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|3015215_3015761_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|3015855_3016908_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934920.1|3017004_3017973_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236847.1|3017994_3021318_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001300174.1|3021467_3022970_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004770.1|3023188_3024166_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	1.2e-27
WP_001192973.1|3024490_3026299_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|3026291_3027026_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_000208757.1|3027036_3027432_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000609663.1|3027442_3027802_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001300820.1|3027864_3028998_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238369.1|3029086_3029620_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|3029616_3029934_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|3030108_3030255_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|3030365_3030491_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|3030542_3031109_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940528.1|3031150_3032179_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008049.1|3032573_3033443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558209.1|3033635_3033989_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|3034126_3035773_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|3035816_3036110_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015821.1|3036385_3037642_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|3037657_3038134_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|3038470_3039907_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|3040024_3041326_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000883400.1|3041441_3041780_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_110844136.1|3041755_3043453_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|3043489_3044065_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_077521113.1|3044444_3045707_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.6	8.4e-79
WP_110844138.1|3045972_3047246_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.2e-170
WP_097312866.1|3047494_3051010_+	ATP-binding protein	NA	NA	NA	NA	NA
3049715:3049729	attR	ATGCTGGCGGAAAAA	NA	NA	NA	NA
WP_097312865.1|3051118_3052618_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001352368.1|3052831_3054040_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 11
NZ_CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	3498665	3566657	5213052	transposase,integrase,holin	Staphylococcus_phage(18.18%)	58	3520973:3521032	3573307:3574636
WP_064149665.1|3498665_3499874_-|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	9.6e-48
WP_016243364.1|3502425_3503535_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.0	3.3e-26
WP_000632657.1|3503709_3503844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000742442.1|3503891_3505124_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000022200.1|3505186_3506494_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_000079398.1|3506504_3507356_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_000819837.1|3507360_3508563_+	galactosidase	NA	NA	NA	NA	NA
WP_001031684.1|3508594_3510652_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_000254058.1|3510715_3511030_+	PTS transporter subunit EIIB	NA	NA	NA	NA	NA
WP_001098396.1|3511166_3512438_-	maltoporin	NA	NA	NA	NA	NA
WP_000837747.1|3512708_3513779_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	42.2	5.1e-69
WP_001310574.1|3514529_3515177_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_089518216.1|3515961_3516279_+	toxin	NA	NA	NA	NA	NA
WP_032083213.1|3516275_3516764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839228.1|3516775_3516973_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001280536.1|3517057_3517906_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000144689.1|3517998_3519318_-|integrase	site-specific integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	23.4	1.5e-17
WP_000687184.1|3519655_3520555_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
3520973:3521032	attL	CTGAGAGATCCCCTCATAATTTCCCCAAAACGTAACCATGTGTGAATAGATTTTGAGTAA	NA	NA	NA	NA
WP_001352368.1|3520985_3522194_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000074139.1|3522423_3522672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019920.1|3522718_3523333_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|3523579_3523909_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001695467.1|3524221_3524932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001265646.1|3524900_3526544_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_110844175.1|3526533_3529059_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000716386.1|3529084_3529753_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|3529810_3530398_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000389022.1|3530472_3531015_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147284.1|3531838_3532030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|3532099_3532240_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|3532239_3532503_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|3532855_3532957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110844177.1|3533430_3534573_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_000860021.1|3534816_3535737_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001307603.1|3535893_3536820_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000910716.1|3537020_3537914_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001172291.1|3537944_3538934_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_001174462.1|3538960_3539812_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	4.4e-47
WP_089518217.1|3540377_3544634_+	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000621021.1|3544773_3545625_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021556518.1|3545872_3546742_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_001306921.1|3546901_3547495_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474077.1|3547506_3547743_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_024257800.1|3547851_3549177_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	4.2e-113
