The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030174	Klebsiella pneumoniae subsp. pneumoniae strain 11219 chromosome, complete genome	5377145	1269190	1322977	5377145	tRNA,head,transposase,plate,terminase,holin	Escherichia_phage(12.73%)	72	NA	NA
WP_004143010.1|1269190_1270576_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|1270621_1270834_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|1270835_1271702_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_112162449.1|1273173_1273509_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_112162450.1|1273510_1273729_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	59.4	5.6e-15
WP_181566922.1|1273934_1274105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048986752.1|1274101_1274302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017898877.1|1274298_1274520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112162451.1|1274516_1275284_-	dcm methylase	NA	D5LH17	Escherichia_phage	51.8	1.6e-64
WP_112162452.1|1275280_1275808_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	3.2e-56
WP_065519921.1|1275836_1276460_-	YqaJ viral recombinase family protein	NA	A0A0S2SY31	Pseudomonas_phage	59.7	3.1e-58
WP_086618476.1|1276456_1277203_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	67.7	3.1e-65
WP_085841924.1|1277219_1277504_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	60.6	4.4e-28
WP_008807814.1|1277584_1277791_-	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_004219883.1|1277783_1277909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112150724.1|1278360_1279481_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.0	1.5e-50
WP_048980368.1|1279678_1279975_-	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	45.2	9.9e-15
WP_032442364.1|1280219_1280504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025269974.1|1280718_1281429_-	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	71.4	3.7e-92
WP_001548452.1|1281533_1281725_+	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	55.4	2.4e-09
WP_038435002.1|1281804_1282089_+	hypothetical protein	NA	K7PHN8	Enterobacterial_phage	56.2	1.3e-19
WP_112162899.1|1282172_1282901_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.0	2.3e-36
WP_048257879.1|1282897_1283674_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	64.6	3.3e-94
WP_004218528.1|1283673_1283976_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_112162453.1|1284517_1284922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_181566923.1|1284918_1285455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162837911.1|1285454_1285622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077266649.1|1285885_1286524_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	57.5	3.3e-39
WP_064161320.1|1286516_1286822_+	hypothetical protein	NA	Q7Y3Y0	Yersinia_phage	43.4	5.1e-14
WP_019704113.1|1287073_1287529_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	1.0e-55
WP_112162454.1|1287528_1287699_+	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	7.4e-15
WP_112162455.1|1287691_1288327_+	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	77.5	2.2e-80
WP_112162456.1|1288323_1288464_+	YlcG family protein	NA	NA	NA	NA	NA
WP_112162457.1|1288460_1289150_+	antiterminator	NA	I6PDF8	Cronobacter_phage	55.4	1.0e-62
WP_004146526.1|1290052_1290301_+|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_112162458.1|1290303_1290834_+	lysozyme	NA	G9L6J6	Escherichia_phage	79.1	2.7e-79
WP_065928395.1|1290830_1291220_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	49.2	1.5e-23
WP_086625994.1|1291678_1292314_+	hypothetical protein	NA	I6S676	Salmonella_phage	81.6	9.4e-103
WP_102855231.1|1292344_1292830_+	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	78.9	4.8e-67
WP_112162459.1|1292831_1294508_+|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	74.8	3.5e-250
WP_112162460.1|1294508_1296029_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.6	8.2e-105
WP_112162461.1|1296081_1296780_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	50.0	6.3e-60
WP_112162462.1|1296783_1297995_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.9	3.5e-58
WP_014342913.1|1297996_1298479_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	51.0	1.2e-33
WP_019724831.1|1298478_1299516_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.0	1.9e-84
WP_019724830.1|1299517_1299844_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.7	1.6e-10
WP_041937856.1|1299843_1300287_+	DUF4054 domain-containing protein	NA	A0A1X9SF97	Acinetobacter_phage	38.2	1.1e-12
WP_012542595.1|1300289_1300853_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	32.9	3.7e-18
WP_012542594.1|1300849_1301218_+	hypothetical protein	NA	Q6UJ26	Burkholderia_virus	29.8	2.8e-06
WP_012542593.1|1301199_1301751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112162463.1|1301754_1303236_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	39.5	1.7e-91
WP_023304864.1|1303235_1303679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112162464.1|1303858_1304416_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	85.3	1.3e-84
WP_025713742.1|1304496_1304973_+	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	29.8	5.5e-07
WP_112162465.1|1305177_1307136_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	38.1	4.4e-42
WP_112162466.1|1307139_1307979_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	33.3	1.5e-28
WP_112162467.1|1307980_1308286_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.5	2.1e-20
WP_112162468.1|1308282_1309152_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	28.9	1.5e-26
WP_087775389.1|1309141_1309732_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	23.4	7.6e-06
WP_181566924.1|1309743_1310124_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	46.2	2.1e-17
WP_001518114.1|1310186_1310543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112162469.1|1310550_1311783_+|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	50.7	6.7e-105
WP_102004623.1|1311775_1312363_+	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	43.4	2.9e-34
WP_112162470.1|1312364_1313408_+	hypothetical protein	NA	A0A077KC23	Edwardsiella_phage	41.5	4.4e-17
WP_181566925.1|1313417_1315853_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A2H4N7A3	Pectobacterium_phage	79.1	7.6e-52
WP_112162471.1|1315862_1317272_+	hypothetical protein	NA	A0A1D8KTD3	Synechococcus_phage	27.4	1.0e-16
WP_014386491.1|1317742_1318723_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_142674216.1|1318810_1319920_+	acyltransferase family protein	NA	C6ZR20	Salmonella_phage	25.5	4.7e-09
WP_065807526.1|1320008_1320248_-	DinI family protein	NA	K7P6H1	Enterobacteria_phage	85.7	6.1e-31
WP_064147714.1|1320321_1320648_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.7	2.8e-26
WP_004183235.1|1321297_1321582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088765928.1|1321856_1322977_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 2
