The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030269	Klebsiella pneumoniae subsp. pneumoniae strain SC-7 chromosome, complete genome	5379591	881946	891360	5379591		Escherichia_phage(87.5%)	9	NA	NA
WP_161283558.1|881946_883581_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.7	6.9e-182
WP_014907639.1|883635_884901_+	MFS transporter	NA	NA	NA	NA	NA
WP_014907640.1|884931_886020_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	1.0e-210
WP_014907641.1|886106_886367_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	2.1e-40
WP_004176269.1|886664_887525_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|887545_888307_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|888567_889470_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004224682.1|889481_890747_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002210516.1|890739_891360_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 2
NZ_CP030269	Klebsiella pneumoniae subsp. pneumoniae strain SC-7 chromosome, complete genome	5379591	1284103	1378824	5379591	integrase,transposase,capsid,head,tRNA,holin,portal,terminase,tail	Klebsiella_phage(46.51%)	103	1276636:1276653	1386972:1386989
1276636:1276653	attL	ACGCCAAACCCCACCGTC	NA	NA	NA	NA
WP_002901088.1|1284103_1284604_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|1284721_1285168_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004140469.1|1285151_1285946_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014907798.1|1286053_1287229_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_014907799.1|1287260_1287953_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|1288098_1288608_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_014343000.1|1288612_1288951_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_004176548.1|1288940_1289180_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004176549.1|1289480_1290494_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
WP_004150782.1|1290551_1290653_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|1290652_1290727_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|1290844_1290970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|1291028_1291292_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|1291422_1292061_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|1292150_1293065_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004148037.1|1293526_1293646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014907800.1|1293726_1294770_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004140494.1|1295072_1296281_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_014907801.1|1296354_1298139_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|1298145_1299036_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|1299156_1300665_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_020804938.1|1300698_1300863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|1300975_1301662_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140501.1|1302059_1302239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|1302278_1302911_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|1303477_1303675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014907802.1|1303790_1304801_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140511.1|1304797_1306204_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|1306259_1307147_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|1307163_1307670_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004148027.1|1307696_1308191_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|1308281_1308467_-	general stress protein	NA	NA	NA	NA	NA
WP_032421220.1|1308686_1309022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140529.1|1309089_1310283_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|1310395_1310623_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_032415655.1|1310776_1310953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014907803.1|1311072_1311396_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|1311388_1311781_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004213085.1|1311777_1312491_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|1312763_1312916_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_014228923.1|1313564_1314257_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004224164.1|1314611_1315670_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.7	2.1e-14
WP_014907806.1|1316092_1317520_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	55.5	3.0e-101
WP_060184316.1|1317588_1330293_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	46.9	0.0e+00
WP_014228919.1|1330355_1330967_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	72.5	5.3e-71
WP_021462612.1|1330982_1331333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014228918.1|1331364_1332075_-	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	89.8	1.4e-136
WP_014907809.1|1332076_1332832_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	81.3	1.2e-125
WP_014228916.1|1332828_1333167_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	8.3e-58
WP_041169041.1|1333166_1336502_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.6	0.0e+00
WP_014228914.1|1336734_1337100_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_014228913.1|1337157_1337619_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_017898997.1|1337650_1338052_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