WP_089518218.1|3549402_3550257_+	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001102100.1|3550783_3551503_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023919.1|3551513_3552941_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000370398.1|3552933_3553629_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_023154347.1|3553871_3554540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071826456.1|3554721_3555915_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001213049.1|3557060_3557822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312575.1|3557975_3558770_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001362381.1|3559099_3559663_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.7	1.8e-52
WP_024257799.1|3559907_3560042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001159084.1|3560719_3562408_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	2.1e-61
WP_110844179.1|3562421_3563894_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001301903.1|3563907_3564495_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|3564623_3566657_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
3573307:3574636	attR	TTACTCAAAATCTATTCACACATGGTTACGTTTTGGGGAAATTATGAGGGGATCTCTCAGCGTCGAGCAGGCATTTGTGGCGATGGCGACCGAAATGAACAAAGGTGTGCTGAAAAATTTAGGACTGCTGACGCCGGAGCTGGAACAGGCGAAAAACGGCGACCTGATGATTGTCATCAATGGTAAATCGGGGGCGGACAACGAGCAGTTGCTGGTGGAGATTGAAGAACTGTTCAACAGCAAAGCGCAAAGCGGCTCGCACGAGGCGCGTTACGCCACTATTGCCAGCGCCAAAAAGCATATCCCGGAAAGTAACCTGGCGGTGATTTCGGTCAACGGTCTGTTTGCCGCTCGCGAAGCGCGTCAGGCGCTGCAAAACGATCTCAACGTGATGCTGTTTTCCGATAACGTCTCGGTTGAAGATGAACTGGCGCTCAAGCAACTGGCCCACGAAAAAGGGCTGCTGATGATGGGGCCAGACTGTGGCACGGCGATTATCAACGGCGCGGCGCTCTGTTTTGGTAACGCCGTGCATCGCGGCAACATCGGTATTGTTGGCGCATCCGGCACCGGCAGCCAGGAGCTGAGCGTCCGCATTCATGAATTTGGTGGCGGCGTTTCACAACTGATTGGCACCGGCGGGCGCGACCTGAGCGAGAAAATCGGCGGCCTGATGATGCTCGACGCCATCGGGATGCTGGAAAACGATCCGCAAACTGAAATTATCGCGCTGATTTCAAAACCTCCCGCGCCTGCGGTGGCCCGTAAAGTGCTGGAACGCGCCCGCGCCTGCCGCAAGCCGGTGGTGGTCTGCTTCCTCGGTCGTGGCGAAACGCCGGTTGACGAGCAGGGGCTACAGTTTGCTCGCGGCAGCAAAGAAGCGGCGCTAAAAGCGGTGATGCTCTCCGGCGTGAAACAGGAAAATCTCGACCTGCATACGCTTAACCAGCCGTTGATTGCGGATGTGCGTGCGCGTCTGCAACCGCAGCAGAAATACATTCGTGGCCTGTTCTGCGGCGGCACGTTGTGCGACGAAACCATGTTCGCGGTGATGGAAAAACATGGCGATGTCTACAGCAACATTCAGCCCGATCCGGAATTCCGCCTGAAAGATATCAACCGCAGCATCAAACACACCTTCCTCGACTTTGGCGATGACGACTTCACCAACGGCAAGCCGCATCCAATGATTGACCCCACCAACCGCATCAGTCGCTTGCTCGAAGAGGCGCGCGATCCAGAAGTGGCGGTGATCGTGATGGATTTTGTGCTCGGATTTGGATCGCATGAAGATCCGGTCGGCTCCACCATCGAGGCGATCAAAGAAGCG	NA	NA	NA	NA
>prophage 12
NZ_CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	3763117	3869993	5213052	transposase,head,lysis,integrase,tail,tRNA,capsid,protease	Enterobacteria_phage(41.67%)	105	3818714:3818760	3836414:3836460
WP_001295836.1|3763117_3763741_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|3763711_3764398_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_110844199.1|3764394_3766809_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_110844201.1|3767238_3771519_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.6	1.9e-21
WP_000877768.1|3771558_3771927_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|3772617_3772878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|3774109_3775204_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_110844202.1|3775272_3776199_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|3776428_3776911_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|3776988_3777804_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001355653.1|3777893_3779675_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_110844204.1|3779687_3780464_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_110844206.1|3780563_3781442_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_110844208.1|3781610_3783065_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|3783124_3784486_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|3784542_3785844_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_000706355.1|3785865_3787011_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
WP_110844210.1|3787238_3787982_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_110844212.1|3788196_3789426_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	1.3e-132
WP_162616997.1|3789489_3789723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032354309.1|3789800_3789989_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	4.5e-13
WP_110844214.1|3790041_3791142_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_110844216.1|3791134_3791503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110844218.1|3791492_3791945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110844220.1|3791946_3792180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110844222.1|3792185_3792485_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_110844224.1|3792481_3793888_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	55.6	5.6e-108
WP_110844226.1|3794089_3794458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110844228.1|3794461_3794704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110844230.1|3794700_3795111_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_096996089.1|3795121_3795394_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_029400540.1|3795634_3795841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089623523.1|3795840_3796896_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.9	1.0e-69
WP_089623524.1|3796907_3797243_+|head	head decoration protein	head	NA	NA	NA	NA
WP_110844232.1|3797255_3797669_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_097680335.1|3797831_3798272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110844234.1|3798565_3798847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001468137.1|3799280_3800516_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703918.1|3800537_3801587_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_001306952.1|3803579_3804395_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855376.1|3804391_3805285_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815566.1|3805479_3806547_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001351650.1|3806543_3807053_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212253.1|3807170_3807893_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|3807895_3808390_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|3808563_3809949_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143558.1|3809984_3810506_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|3810613_3810826_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|3810827_3811694_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|3812164_3812707_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988365.1|3812926_3813619_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001529553.1|3813649_3816259_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|3816237_3817278_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255226.1|3817288_3817804_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805422.1|3817806_3818439_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