NZ_CP030174	Klebsiella pneumoniae subsp. pneumoniae strain 11219 chromosome, complete genome	5377145	1797849	1807323	5377145	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_065889923.1|1797849_1798965_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_065889925.1|1798961_1800902_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	6.5e-38
WP_002896516.1|1800978_1801200_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1801525_1801843_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|1801873_1804153_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|1804283_1804502_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|1804855_1805557_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_112162495.1|1805601_1807323_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 3
NZ_CP030174	Klebsiella pneumoniae subsp. pneumoniae strain 11219 chromosome, complete genome	5377145	1888711	1959624	5377145	head,protease,integrase,tail,capsid,portal,plate,terminase	Enterobacteria_phage(40.0%)	75	1927256:1927276	1961441:1961461
WP_016529118.1|1888711_1890469_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002898404.1|1890654_1891107_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_002898408.1|1891238_1892309_-	porin OmpA	NA	NA	NA	NA	NA
WP_004179215.1|1892661_1893171_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_004150836.1|1893519_1894116_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_002898422.1|1894129_1896265_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_002898425.1|1896282_1896729_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_009485779.1|1896853_1898908_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.0	1.8e-14
WP_002898432.1|1898919_1899378_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002898434.1|1899532_1899946_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_002898441.1|1899975_1900293_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_004141630.1|1900352_1901555_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_065889942.1|1901745_1902300_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_004191090.1|1902317_1903106_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004150835.1|1903154_1903436_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002898457.1|1903432_1903762_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_004191089.1|1903850_1904510_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	47.1	1.1e-37
WP_048993461.1|1904779_1906432_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032421162.1|1907664_1907928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065889954.1|1908097_1909063_-	oxidoreductase	NA	NA	NA	NA	NA
WP_065889958.1|1909120_1910569_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002898571.1|1910587_1911712_-	ring-hydroxylating oxygenase subunit alpha	NA	NA	NA	NA	NA
WP_022615490.1|1911748_1913356_-	BCCT family transporter	NA	NA	NA	NA	NA
WP_023312925.1|1913810_1914896_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_004221441.1|1914978_1915941_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002898585.1|1915937_1917218_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_065889960.1|1917220_1918708_-	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
WP_002898590.1|1919028_1919586_-	HTH-type transcriptional regulator PuuR	NA	NA	NA	NA	NA
WP_020802183.1|1919611_1920364_-	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	NA	NA	NA	NA
WP_065889962.1|1920589_1922011_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_002898600.1|1923874_1923997_-	small membrane protein	NA	NA	NA	NA	NA
WP_002898602.1|1924253_1924475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004214503.1|1924495_1925284_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004141456.1|1925399_1925849_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065804272.1|1926001_1927249_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
1927256:1927276	attL	AAACCCGGAGCACTCCGGGTT	NA	NA	NA	NA
WP_032442294.1|1927345_1928353_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	52.8	6.9e-100
WP_032421664.1|1928440_1928743_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	55.0	1.3e-22
WP_004201487.1|1928838_1929171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087638608.1|1929380_1929560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032442293.1|1929571_1929811_+	DUF4754 family protein	NA	NA	NA	NA	NA
WP_032442422.1|1929813_1930086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279602.1|1930154_1930379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187206.1|1930375_1930954_+	3'-5' exoribonuclease	NA	A0A1Q1PW66	Pseudoalteromonas_phage	38.0	2.6e-27
WP_023279599.1|1931918_1932092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167876628.1|1932102_1932255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279597.1|1932277_1932439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032442292.1|1932415_1932793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112162499.1|1932791_1935398_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	51.9	1.2e-193
WP_064148541.1|1935551_1936931_-	hypothetical protein	NA	R9TRQ8	Vibrio_phage	28.0	3.8e-24
WP_032414438.1|1937336_1938389_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	67.2	4.2e-140
WP_112162501.1|1938391_1940113_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	66.2	4.8e-226
WP_032442290.1|1940273_1941107_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	64.8	2.1e-94
WP_032442289.1|1941130_1942180_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	53.9	5.1e-106
WP_032442288.1|1942226_1943087_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	68.4	4.5e-84
WP_032442287.1|1943189_1943687_+|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	69.7	2.2e-59
WP_004187236.1|1943686_1943887_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	64.6	3.0e-15
WP_004187237.1|1943877_1944159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032442286.1|1944155_1944707_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	41.9	2.6e-32
WP_032442285.1|1944703_1945099_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_032442284.1|1945243_1945702_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	45.5	3.4e-30
WP_004187250.1|1945698_1946340_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	49.8	1.4e-45
WP_032442283.1|1946339_1946924_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.8	1.1e-62
WP_004187254.1|1946920_1947289_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	57.4	2.3e-29
WP_032442282.1|1947275_1948175_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	62.2	3.6e-92
WP_032442281.1|1948167_1948776_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	46.9	5.0e-45
WP_032442280.1|1948772_1950947_+	hypothetical protein	NA	A0A0S1S0B7	Acinetobacter_phage	27.2	8.7e-15
WP_032442279.1|1950972_1951692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032442278.1|1951701_1952772_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	48.8	2.8e-30
WP_032442276.1|1952897_1953386_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	61.7	4.0e-53