WP_014907812.1|1338048_1338438_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	85.3	1.1e-56
WP_014228910.1|1338418_1338757_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_041168975.1|1338753_1339071_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	88.8	2.6e-45
WP_014907814.1|1339051_1339312_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	1.5e-22
WP_014228907.1|1339370_1340657_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	4.4e-216
WP_014907815.1|1340734_1341655_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_112295253.1|1341691_1342951_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.0	2.3e-222
WP_032418045.1|1342950_1343130_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	4.0e-11
WP_012542167.1|1343123_1344845_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.1e-190
WP_012542168.1|1344844_1345279_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014907818.1|1345527_1345959_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_014907819.1|1345955_1346279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041168976.1|1346230_1346593_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	82.5	1.3e-56
WP_032749552.1|1346919_1347144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065888617.1|1347182_1347620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041168977.1|1348568_1348919_-	hypothetical protein	NA	A0A0K2FIW3	Enterobacter_phage	37.7	6.0e-11
WP_023159886.1|1348915_1349413_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	86.4	4.3e-79
WP_021462597.1|1349412_1349628_-|holin	holin	holin	A5LH82	Enterobacteria_phage	87.3	1.0e-29
WP_077260858.1|1350639_1351080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020317678.1|1351084_1351954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014228895.1|1351982_1352327_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.0	1.0e-55
WP_014907821.1|1352339_1353371_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	49.3	1.8e-95
WP_051017642.1|1353570_1353963_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	6.1e-12
WP_077260856.1|1354003_1354294_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	6.1e-17
WP_012542186.1|1354305_1354539_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	1.7e-25
WP_048333319.1|1355193_1356555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112295254.1|1356898_1358662_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_021462584.1|1358974_1359415_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_041169042.1|1359428_1359893_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	68.9	1.9e-60
WP_021462582.1|1359885_1360869_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	56.4	3.3e-46
WP_014907826.1|1360920_1361475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012542199.1|1361477_1361693_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
WP_012542200.1|1361794_1362184_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
WP_021462581.1|1363026_1363221_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_021462580.1|1363263_1363608_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_014907830.1|1363749_1365888_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.9	3.3e-99
WP_012542206.1|1365940_1366186_+	excisionase	NA	NA	NA	NA	NA
WP_014228877.1|1366166_1367294_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	3.3e-119
WP_004150800.1|1367411_1368662_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|1368902_1369553_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150802.1|1369569_1370028_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|1370084_1371191_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004140557.1|1371245_1371887_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_004176557.1|1371890_1373261_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	1.2e-107
WP_004213084.1|1373315_1373678_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004179353.1|1373761_1374568_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004150807.1|1374850_1375522_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_015874641.1|1375521_1376988_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_004176560.1|1377073_1378195_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004190938.1|1378332_1378824_-|transposase	transposase	transposase	NA	NA	NA	NA
1386972:1386989	attR	ACGCCAAACCCCACCGTC	NA	NA	NA	NA
>prophage 3
NZ_CP030269	Klebsiella pneumoniae subsp. pneumoniae strain SC-7 chromosome, complete genome	5379591	1627873	1637337	5379591	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_012737718.1|1627873_1629595_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_004141853.1|1629621_1630341_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1630694_1630913_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|1631033_1633313_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|1633343_1633661_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|1633986_1634208_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|1634284_1636225_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|1636221_1637337_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 4
NZ_CP030269	Klebsiella pneumoniae subsp. pneumoniae strain SC-7 chromosome, complete genome	5379591	4791266	4834691	5379591	holin,integrase,tail,terminase	Salmonella_phage(42.22%)	51	4785291:4785305	4803599:4803613
4785291:4785305	attL	ATGCGGCGCTGAAAA	NA	NA	NA	NA