3818714:3818760	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_110844236.1|3818773_3819937_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	1.2e-199
WP_110844238.1|3819792_3820164_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	1.2e-46
WP_000488419.1|3820135_3820414_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	98.9	1.7e-48
WP_000763373.1|3820461_3820680_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_001386642.1|3820778_3821060_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_110844240.1|3821127_3821766_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.0	1.6e-110
WP_000145931.1|3821762_3822053_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000736903.1|3822126_3822567_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000153280.1|3822563_3823091_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254223.1|3823087_3823264_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_141085703.1|3823266_3823608_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	95.6	4.7e-61
WP_024196353.1|3823600_3823795_+	protein ninF	NA	NA	NA	NA	NA
WP_001099705.1|3823814_3824177_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	9.5e-60
WP_001393963.1|3824173_3824314_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	65.1	3.6e-07
WP_001204791.1|3824399_3824783_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_001352368.1|3825946_3827155_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000839596.1|3827981_3828197_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135280.1|3828196_3828694_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_001228695.1|3828910_3829093_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|3829183_3829477_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001415975.1|3829836_3830031_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_110844244.1|3830419_3830965_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	8.9e-94
WP_001395371.1|3831375_3832068_+	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	41.8	1.1e-40
WP_000654156.1|3832064_3832346_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_000355602.1|3833069_3833363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000386784.1|3834038_3834788_+	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_001201820.1|3835036_3835990_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177481.1|3836503_3837265_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3836414:3836460	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224564.1|3837447_3838338_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001300620.1|3838338_3841311_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383906.1|3841423_3843535_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420966.1|3843805_3844942_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001300892.1|3845906_3846068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000889443.1|3846193_3846454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001160804.1|3851023_3851485_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_110844245.1|3851512_3853414_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.5	1.2e-25
WP_000253838.1|3854150_3855599_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000770953.1|3855588_3856272_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000074234.1|3856428_3857802_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709870.1|3857959_3858292_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000717157.1|3858307_3859531_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000573945.1|3859542_3862686_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000786320.1|3862787_3864164_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_001153148.1|3864231_3865479_-	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000351480.1|3865586_3866240_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360951.1|3866333_3866702_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682524.1|3866766_3867015_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_001130653.1|3867080_3868199_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000956455.1|3868651_3868804_+	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001393886.1|3868880_3869993_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	4066836	4081828	5213052	lysis,protease,integrase	Enterobacteria_phage(62.5%)	19	4066749:4066763	4082469:4082483
4066749:4066763	attL	GCTTTTTTATACTAA	NA	NA	NA	NA
WP_160508349.1|4066836_4067355_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	6.8e-43
WP_000372937.1|4067429_4067573_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|4067541_4067706_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065374.1|4067778_4068147_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001066169.1|4068407_4068989_+	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_001358311.1|4069005_4069278_-	hypothetical protein	NA	K7PH69	Enterobacterial_phage	96.7	4.0e-26
WP_001095981.1|4069590_4070241_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	98.6	4.1e-122
WP_001204777.1|4070503_4070881_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000780581.1|4071036_4071561_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_000592543.1|4071753_4072713_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_001146308.1|4073064_4073796_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000839596.1|4073983_4074199_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135263.1|4074198_4074696_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.0	9.3e-90
WP_001228696.1|4074912_4075098_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001393986.1|4075294_4076752_+	trk system potassium uptake protein trkG	NA	NA	NA	NA	NA