WP_077254633.1|1953395_1956116_-|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	47.7	2.5e-128
WP_050554917.1|1956096_1956249_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	71.4	1.5e-11
WP_032414457.1|1956269_1956569_-	hypothetical protein	NA	B9A7B2	Serratia_phage	72.7	2.9e-30
WP_004187274.1|1956620_1957136_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	70.0	2.6e-63
WP_032442273.1|1957136_1958318_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7NV69	Enterobacteria_phage	69.6	8.0e-156
WP_032442272.1|1958469_1959624_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	73.9	1.1e-162
1961441:1961461	attR	AAACCCGGAGCACTCCGGGTT	NA	NA	NA	NA
>prophage 4
NZ_CP030174	Klebsiella pneumoniae subsp. pneumoniae strain 11219 chromosome, complete genome	5377145	2070961	2195670	5377145	tRNA,head,integrase,transposase,tail,capsid,portal,plate,terminase,holin	Enterobacteria_phage(25.97%)	131	2153434:2153451	2190425:2190442
WP_004150803.1|2070961_2072068_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004150802.1|2072124_2072583_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150801.1|2072599_2073250_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|2073490_2074741_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_110228966.1|2074858_2075986_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	58.4	4.4e-119
WP_012542206.1|2075966_2076212_-	excisionase	NA	NA	NA	NA	NA
WP_110228965.1|2076264_2078403_-	exonuclease	NA	S4TNL0	Salmonella_phage	42.9	4.7e-98
WP_014228879.1|2078544_2078889_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_063002092.1|2078931_2079126_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_025861419.1|2079942_2080332_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	64.3	5.5e-37
WP_004147982.1|2080467_2080689_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	75.3	1.2e-28
WP_017898969.1|2080691_2081246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_181566927.1|2081290_2082310_+	helix-turn-helix domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	45.3	7.4e-33
WP_110228964.1|2082302_2082767_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	71.5	9.0e-63
WP_065804438.1|2082780_2083221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112162509.1|2083483_2085121_+	CMP deaminase	NA	NA	NA	NA	NA
WP_162272086.1|2087101_2088589_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.5	5.0e-30
WP_012542186.1|2088667_2088901_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	1.7e-25
WP_077253592.1|2088912_2089203_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	1.4e-16
WP_049114843.1|2089243_2089636_+	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	4.7e-12
WP_112162511.1|2089835_2090867_+	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	49.6	6.2e-96
WP_110228974.1|2090879_2091227_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.5	3.7e-53
WP_064164892.1|2091245_2092130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023159888.1|2092139_2092652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017880269.1|2093923_2094139_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
WP_023279523.1|2094138_2094636_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	85.8	1.9e-79
WP_017898986.1|2094632_2094983_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.8	1.8e-10
WP_017898990.1|2096732_2097095_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	81.7	3.4e-57
WP_014228902.1|2097046_2097364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017898991.1|2097360_2097792_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.3	1.8e-41
WP_012542168.1|2098041_2098476_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_032418044.1|2098475_2100197_+|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	6.5e-191
WP_032418045.1|2100190_2100370_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	4.0e-11
WP_032418046.1|2100369_2101629_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.2	2.1e-223
WP_032418047.1|2101665_2102586_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	1.6e-148
WP_014228907.1|2102663_2103950_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	4.4e-216
WP_003031976.1|2104106_2104511_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
WP_000612626.1|2104507_2104855_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_004201219.1|2104903_2106442_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
WP_112162513.1|2106467_2106731_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	62.7	1.3e-21
WP_099501511.1|2106711_2107029_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	88.8	9.9e-45
WP_014228910.1|2107025_2107364_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_017880258.1|2107344_2107734_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_017898997.1|2107730_2108132_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
WP_040223142.1|2108163_2108625_+|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.0	3.9e-66
WP_014228914.1|2108682_2109048_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_040223148.1|2109280_2112637_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	86.5	0.0e+00
WP_017880254.1|2112636_2112975_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	6.4e-58
WP_040147639.1|2112971_2113727_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.1	3.0e-124
WP_040223141.1|2113728_2114439_+	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	88.5	7.4e-133
WP_099501515.1|2114485_2115313_+	hypothetical protein	NA	A0A0S2SY43	Pseudomonas_phage	44.7	4.8e-06
WP_040223139.1|2115329_2115923_+|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	80.2	8.2e-85
WP_112162515.1|2115985_2128150_+	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	49.4	0.0e+00
WP_025368254.1|2128218_2129715_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	6.4e-126
WP_004892953.1|2129869_2130022_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_065889993.1|2130294_2131008_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150798.1|2131004_2131397_-	amino acid-binding protein	NA	NA	NA	NA	NA
WP_008807712.1|2131389_2131713_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_020805510.1|2131832_2132009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004140530.1|2132162_2132390_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_065889995.1|2132502_2133696_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016831890.1|2133763_2134099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150795.1|2134318_2134504_+	general stress protein	NA	NA	NA	NA	NA
WP_065889997.1|2134594_2135089_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_040174366.1|2135115_2135622_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140512.1|2135638_2136526_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_021313534.1|2136581_2137988_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140509.1|2137984_2138995_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140506.1|2139110_2139308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004140501.1|2140545_2140725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|2141122_2141809_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_020804938.1|2141921_2142086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004140497.1|2142119_2143628_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_021313530.1|2143748_2144639_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032432901.1|2144645_2146430_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004140494.1|2146503_2147712_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004892909.1|2148014_2149058_+	type II asparaginase	NA	NA	NA	NA	NA