WP_004151980.1|4791266_4792733_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|4792800_4794378_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_060184358.1|4794569_4795820_+|integrase	site-specific integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.9	8.9e-206
WP_004200579.1|4795836_4796028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048336803.1|4796024_4796618_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.9	3.3e-110
WP_004144296.1|4796614_4796773_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	2.5e-17
WP_023339275.1|4796765_4797059_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004144294.1|4797168_4797417_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_048336802.1|4797463_4798345_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.6	1.4e-136
WP_048336801.1|4798341_4799163_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	2.8e-131
WP_048336848.1|4799162_4799354_-	hypothetical protein	NA	A0A1L2C975	Pseudomonas_phage	52.6	2.1e-05
WP_004164029.1|4799413_4799713_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_048336800.1|4800079_4800661_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	4.2e-65
WP_004152538.1|4800814_4801048_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_048336799.1|4801394_4802057_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	61.4	1.5e-82
WP_032415344.1|4802056_4802818_+	DNA replication domain protein	NA	T1SA92	Salmonella_phage	57.4	3.4e-67
WP_048336798.1|4802943_4803288_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	85.1	6.9e-52
WP_053065703.1|4803480_4803942_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	35.5	2.7e-06
4803599:4803613	attR	ATGCGGCGCTGAAAA	NA	NA	NA	NA
WP_071888830.1|4803934_4804615_+	DNA cytosine methyltransferase	NA	A0A0H5AU88	Pseudomonas_phage	58.3	9.2e-72
WP_004141386.1|4805085_4805298_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_048336795.1|4805905_4806190_+	hypothetical protein	NA	A0A0N7KZ94	Stx2-converting_phage	75.5	2.5e-15
WP_048336845.1|4806189_4806378_+	hypothetical protein	NA	R9TNE4	Aeromonas_phage	76.7	9.4e-19
WP_023339258.1|4806370_4806709_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_048336844.1|4806784_4807114_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	55.1	1.9e-27
WP_048336794.1|4807171_4807756_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	8.4e-90
WP_048336793.1|4807752_4809228_+	hypothetical protein	NA	Q858H3	Salmonella_phage	93.7	1.5e-281
WP_077274498.1|4809224_4810016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048336792.1|4810193_4810439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152472.1|4811036_4811240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004149313.1|4811243_4812923_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	59.3	3.6e-194
WP_004152470.1|4812919_4813225_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004152468.1|4813506_4813905_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
WP_004197367.1|4813917_4814925_+	bbp17	NA	T1S9H9	Salmonella_phage	92.8	2.1e-181
WP_004152466.1|4814935_4815328_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_024622837.1|4815320_4815599_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	1.1e-20
WP_004197381.1|4815647_4816259_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	9.2e-47
WP_048336791.1|4816258_4818736_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.8	7.3e-268
WP_048336790.1|4818737_4819208_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.9	6.6e-45
WP_004197440.1|4819200_4819698_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	43.6	4.0e-24
WP_048336789.1|4819710_4822209_+	bacteriophage protein	NA	A0A193GYI3	Enterobacter_phage	61.3	1.5e-289
WP_048336788.1|4822205_4824011_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	73.3	1.7e-237
WP_048336787.1|4824014_4826489_+	phage protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	85.7	0.0e+00
WP_048336786.1|4826684_4826981_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	93.8	1.7e-46
WP_004141317.1|4827267_4827813_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_009485391.1|4828200_4828497_-	hypothetical protein	NA	T1SA06	Salmonella_phage	65.5	8.1e-25
WP_048336785.1|4828648_4830982_+	hypothetical protein	NA	A0A249Y258	Klebsiella_phage	60.1	1.5e-201
WP_048336784.1|4830989_4831397_+	membrane protein	NA	T1SA79	Salmonella_phage	82.7	1.4e-54
WP_048336783.1|4831383_4831680_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	77.6	2.1e-33
WP_071888828.1|4831676_4832156_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	2.1e-62
WP_048336782.1|4832152_4832653_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	78.8	5.9e-60
WP_009309501.1|4832822_4834691_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 5
NZ_CP030269	Klebsiella pneumoniae subsp. pneumoniae strain SC-7 chromosome, complete genome	5379591	5168168	5175073	5379591	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|5168168_5169032_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004180550.1|5169042_5169816_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|5170056_5170953_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|5171195_5172557_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|5172875_5173598_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|5173594_5175073_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 1