WP_110844253.1|4076889_4078722_+	ParB N-terminal domain-containing protein	NA	A5LH43	Enterobacteria_phage	98.1	1.6e-275
WP_001171282.1|4079029_4079992_-	hypothetical protein	NA	A0A0A7NV63	Enterobacteria_phage	91.1	4.0e-174
WP_001378636.1|4080096_4080291_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.3	2.3e-28
WP_110844254.1|4080496_4081828_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	2.5e-20
4082469:4082483	attR	GCTTTTTTATACTAA	NA	NA	NA	NA
>prophage 14
NZ_CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	4163204	4275851	5213052	transposase,protease,tRNA,portal,lysis,terminase,integrase,plate,head,capsid,tail	Salmonella_phage(36.26%)	137	4163989:4164005	4223736:4223752
WP_000290937.1|4163204_4164257_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
4163989:4164005	attL	ACCATCAACAGCAATTT	NA	NA	NA	NA
WP_021574262.1|4164339_4166016_-	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	66.8	9.8e-83
WP_110844263.1|4166036_4166633_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	1.4e-39
WP_000188448.1|4166728_4166950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460892.1|4166982_4167492_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956192.1|4167499_4167796_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000996717.1|4167913_4168255_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_110844264.1|4168322_4168556_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	5.4e-32
WP_000752610.1|4168555_4168783_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001544405.1|4168779_4169637_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
WP_110844265.1|4169633_4172048_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.3	0.0e+00
WP_001154434.1|4172201_4172390_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|4172400_4172634_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000834899.1|4172793_4173219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061103562.1|4173862_4174429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061103559.1|4174422_4174923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110844266.1|4174909_4176814_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_061103558.1|4176879_4177905_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.4	1.9e-169
WP_001098431.1|4177904_4179671_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_061103557.1|4179813_4180647_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	84.1	7.7e-121
WP_000742510.1|4180663_4181722_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_110844267.1|4181725_4182376_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	3.3e-111
WP_061103555.1|4182471_4182936_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	87.7	2.1e-75
WP_000868175.1|4182935_4183139_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|4183142_4183358_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069908.1|4183338_4183854_+	lysozyme	NA	E5G6N1	Salmonella_phage	93.0	5.6e-90
WP_110844268.1|4183850_4184279_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	88.7	6.8e-57
WP_021537400.1|4184433_4185006_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	3.6e-85
WP_024191230.1|4185077_4185539_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.6	1.4e-34
WP_021537398.1|4185545_4186160_-|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	61.0	2.9e-61
WP_077461952.1|4186159_4187923_-	short-chain fatty acid transporter	NA	M1TAS6	Escherichia_phage	41.9	1.9e-36
WP_000138756.1|4187925_4188504_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001219101.1|4188496_4189600_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	8.3e-107
WP_000859111.1|4189590_4189938_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_001404342.1|4189992_4190589_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.7	3.2e-36
WP_021537395.1|4190585_4191740_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.8	1.9e-85
WP_012602373.1|4191727_4191943_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_021537394.1|4191939_4192824_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	48.4	1.0e-51
WP_021547582.1|4192823_4195775_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.8	3.7e-85
WP_085959828.1|4195850_4196009_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_015365642.1|4195932_4196268_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_021537392.1|4196365_4196647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034294.1|4196649_4197171_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_021537391.1|4197170_4198598_-	hypothetical protein	NA	A4JWK5	Burkholderia_virus	76.1	1.0e-213
WP_032155708.1|4198587_4198842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021537389.1|4198838_4199303_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	8.2e-40
WP_021537388.1|4199302_4199749_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	51.7	1.3e-34
WP_021537387.1|4199750_4200086_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_021537386.1|4200096_4201050_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	40.8	1.9e-59
WP_021547581.1|4201059_4202175_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	5.5e-98
WP_021537384.1|4202389_4202848_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	9.9e-30
WP_021537383.1|4202850_4203672_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	60.1	7.1e-95
WP_110844269.1|4203652_4205149_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.8	6.1e-169
WP_110844270.1|4205148_4206672_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.5	1.4e-184
WP_016234467.1|4206668_4207211_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	50.8	7.1e-43
WP_000227702.1|4207213_4207525_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	3.0e-30
WP_000175097.1|4207524_4207851_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_061092910.1|4207847_4208498_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.5	9.5e-10
WP_061092909.1|4208481_4209222_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.9	2.2e-63
WP_061092908.1|4209224_4209575_-	hypothetical protein	NA	A4JWP3	Burkholderia_virus	59.8	1.3e-21
WP_060614795.1|4209707_4210451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001069609.1|4210504_4210720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016235482.1|4210911_4211676_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_061092906.1|4211792_4212140_-	helix-turn-helix transcriptional regulator	NA	Q5ZQZ8	Pseudomonas_phage	50.6	1.2e-16