WP_004148038.1|2149719_2150634_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150783.1|2150723_2151362_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004140489.1|2151492_2151756_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|2151815_2151941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213093.1|2152058_2152133_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|2152132_2152234_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_021313528.1|2152291_2153302_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.1	2.4e-12
2153434:2153451	attL	AAAAAAAGCCCCGTCGGG	NA	NA	NA	NA
WP_032414463.1|2153536_2154550_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	79.4	3.8e-154
WP_032424825.1|2154665_2154965_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	74.7	2.7e-36
WP_020806130.1|2155085_2155364_+	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_023328080.1|2155384_2155603_+	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_009486498.1|2155618_2155996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328079.1|2156011_2156275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213098.1|2156352_2156577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031593599.1|2156573_2157140_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	1.2e-13
WP_112162517.1|2157372_2158308_+	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	53.8	6.4e-84
WP_112162519.1|2160806_2162189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099751683.1|2162190_2164341_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_023328073.1|2164942_2166004_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	4.8e-144
WP_047670732.1|2165997_2167725_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.3	2.4e-233
WP_112162521.1|2167880_2168720_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	3.3e-95
WP_048299350.1|2168729_2169764_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	8.1e-96
WP_112162523.1|2169813_2170671_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.4	7.5e-71
WP_047720963.1|2170783_2171299_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	4.1e-40
WP_004131559.1|2171298_2171499_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_004213110.1|2171489_2171774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064146776.1|2171770_2172316_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	7.4e-32
WP_158608812.1|2172502_2172838_+	peptidase	NA	B6SD31	Bacteriophage	34.4	4.3e-06
WP_064146775.1|2172838_2173306_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	7.0e-47
WP_064146774.1|2173302_2173938_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	52.4	1.6e-57
WP_064146773.1|2173934_2174522_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	2.6e-59
WP_004131573.1|2174518_2174869_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	59.3	6.2e-24
WP_112162524.1|2174870_2175794_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.2	2.9e-52
WP_064146772.1|2175783_2178810_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_009486478.1|2178806_2179019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064146771.1|2179018_2180116_+|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
WP_112162526.1|2180715_2181939_+	DUF262 domain-containing protein	NA	A0A1V0S9I8	Catovirus	27.5	7.8e-05
WP_064146770.1|2181956_2182619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064146769.1|2183081_2183555_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	67.6	1.3e-53
WP_112162528.1|2183569_2186545_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.5	1.3e-218
WP_071993210.1|2186531_2186669_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	65.9	5.8e-10
WP_004131585.1|2186689_2187007_-	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_064146767.1|2187052_2187568_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	60.6	6.3e-57
WP_064146766.1|2187567_2188740_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	1.1e-157
WP_032432765.1|2188894_2190034_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	71.0	1.6e-145
WP_004213128.1|2190077_2190329_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_004150780.1|2190593_2190833_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
2190425:2190442	attR	AAAAAAAGCCCCGTCGGG	NA	NA	NA	NA
WP_014343000.1|2190822_2191161_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_004150778.1|2191165_2191675_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004140471.1|2191820_2192513_+	CTP synthase	NA	NA	NA	NA	NA
WP_074442794.1|2192544_2193720_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004224197.1|2193827_2194622_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901080.1|2194605_2195052_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_021313525.1|2195169_2195670_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP030174	Klebsiella pneumoniae subsp. pneumoniae strain 11219 chromosome, complete genome	5377145	2286627	2378833	5377145	coat,integrase,protease,transposase,tail,capsid,terminase,holin	Enterobacteria_phage(22.95%)	105	2291398:2291415	2335667:2335684
WP_060578434.1|2286627_2287188_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_162882145.1|2288965_2289139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162882146.1|2289169_2289346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032435045.1|2289360_2290191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014386491.1|2290524_2291505_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
2291398:2291415	attL	ATTCTGCCATGGCAGAAT	NA	NA	NA	NA
WP_032435044.1|2291792_2292200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112162532.1|2292199_2292424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060578431.1|2292423_2292762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060578429.1|2293281_2293482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060578428.1|2293496_2293856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060578426.1|2293874_2294906_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_024623152.1|2295009_2295198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060578424.1|2295197_2297057_+	hypothetical protein	NA	A0A140G5Z0	Enterobacteria_phage	38.9	1.1e-66
WP_071961336.1|2297387_2297666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002901746.1|2297935_2298838_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_002901749.1|2298898_2299489_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_112162534.1|2299485_2300247_-	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_004148112.1|2300241_2300457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064145499.1|2300501_2301548_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_002901761.1|2301595_2301847_-	YciN family protein	NA	NA	NA	NA	NA