NZ_CP030268	Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-IncFIB-110K, complete sequence	111007	5309	34104	111007	terminase,tail,portal	Salmonella_phage(97.22%)	40	NA	NA
WP_019704527.1|5309_5921_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	1.1e-76
WP_004109817.1|5908_6706_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
WP_004109820.1|6698_7397_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
WP_032423010.1|7483_7819_-|tail	tail protein	tail	J9Q6E1	Salmonella_phage	84.5	2.6e-51
WP_112295218.1|7862_12401_-	tape measure protein	NA	J9Q712	Salmonella_phage	72.3	0.0e+00
WP_014342129.1|12408_12633_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.2	2.0e-31
WP_004109835.1|12758_13076_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
WP_004109839.1|13137_13884_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.0	3.7e-106
WP_102007214.1|13951_14344_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	67.5	1.0e-46
WP_021313126.1|14345_14819_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
WP_004109848.1|14809_15154_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
WP_023279432.1|15251_16085_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.4	2.4e-130
WP_160552724.1|16084_16465_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.7	3.4e-52
WP_014342133.1|16402_16591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342134.1|16566_16995_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	71.6	7.9e-29
WP_004109857.1|17073_17952_-	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	4.7e-153
WP_023279435.1|17978_18878_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	6.1e-124
WP_161508560.1|18900_20475_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	88.7	7.9e-276
WP_004109863.1|20507_21764_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
WP_004109866.1|21766_22408_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
WP_004109869.1|22583_22850_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
WP_004109872.1|22859_23750_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	5.4e-165
WP_060528000.1|23755_24010_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	95.2	3.4e-40
WP_019704584.1|24002_24641_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	97.6	1.4e-109
WP_112295220.1|24637_25306_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	91.4	1.5e-106
WP_050484892.1|25305_26010_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	89.3	2.8e-108
WP_021313133.1|26069_27629_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.9	1.2e-279
WP_014342145.1|27631_27907_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	4.0e-26
WP_014342146.1|27957_28392_-	hypothetical protein	NA	A0A1V0E7W1	Vibrio_phage	36.4	9.5e-14
WP_101329653.1|28550_29081_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	84.5	1.3e-70
WP_032423112.1|29213_29393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004109892.1|29714_30365_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
WP_004109904.1|30415_30619_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
WP_039817706.1|31211_31694_-	hypothetical protein	NA	J9Q805	Salmonella_phage	76.9	1.8e-69
WP_072196389.1|31899_32097_-	hypothetical protein	NA	J9Q753	Salmonella_phage	80.0	6.4e-26
WP_112295221.1|32183_32558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072196390.1|32685_33105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342154.1|33212_33512_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	70.7	5.0e-30
WP_023279445.1|33660_33873_-	hypothetical protein	NA	J9Q804	Salmonella_phage	77.9	4.4e-25
WP_064173656.1|33885_34104_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	83.3	1.3e-27
>prophage 2
NZ_CP030268	Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-IncFIB-110K, complete sequence	111007	38054	45738	111007		Salmonella_phage(33.33%)	7	NA	NA
WP_112295224.1|38054_39611_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
WP_112295225.1|39607_40813_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_112295226.1|40929_44046_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	2.0e-25
WP_014342165.1|44107_44323_-	restriction endonuclease subunit M	NA	J9Q747	Salmonella_phage	69.8	1.2e-14
WP_048333486.1|44451_45030_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	57.5	1.7e-55
WP_060877020.1|45157_45313_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	61.2	1.7e-05
WP_019704567.1|45312_45738_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
>prophage 3
NZ_CP030268	Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-IncFIB-110K, complete sequence	111007	49588	83191	111007		Salmonella_phage(91.67%)	37	NA	NA
WP_019704564.1|49588_49822_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	2.7e-31
WP_101329658.1|50019_50613_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	84.8	1.7e-98
WP_032423057.1|50797_51631_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	56.4	1.1e-63
WP_032423056.1|51756_52305_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	74.4	3.2e-75
WP_050485941.1|52301_52883_-	hypothetical protein	NA	A0A1B0VMI8	Pseudomonas_phage	50.4	4.2e-33
WP_048333489.1|53105_53525_-	hypothetical protein	NA	J9Q743	Salmonella_phage	74.1	3.8e-52
WP_112295227.1|53588_54233_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	77.6	2.1e-94
WP_072271806.1|54232_54703_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	80.0	1.8e-71
WP_072196421.1|54705_55101_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	75.6	6.7e-51