WP_021518100.1|4212233_4212422_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	1.8e-17
WP_000047758.1|4212475_4212784_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	3.5e-23
WP_061092905.1|4212794_4213712_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.0	6.3e-76
WP_110844271.1|4213711_4214029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110844272.1|4214044_4215814_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.6	4.0e-228
WP_021537366.1|4215824_4216991_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	1.7e-121
WP_000843446.1|4216993_4217263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|4217290_4217821_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_021519404.1|4218109_4218382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299260.1|4218391_4218688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763554.1|4218702_4218918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061092902.1|4218914_4219598_+	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	36.7	1.0e-25
WP_061092901.1|4219594_4219825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072275307.1|4219814_4220030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061092900.1|4220019_4220472_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	2.8e-24
WP_001281696.1|4220443_4220842_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	55.9	3.9e-30
WP_000460689.1|4220956_4221589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001039944.1|4221975_4222407_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	4.4e-72
WP_000829122.1|4222399_4222846_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	5.1e-63
WP_000993775.1|4222914_4223493_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000177590.1|4223489_4223849_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
4223736:4223752	attR	ACCATCAACAGCAATTT	NA	NA	NA	NA
WP_000268280.1|4223835_4224744_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	7.8e-143
WP_001086824.1|4224736_4225342_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	1.8e-111
WP_048943249.1|4225338_4226697_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	79.3	8.9e-151
WP_032349848.1|4226698_4227139_+|tail	phage tail fiber protein	tail	A0A0F7LDZ0	Escherichia_phage	59.9	8.9e-44
WP_021549529.1|4227110_4227713_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	92.5	2.4e-100
WP_075699518.1|4227712_4228252_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	64.1	4.6e-58
WP_000905032.1|4228282_4228849_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_000046120.1|4228991_4230164_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_001207660.1|4230173_4230689_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|4230743_4231046_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|4231060_4231180_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_110844273.1|4231172_4234250_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.2	0.0e+00
WP_000980391.1|4234246_4234732_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_069684323.1|4234728_4235829_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	1.9e-175
WP_000972391.1|4235919_4236138_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|4236373_4238059_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|4238328_4238706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195240.1|4238735_4238993_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|4239152_4239440_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000684321.1|4240205_4241108_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|4241195_4241672_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126073.1|4242022_4243135_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996005.1|4243229_4244363_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001093854.1|4244372_4245326_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061665.1|4245322_4246168_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|4246227_4246716_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149756.1|4246756_4247884_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_001295339.1|4248082_4248814_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|4249104_4249773_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|4249772_4250489_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|4250495_4251227_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|4251244_4251973_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270734.1|4252190_4252706_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|4252831_4253155_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255167.1|4253151_4253982_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001338420.1|4253978_4254992_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099205834.1|4255090_4256521_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566372.1|4256531_4257533_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815362.1|4257569_4259288_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000178677.1|4259420_4260389_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458809.1|4260400_4262053_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|4262196_4263096_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|4263590_4264286_-	aquaporin Z	NA	NA	NA	NA	NA
WP_110844274.1|4264711_4266370_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_162616999.1|4266366_4267323_-	DUF535 family protein	NA	NA	NA	NA	NA
WP_000746460.1|4267473_4268589_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188180.1|4268585_4270532_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_001351689.1|4270604_4270829_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4271151_4271472_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934034.1|4271502_4273779_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.1e-166
WP_001040187.1|4274643_4274862_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241677.1|4275146_4275851_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	4790613	4829908	5213052	transposase	Escherichia_phage(20.0%)	37	NA	NA
WP_110844306.1|4790613_4791120_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	8.7e-43
WP_001355499.1|4791127_4792336_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	1.4e-208