WP_002901763.1|2302253_2304851_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
WP_002901772.1|2305196_2306171_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_002901776.1|2306416_2306584_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_004176472.1|2306974_2309647_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_002901778.1|2309693_2310296_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
WP_002901779.1|2310459_2311227_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_002901780.1|2311362_2311671_+	LapA family protein	NA	NA	NA	NA	NA
WP_002901781.1|2311677_2312847_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_004151907.1|2313038_2313776_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_002901782.1|2313775_2314102_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_002901783.1|2314233_2314452_-	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_002901785.1|2314727_2315477_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002901786.1|2315548_2315728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065889041.1|2315885_2317820_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	4.1e-08
WP_065889039.1|2317901_2319059_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004140277.1|2319249_2320038_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004152967.1|2320236_2320779_-	HutD family protein	NA	NA	NA	NA	NA
WP_165453385.1|2321026_2322406_+	cytosine permease	NA	NA	NA	NA	NA
WP_004140269.1|2322450_2323260_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|2323261_2324254_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|2324253_2325144_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_012542039.1|2325290_2326508_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.6	3.3e-120
WP_004892750.1|2326728_2326968_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	70.1	8.0e-23
WP_012542038.1|2326975_2327284_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	4.2e-24
WP_181566928.1|2327280_2327946_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	62.2	1.3e-67
WP_112162538.1|2327980_2329069_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	55.7	1.8e-106
WP_112162540.1|2329081_2332183_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	58.0	7.9e-296
WP_023282477.1|2332320_2332476_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	71.2	2.0e-14
WP_004179600.1|2332484_2332676_-	YebW family protein	NA	NA	NA	NA	NA
WP_088765928.1|2333266_2334386_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_181566934.1|2334428_2334575_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	70.8	1.4e-09
WP_102004583.1|2334620_2335010_-	hypothetical protein	NA	A0A1V0E5P0	Salmonella_phage	56.0	2.4e-16
WP_142375678.1|2335027_2335495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|2335576_2336557_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
2335667:2335684	attR	ATTCTGCCATGGCAGAAT	NA	NA	NA	NA
WP_064154895.1|2336728_2337112_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	81.9	2.9e-51
WP_023282398.1|2337210_2337429_+	helix-turn-helix domain-containing protein	NA	K7PKS2	Enterobacteria_phage	64.8	8.9e-21
WP_102004572.1|2337431_2337968_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	68.9	4.8e-60
WP_181566929.1|2338315_2339233_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	65.8	3.7e-100
WP_112162544.1|2339229_2339973_+	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	55.2	1.4e-65
WP_016946299.1|2339965_2340301_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	4.4e-11
WP_112162546.1|2340293_2341085_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	1.1e-63
WP_102004569.1|2341077_2341647_+	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	58.5	3.2e-38
WP_102004568.1|2341643_2341823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040154944.1|2342444_2342705_+	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	70.9	9.0e-28
WP_181566930.1|2342701_2342893_+	hypothetical protein	NA	R9TNE4	Aeromonas_phage	78.3	1.7e-20
WP_040241897.1|2343051_2343279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184503.1|2343654_2343888_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_071557491.1|2343993_2344242_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	67.9	5.0e-28
WP_016946309.1|2344276_2344873_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.1	1.3e-90
WP_004892208.1|2345081_2345378_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	1.2e-36
WP_023282412.1|2345374_2345731_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.1	1.5e-41
WP_023287514.1|2345847_2346669_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.1e-98
WP_004146526.1|2346910_2347159_+|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004146527.1|2347161_2347692_+	lysozyme	NA	G9L6J6	Escherichia_phage	79.7	5.4e-80
WP_112162547.1|2347688_2348078_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	50.0	3.1e-24
WP_112162549.1|2348561_2348810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073545918.1|2348902_2349139_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	62.8	3.8e-17
WP_112162551.1|2349389_2350394_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	43.5	3.8e-34
WP_112162553.1|2350371_2351676_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	60.3	1.7e-146
WP_142674217.1|2352159_2352438_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	98.9	3.3e-44
WP_000612626.1|2352559_2352907_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_004201219.1|2352955_2354494_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
WP_112162555.1|2355549_2356662_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	53.0	2.6e-108
WP_048271641.1|2356765_2357530_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	62.2	1.3e-79
WP_112162557.1|2357617_2358754_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	74.6	7.7e-156
WP_112162559.1|2358803_2359106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112162561.1|2359109_2359520_+	protein singed	NA	A0A0H5AUF0	Pseudomonas_phage	41.2	7.1e-11
WP_112162563.1|2359521_2359755_+	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	50.8	4.4e-10
WP_065520084.1|2359741_2360125_+	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	44.4	6.0e-20
WP_012967909.1|2360126_2360678_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	5.9e-29
WP_004190640.1|2360674_2361067_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_112162565.1|2361090_2362263_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	26.6	6.1e-23
WP_023313117.1|2362317_2362800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121496572.1|2362937_2363135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032443396.1|2363202_2363724_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	57.3	8.1e-28