WP_071597387.1|4792375_4793590_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429133.1|4793642_4794179_+	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_001355676.1|4794251_4796213_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	3.5e-23
WP_000494244.1|4796304_4796535_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|4796756_4796933_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270286.1|4796978_4797395_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760586.1|4797473_4798880_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047424.1|4799124_4800270_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220399.1|4800287_4801301_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	55.4	1.1e-25
WP_001251313.1|4801301_4802243_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000555458.1|4802232_4803027_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001163875.1|4803048_4804473_+	aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001303494.1|4804569_4804665_-	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_000061178.1|4804859_4805033_+	orphan toxin OrtT	NA	NA	NA	NA	NA
WP_000018633.1|4805118_4805352_+	YdcY family protein	NA	NA	NA	NA	NA
WP_001076535.1|4805352_4805802_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001351727.1|4805798_4806317_-	L-methionine sulfoximine/L-methionine sulfone acetyltransferase	NA	NA	NA	NA	NA
WP_000531453.1|4806496_4807534_+	NADPH-dependent curcumin/dihydrocurcumin reductase	NA	NA	NA	NA	NA
WP_001299369.1|4807731_4808397_+	DNA-binding transcriptional regulator McbR	NA	NA	NA	NA	NA
WP_097562303.1|4808432_4810535_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	5.3e-134
WP_000550695.1|4810776_4811838_+	YncE family protein	NA	NA	NA	NA	NA
WP_001300590.1|4811950_4813450_-	L-asparagine permease	NA	NA	NA	NA	NA
WP_000169527.1|4814025_4814325_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|4814321_4815188_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000420959.1|4816340_4817477_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001120143.1|4817576_4817810_+	tautomerase PptA	NA	NA	NA	NA	NA
WP_000085899.1|4817806_4818376_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_000187919.1|4818548_4819394_+	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
WP_110844307.1|4819489_4820383_-	PhzF family isomerase	NA	NA	NA	NA	NA
WP_000617116.1|4820461_4821142_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_001166353.1|4821138_4821834_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702535.1|4821833_4823378_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
WP_110844308.1|4823374_4827115_-	nitrate reductase Z subunit alpha	NA	NA	NA	NA	NA
WP_110844309.1|4827196_4828585_-	nitrate/nitrite transporter NarU	NA	NA	NA	NA	NA
WP_023486738.1|4828939_4829908_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	6.5e-172
>prophage 16
NZ_CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	4869685	4936421	5213052	transposase,tail,integrase	Enterobacteria_phage(20.0%)	60	4924773:4924787	4934989:4935003
WP_110843859.1|4869685_4871257_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.9	5.8e-170
WP_110844312.1|4871348_4874462_-	chromate transporter	NA	NA	NA	NA	NA
WP_001706973.1|4875187_4875994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086929.1|4876421_4877972_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001059072.1|4877955_4878831_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001125439.1|4879605_4880928_-	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001301023.1|4880927_4881194_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_001083595.1|4881416_4882817_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	4.0e-106
WP_000113148.1|4887367_4888960_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_000154352.1|4889038_4889992_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194916.1|4890240_4891776_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	3.4e-21
WP_000911166.1|4891769_4892798_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222729.1|4892797_4893790_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_110844314.1|4893801_4894824_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774183.1|4894850_4895726_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558527.1|4895749_4896040_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001286597.1|4896096_4896855_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_001351738.1|4896858_4897773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854633.1|4897979_4899431_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000558029.1|4899657_4901076_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.9e-18
WP_001191027.1|4901214_4901574_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|4901573_4902500_-	glutaminase B	NA	NA	NA	NA	NA
WP_000156615.1|4902563_4903952_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366501.1|4904052_4904934_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000258598.1|4905011_4906127_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|4906276_4907467_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_110844315.1|4907491_4908157_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000268704.1|4908277_4908562_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000273128.1|4908551_4908872_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	42.3	7.2e-19
WP_000843419.1|4909091_4909526_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|4909546_4909930_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803653.1|4909961_4910180_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000087211.1|4910210_4911110_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054175.1|4911304_4912492_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|4912618_4912714_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592802.1|4912932_4913823_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	6.2e-20
WP_000671737.1|4914077_4914470_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024558.1|4914747_4915266_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000210373.1|4915309_4917355_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|4917491_4918238_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|4918326_4919013_+	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000214712.1|4919189_4919393_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527809.1|4919427_4920888_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_050010220.1|4920976_4922260_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|4922863_4922977_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|4923045_4923279_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|4923596_4924187_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885584.1|4924284_4924860_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	8.5e-103