WP_112162566.1|2363816_2367176_+|tail	phage tail length tape measure family protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.6	3.4e-95
WP_101999421.1|2367175_2367649_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.9	1.9e-60
WP_112162568.1|2367635_2368118_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	96.9	9.6e-84
WP_048294606.1|2368127_2368508_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	98.4	5.1e-72
WP_112162570.1|2368504_2371573_+	kinase	NA	A0A286S259	Klebsiella_phage	97.7	0.0e+00
WP_112162573.1|2374054_2374978_+	hypothetical protein	NA	A0A1C9EHS8	Gordonia_phage	42.7	4.2e-19
WP_112162575.1|2375085_2375325_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	62.8	4.7e-23
WP_112162577.1|2375324_2375642_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.0	5.3e-22
WP_002901812.1|2377146_2377566_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_112162579.1|2377567_2378833_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.6	1.3e-209
>prophage 6
NZ_CP030174	Klebsiella pneumoniae subsp. pneumoniae strain 11219 chromosome, complete genome	5377145	2408464	2448836	5377145	head,protease,integrase,tail,capsid,portal,terminase,holin	Klebsiella_phage(40.48%)	48	2406545:2406559	2413762:2413776
2406545:2406559	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004176437.1|2408464_2409226_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.3e-21
WP_023282446.1|2409442_2410975_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_065889028.1|2411173_2411686_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_023304713.1|2411918_2413100_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.5	7.4e-202
WP_009309074.1|2413080_2413272_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	75.4	2.3e-20
WP_065889026.1|2413393_2413912_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	97.1	9.4e-93
2413762:2413776	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_065889024.1|2414016_2414844_-|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.0	1.2e-110
WP_009309071.1|2414840_2415035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032439899.1|2415031_2415457_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.2	7.8e-53
WP_029602968.1|2415643_2415898_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	91.7	6.1e-37
WP_023304721.1|2415890_2416256_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
WP_032442236.1|2416256_2416481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023304722.1|2416663_2417077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029602970.1|2417240_2417900_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	79.5	9.4e-98
WP_049245616.1|2418055_2418289_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	63.9	2.2e-17
WP_071889496.1|2419006_2420665_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.6	0.0e+00
WP_049245617.1|2420666_2421629_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.1	8.1e-183
WP_032439905.1|2421625_2422102_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	99.4	3.1e-90
WP_065889022.1|2422098_2422881_+	antitermination protein	NA	F1C595	Cronobacter_phage	77.1	3.6e-112
WP_004184721.1|2423034_2423292_+	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	100.0	1.3e-42
WP_071889498.1|2423197_2423644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031280382.1|2424255_2424555_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_004206700.1|2424551_2425091_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	99.4	5.1e-102
WP_004190674.1|2425087_2425432_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004190672.1|2425428_2425704_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_032442233.1|2426662_2426908_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	97.5	3.5e-34
WP_032442232.1|2426963_2427305_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	74.8	6.0e-48
WP_004177162.1|2427487_2427952_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	3.7e-48
WP_065890190.1|2427905_2429648_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.2	1.3e-141
WP_029603007.1|2429647_2430955_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.1	9.3e-214
WP_032442230.1|2430967_2431816_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	84.6	7.8e-129
WP_032422768.1|2431825_2433043_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.9	4.8e-196
WP_023341473.1|2433085_2433337_+	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	68.1	1.6e-10
WP_032442227.1|2433336_2433663_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	69.4	2.0e-40
WP_032442226.1|2433674_2434013_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	72.3	1.6e-40
WP_019705270.1|2434009_2434459_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_016530186.1|2434455_2434803_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_023313062.1|2434859_2435564_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	5.5e-80
WP_040200637.1|2435594_2435999_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	56.2	3.8e-33
WP_032442224.1|2436001_2436307_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	3.6e-28
WP_016530182.1|2436381_2436615_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_065890188.1|2436675_2440065_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.9	8.6e-304
WP_004177132.1|2440085_2440559_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_004864228.1|2440545_2441022_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_032408661.1|2441034_2441415_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	84.1	5.3e-61
WP_065890186.1|2441411_2444489_+	kinase	NA	A0A286S259	Klebsiella_phage	62.2	0.0e+00
WP_032442220.1|2446598_2447357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032442218.1|2447426_2448836_-	hypothetical protein	NA	A0A1D8KTD3	Synechococcus_phage	27.6	9.3e-18
>prophage 7
NZ_CP030174	Klebsiella pneumoniae subsp. pneumoniae strain 11219 chromosome, complete genome	5377145	2673593	2684481	5377145		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|2673593_2674214_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_065890093.1|2674206_2675472_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.5e-232
WP_040218163.1|2675483_2676386_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	1.0e-158
WP_002210513.1|2676647_2677409_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_001620095.1|2677429_2678290_-	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_004176262.1|2678587_2678848_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620097.1|2678934_2680023_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_065890091.1|2680053_2681319_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_065890088.1|2681373_2684481_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 8
NZ_CP030174	Klebsiella pneumoniae subsp. pneumoniae strain 11219 chromosome, complete genome	5377145	3322109	3406966	5377145	tRNA,head,protease,transposase,tail,capsid,plate,portal,terminase,holin	Klebsiella_phage(21.82%)	90	NA	NA