4924773:4924787	attL	CGTCACCTTCACCAA	NA	NA	NA	NA
WP_110844316.1|4924859_4925804_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	71.4	1.9e-38
WP_048339841.1|4927124_4927319_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	53.7	8.2e-10
WP_000876998.1|4927353_4928634_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	7.8e-157
WP_001389342.1|4928635_4928764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110844317.1|4928821_4929841_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	2.8e-16
WP_001295394.1|4929852_4931067_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|4931272_4931599_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|4931733_4932075_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|4932109_4932670_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|4932672_4933383_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|4933490_4933796_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041675.1|4933994_4936421_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
4934989:4935003	attR	TTGGTGAAGGTGACG	NA	NA	NA	NA
>prophage 1
NZ_CP029742	Escherichia coli strain AR_0085 plasmid unnamed1, complete sequence	139740	56029	113316	139740	transposase,integrase	Enterobacteria_phage(22.22%)	53	51630:51644	68860:68874
51630:51644	attL	GGTCTGCCGCTGTTC	NA	NA	NA	NA
WP_021532708.1|56029_57199_-|integrase	site-specific integrase	integrase	B5WZU7	Pseudomonas_phage	44.0	1.1e-48
WP_077891451.1|57535_58813_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_106631246.1|58809_59460_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_021532704.1|59476_59953_-	lytic transglycosylase domain-containing protein	NA	A0A0A8J856	Ralstonia_phage	37.0	1.3e-08
WP_021532703.1|60011_60548_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_072661742.1|60597_61698_-	type II secretion protein F	NA	NA	NA	NA	NA
WP_106631238.1|61699_63208_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_021547655.1|63304_63901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021532699.1|63996_64551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021532698.1|64599_65052_-	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
WP_106631237.1|65041_66337_-	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_021532696.1|66357_67977_-	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
WP_106631236.1|68007_68445_-	type IV pilus biogenesis protein PilM	NA	NA	NA	NA	NA
WP_021532694.1|68449_69520_-	hypothetical protein	NA	NA	NA	NA	NA
68860:68874	attR	GGTCTGCCGCTGTTC	NA	NA	NA	NA
WP_086795421.1|70233_70551_-	PilI type IV pilus biogenesis protein	NA	NA	NA	NA	NA
WP_110844349.1|70556_72251_-	flotillin family protein	NA	NA	NA	NA	NA
WP_106631233.1|72714_73988_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.6e-176
WP_000154146.1|74500_75166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021547665.1|75306_75948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106631244.1|76652_77516_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_065898644.1|78206_78374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045145550.1|78460_78712_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_032353555.1|78708_78996_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	48.4	3.8e-19
WP_045145547.1|79005_79293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021560313.1|80452_80899_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_032353553.1|81178_81772_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_045145541.1|82625_83813_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032353961.1|83812_84178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032353959.1|84587_85151_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_085948335.1|86560_87774_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	95.9	2.0e-162
WP_001034046.1|88335_88752_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261278.1|88748_88979_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032353458.1|91109_91778_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_001442105.1|91783_92644_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000865634.1|92738_94298_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_053287902.1|94294_95719_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_032353537.1|95711_96668_+	carbamate kinase	NA	NA	NA	NA	NA
WP_001696803.1|96684_97074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024188138.1|97096_98320_+	cytosine permease	NA	NA	NA	NA	NA
WP_000470711.1|98397_99288_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032354229.1|99721_100111_+	cytochrome B562	NA	NA	NA	NA	NA
WP_021534910.1|101220_102084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077250632.1|102343_102523_-	Hin recombinase	NA	NA	NA	NA	NA
WP_160377741.1|103559_104747_-	MFS transporter	NA	NA	NA	NA	NA
WP_000020503.1|104803_105565_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	8.8e-15
WP_032353476.1|105564_106602_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_032353474.1|106601_107600_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000427623.1|108185_109190_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000086536.1|109281_109872_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	5.6e-25
WP_106631289.1|110372_110657_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421257.1|110656_110932_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000612591.1|112657_113005_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_142907866.1|113001_113316_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	99.0	7.0e-51
>prophage 2
NZ_CP029742	Escherichia coli strain AR_0085 plasmid unnamed1, complete sequence	139740	127792	132895	139740	integrase	Escherichia_phage(33.33%)	8	117348:117362	135363:135377
117348:117362	attL	CTGGAAAAAGTGATG	NA	NA	NA	NA
WP_072157241.1|127792_128290_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	94.6	4.1e-53
WP_001536593.1|128426_128702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633911.1|128695_129340_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