WP_002910404.1|3322109_3323366_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|3323636_3324248_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_004898981.1|3324247_3325096_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|3325279_3326227_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004189412.1|3326351_3328031_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
WP_002910436.1|3328031_3329078_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|3329299_3329575_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_004180389.1|3329847_3330432_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|3330549_3331641_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_023313351.1|3331723_3332053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910453.1|3332136_3333051_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032417284.1|3333182_3334598_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004152261.1|3334617_3335061_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004184604.1|3335063_3335600_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_072201031.1|3335580_3336597_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032434756.1|3336626_3338390_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032434757.1|3338523_3341934_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004180395.1|3341917_3343075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004175522.1|3343078_3343345_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032414274.1|3343574_3343901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029884249.1|3344566_3345460_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	29.8	3.6e-15
WP_004217423.1|3345481_3345598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162263613.1|3346183_3347152_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	5.9e-181
WP_181566931.1|3347153_3347480_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_032434761.1|3349901_3352388_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004891113.1|3354546_3355200_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004200314.1|3355196_3356537_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002910650.1|3357105_3357435_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002910652.1|3357549_3358089_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_032434764.1|3358114_3358813_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	5.3e-06
WP_002910657.1|3359003_3359486_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_112162643.1|3360460_3360778_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.0	6.9e-22
WP_112162645.1|3360777_3361017_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	49.4	1.4e-14
WP_112162573.1|3361125_3362049_-	hypothetical protein	NA	A0A1C9EHS8	Gordonia_phage	42.7	4.2e-19
WP_112162647.1|3364532_3367610_-	kinase	NA	A0A286S259	Klebsiella_phage	61.9	0.0e+00
WP_112162649.1|3367606_3367987_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	83.3	4.5e-60
WP_023302606.1|3367999_3368476_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	64.6	5.3e-50
WP_004884312.1|3368462_3368936_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
WP_112162651.1|3368957_3372536_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	61.6	3.0e-238
WP_004177136.1|3372598_3373120_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	45.2	1.7e-09
WP_032409576.1|3373194_3373491_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	63.9	2.5e-26
WP_029603010.1|3373502_3373907_-|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	56.2	3.2e-32
WP_004177145.1|3374541_3374889_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	60.2	8.9e-31
WP_004177147.1|3374885_3375335_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	83.2	3.9e-63
WP_032442226.1|3375331_3375670_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	72.3	1.6e-40
WP_032442227.1|3375681_3376008_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	69.4	2.0e-40
WP_032422768.1|3376328_3377546_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.9	4.8e-196
WP_032442230.1|3377555_3378404_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	84.6	7.8e-129
WP_029603007.1|3378416_3379724_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.1	9.3e-214
WP_065890190.1|3379723_3381466_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.2	1.3e-141
WP_004177162.1|3381419_3381884_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	3.7e-48
WP_032442232.1|3382066_3382408_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	74.8	6.0e-48
WP_032442233.1|3382463_3382709_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	97.5	3.5e-34
WP_112162653.1|3383667_3383943_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	49.4	4.1e-15
WP_112162655.1|3383939_3384284_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	79.8	6.7e-39
WP_004206700.1|3384280_3384820_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	99.4	5.1e-102
WP_031280382.1|3384816_3385116_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_112162656.1|3385598_3386645_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.6	1.0e-05
WP_032416155.1|3386827_3387274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031281242.1|3387179_3387437_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	98.8	2.8e-42
WP_068814875.1|3387937_3388537_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	58.9	1.1e-65
WP_112162658.1|3388533_3389178_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	78.1	1.3e-99
WP_112162660.1|3389174_3389936_-	dcm methylase	NA	D5LH17	Escherichia_phage	51.4	6.4e-66
WP_112162662.1|3389932_3390526_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	65.6	1.6e-43
WP_004184503.1|3390987_3391221_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_065806999.1|3391479_3391800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112162664.1|3392271_3392511_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	2.3e-09
WP_112162665.1|3392503_3392692_-	hypothetical protein	NA	R9TNE4	Aeromonas_phage	76.7	3.8e-20
WP_112162914.1|3392691_3393210_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	35.2	1.9e-08
WP_023339691.1|3393691_3393880_-	hypothetical protein	NA	A0A192Y8X2	Salmonella_phage	88.7	3.7e-23
WP_112162667.1|3393879_3394416_-	hypothetical protein	NA	A0A2H4N7C3	Pectobacterium_phage	53.6	3.4e-37
WP_112162669.1|3394612_3395209_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	47.6	9.6e-33
WP_112162671.1|3395205_3395991_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	54.1	6.0e-67
WP_023158880.1|3395983_3396205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032729773.1|3396204_3396600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064141957.1|3396612_3397353_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	71.6	3.6e-98
WP_112162673.1|3397355_3398237_-	conserved phage C-terminal domain-containing protein	NA	I6NW17	Burkholderia_virus	52.8	2.3e-30
WP_112162674.1|3398250_3398667_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	58.8	2.0e-29
WP_023297269.1|3398666_3398936_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032454806.1|3399007_3399493_+	helix-turn-helix domain-containing protein	NA	A0A0R6PH50	Moraxella_phage	46.8	2.9e-11
WP_172440509.1|3399697_3399850_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	72.5	1.2e-08
WP_087776132.1|3399936_3400413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101865564.1|3400386_3400569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112162676.1|3401048_3401342_+	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_023312753.1|3401867_3402092_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	60.8	1.5e-18
WP_112162680.1|3402088_3402838_+	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	60.3	2.3e-84
WP_019725112.1|3403056_3403299_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	81.3	2.0e-29
WP_021312745.1|3403346_3404609_+	DUF3596 domain-containing protein	NA	A0A286S1S8	Klebsiella_phage	95.0	1.7e-233
WP_004145468.1|3404849_3405659_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004152313.1|3405670_3406966_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
>prophage 9
NZ_CP030174	Klebsiella pneumoniae subsp. pneumoniae strain 11219 chromosome, complete genome	5377145	3580112	3640034	5377145	integrase,transposase	Stx2-converting_phage(26.67%)	57	3578004:3578058	3586488:3586542
3578004:3578058	attL	AAAAGCAAAAAGCCTGCTCGAAAGCAGGCTTCTTAAATTTGGCTCCTCTGACTGG	NA	NA	NA	NA
WP_004899245.1|3580112_3581381_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	9.7e-75
WP_032105408.1|3581530_3582253_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_112162708.1|3582264_3583161_-	oxidoreductase	NA	NA	NA	NA	NA
WP_004899254.1|3583237_3584122_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_112162711.1|3584121_3584979_+	EamA family transporter	NA	NA	NA	NA	NA
WP_071443891.1|3586785_3587889_+	phosphotransferase	NA	NA	NA	NA	NA
3586488:3586542	attR	CCAGTCAGAGGAGCCAAATTTAAGAAGCCTGCTTTCGAGCAGGCTTTTTGCTTTT	NA	NA	NA	NA
WP_023286684.1|3587885_3588857_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_004180471.1|3589063_3589900_-	alpha/beta hydrolase	NA	A0A2D1GKK1	Mycobacterium_phage	28.8	4.8e-14
WP_038435464.1|3590092_3590668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022631348.1|3590799_3591714_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002911862.1|3591719_3592055_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002911866.1|3592061_3592394_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_004144110.1|3592491_3592620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016831855.1|3592616_3594527_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_181566933.1|3594537_3594999_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_112162715.1|3595342_3596662_+	shikimate transporter	NA	NA	NA	NA	NA
WP_064186280.1|3596708_3597449_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_004180478.1|3597408_3598365_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175282.1|3598480_3598870_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_002911879.1|3598891_3599623_-	HPP family protein	NA	NA	NA	NA	NA
WP_048328442.1|3599821_3600931_+	adenosylhomocysteinase	NA	NA	NA	NA	NA
WP_032105072.1|3600973_3602041_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_004180482.1|3602068_3602809_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_002911883.1|3603123_3603447_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_002911885.1|3603614_3604673_-	FUSC family protein	NA	NA	NA	NA	NA
WP_004144123.1|3604771_3605245_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_181566918.1|3605421_3606585_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	80.4	1.9e-181
WP_112162719.1|3606765_3608190_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_112162721.1|3608407_3610510_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.2	2.8e-63
WP_112162723.1|3610749_3611061_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004148994.1|3611236_3612595_-	putrescine/proton symporter PlaP	NA	NA	NA	NA	NA
WP_096335043.1|3612584_3612647_-	membrane protein YoeI	NA	NA	NA	NA	NA
WP_112162725.1|3612884_3613775_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152513.1|3613813_3614638_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004899375.1|3614814_3614865_+	his operon leader peptide	NA	NA	NA	NA	NA
WP_002912152.1|3615010_3615910_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	1.4e-11
WP_112162727.1|3615949_3617254_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_004149000.1|3617250_3618312_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_004144133.1|3618308_3619376_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_112162729.1|3619375_3619966_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_112162731.1|3619965_3620703_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_112162733.1|3620684_3621461_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_004122447.1|3621454_3622054_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A1V0SIZ6	Klosneuvirus	34.2	1.5e-17
WP_112162735.1|3622137_3623457_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	36.0	9.6e-09
WP_181566919.1|3623588_3624734_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_112162739.1|3624734_3625628_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_112162741.1|3625624_3626779_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.1	6.1e-76
WP_032719826.1|3626797_3628690_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_004852439.1|3628703_3629444_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	24.8	1.1e-06
WP_112162916.1|3629443_3630211_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_112162743.1|3631516_3632521_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.9	2.0e-30
WP_023279773.1|3632695_3633664_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	2.9e-180
WP_064146682.1|3635168_3636758_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.9	4.3e-189
WP_112162747.1|3636787_3637138_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	4.4e-38
WP_015632445.1|3637134_3637542_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.2	1.4e-14
WP_001101446.1|3637721_3638747_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_162887343.1|3639065_3640034_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	3.8e-180
>prophage 10
NZ_CP030174	Klebsiella pneumoniae subsp. pneumoniae strain 11219 chromosome, complete genome	5377145	4167709	4173539	5377145		Enterobacteria_phage(100.0%)	8	NA	NA
WP_065889006.1|4167709_4168276_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	2.8e-58
WP_065889005.1|4168293_4168539_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	5.5e-19
WP_065889004.1|4168535_4169273_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	60.7	1.2e-72
WP_004132554.1|4169832_4170099_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_077269590.1|4170095_4170653_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	65.0	6.6e-36
WP_065889002.1|4170649_4170877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065889001.1|4170873_4171194_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_065889000.1|4171205_4173539_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.3	0.0e+00