WP_021580010.1|129568_130540_+	stable plasmid inheritance protein	NA	A0A222YXF2	Escherichia_phage	42.9	1.3e-66
WP_000340830.1|130544_130937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457496.1|130941_132213_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	1.4e-142
WP_000109071.1|132212_132650_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|132646_132895_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
135363:135377	attR	CTGGAAAAAGTGATG	NA	NA	NA	NA
>prophage 1
NZ_CP029743	Escherichia coli strain AR_0085 plasmid unnamed2, complete sequence	104555	6152	46877	104555	integrase,transposase	Salmonella_phage(15.38%)	42	958:978	43015:43035
958:978	attL	AACTTTCACATGTGAAAGTTT	NA	NA	NA	NA
WP_000608644.1|6152_7415_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000976514.1|7738_8884_+	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
WP_001221666.1|8977_9511_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
WP_000118520.1|9507_9825_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_004018134.1|9938_10358_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	95.9	2.2e-47
WP_000624710.1|10354_10705_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	3.6e-40
WP_110844009.1|10735_12349_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.4	1.1e-176
WP_110844352.1|12615_13053_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|13099_13804_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000350638.1|14188_16327_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000343085.1|16680_16938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194575.1|16937_17528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818556.1|17790_19347_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000521603.1|19537_20155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110844353.1|20447_21485_-	permease	NA	NA	NA	NA	NA
WP_001175594.1|21589_21913_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024159726.1|22013_22724_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.5	3.1e-94
WP_001286342.1|22732_23278_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011117603.1|23353_23716_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_011117602.1|23736_25494_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_011117601.1|25567_25936_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011117600.1|25998_26811_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_011117599.1|27022_27559_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001067858.1|27625_28330_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000575657.1|28584_28866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000949433.1|29164_29701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543934.1|29703_30714_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000997323.1|30718_31588_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
WP_000139717.1|31584_32076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342220.1|32121_32253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097010.1|32402_33278_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000101568.1|33439_34480_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_110844355.1|34766_36278_+	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
WP_001326396.1|36388_37429_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000256129.1|37430_38864_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_000534551.1|38876_42491_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_000683483.1|42528_42891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356489.1|43606_43879_+	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
43015:43035	attR	AAACTTTCACATGTGAAAGTT	NA	NA	NA	NA
WP_000790610.1|43878_44412_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000891157.1|44422_45031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001020646.1|45027_45579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064149665.1|45668_46877_+|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	9.6e-48
>prophage 1
NZ_CP029744	Escherichia coli strain AR_0085 plasmid unnamed3, complete sequence	117192	36603	79899	117192	protease,integrase,transposase	Macacine_betaherpesvirus(27.27%)	25	43620:43634	57500:57514
WP_000082154.1|36603_37575_+|transposase	IS110-like element ISEc32 family transposase	transposase	Q75QL1	Wolbachia_phage	32.1	1.1e-25
WP_000817028.1|39886_40858_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
WP_001238646.1|40857_42024_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
WP_000715078.1|43176_44679_-	hypothetical protein	NA	NA	NA	NA	NA
43620:43634	attL	ACTTCCAGTCATGAT	NA	NA	NA	NA
WP_000238252.1|45298_45748_-	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	67.1	5.0e-42
WP_000190053.1|45865_46345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968140.1|47628_48486_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000992806.1|48482_49340_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983710.1|49336_50164_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_000949004.1|50163_51078_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000361611.1|54059_55037_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_001066954.1|55321_56062_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_014640565.1|56182_56371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175738.1|56744_57653_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
57500:57514	attR	ACTTCCAGTCATGAT	NA	NA	NA	NA
WP_000771475.1|57715_58825_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000280980.1|59257_60211_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001332050.1|60314_60704_+|protease	outer membrane protease	protease	NA	NA	NA	NA
WP_001312823.1|61483_61642_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001189111.1|63237_64746_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001318220.1|67581_68697_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_001312839.1|68710_72496_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.3e-45
WP_000933675.1|72599_73829_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_000271276.1|73913_74870_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_001222186.1|74914_77092_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_001310555.1|78882_79899_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