WP_048333492.1|55120_56224_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	79.6	1.6e-179
WP_048333493.1|56417_57293_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	J9Q742	Salmonella_phage	84.7	5.9e-140
WP_112295228.1|57370_58513_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.5	1.5e-212
WP_040177336.1|58643_60947_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.9	0.0e+00
WP_040247361.1|61022_61592_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	89.9	1.1e-94
WP_072196422.1|61601_62312_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	59.7	3.9e-73
WP_160333948.1|62337_62697_-	hypothetical protein	NA	J9Q741	Salmonella_phage	95.0	2.4e-55
WP_072196416.1|64250_64484_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	4.4e-18
WP_021313776.1|64483_65569_-	exonuclease	NA	J9Q7S9	Salmonella_phage	84.8	1.1e-183
WP_072271804.1|65567_65651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021313777.1|65756_66251_-	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	67.1	1.0e-59
WP_112295229.1|66326_66971_-	hypothetical protein	NA	J9Q739	Salmonella_phage	80.7	1.9e-98
WP_072196418.1|67172_68390_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.1	6.7e-73
WP_014342074.1|68820_69033_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
WP_040120273.1|69032_69368_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	67.6	2.1e-37
WP_032414136.1|69730_69907_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	68.8	6.1e-12
WP_162629314.1|70077_71109_-	recombinase	NA	J9Q736	Salmonella_phage	95.3	2.4e-188
WP_094327225.1|71156_71423_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	83.0	8.6e-34
WP_021313784.1|71422_72367_-	exonuclease	NA	J9Q7S6	Salmonella_phage	93.6	2.8e-172
WP_042935032.1|72427_73435_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	87.6	2.3e-143
WP_042935034.1|73554_73986_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	92.3	6.2e-66
WP_023279488.1|74335_74551_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	80.0	4.5e-25
WP_072271803.1|74703_75129_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	83.0	7.2e-59
WP_072201187.1|75143_76313_-	uracil-DNA glycosylase	NA	J9Q7Z2	Salmonella_phage	93.3	6.2e-209
WP_060877009.1|76334_77030_-	hypothetical protein	NA	S5YLC4	Mycobacterium_phage	37.1	4.9e-20
WP_072271797.1|77032_79396_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	86.7	0.0e+00
WP_032439780.1|79576_80809_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	86.4	2.2e-212
WP_112295231.1|80905_83191_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	62.6	2.9e-247
>prophage 4
NZ_CP030268	Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-IncFIB-110K, complete sequence	111007	91283	106767	111007	tail	Salmonella_phage(81.25%)	17	NA	NA
WP_023279474.1|91283_91751_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	63.9	1.3e-48
WP_102000810.1|91830_92619_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	51.1	3.1e-71
WP_112295236.1|92910_94077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161424758.1|94119_95244_-	DNA primase	NA	J9Q720	Salmonella_phage	91.0	5.4e-202
WP_032440528.1|95390_96731_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	96.0	5.4e-241
WP_023279420.1|96795_97521_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.8	2.5e-128
WP_021313114.1|97714_98473_-	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	98.0	1.6e-146
WP_014342115.1|98518_98875_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_032440479.1|98880_99546_-	P-loop NTPase	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
WP_112295238.1|99730_100480_-	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	31.3	1.6e-16
WP_032734133.1|100464_100857_-	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	42.2	1.0e-14
WP_161508561.1|101131_101281_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	63.8	1.8e-12
WP_039817675.1|101273_101525_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	73.5	2.0e-24
WP_032422980.1|101527_102220_-	membrane protein	NA	J9Q7Y7	Salmonella_phage	89.1	2.7e-119
WP_004109805.1|102233_102557_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
WP_094313838.1|102647_104093_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	39.0	8.0e-41
WP_161508563.1|104145_106767_-	DUF1983 domain-containing protein	NA	A0A0P0IKE4	Klebsiella_phage	55.2	6.5e-33
>prophage 1
NZ_CP030270	Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence	236809	164247	213598	236809	transposase,integrase,protease	Caulobacter_phage(17.65%)	48	197509:197528	219623:219642
WP_004225018.1|164247_165243_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
WP_004210218.1|165448_166462_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
WP_004210220.1|166574_167102_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_077250518.1|167115_170073_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.8	2.3e-50
WP_004144375.1|170914_171775_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.7	9.0e-08
WP_011251321.1|173506_174142_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_024198108.1|174477_175719_-	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	25.1	4.8e-10
WP_004026611.1|175803_176379_-	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	42.6	9.6e-30
WP_004026609.1|176465_177044_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_004026607.1|177082_178123_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
WP_004026604.1|178146_178602_-	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_011251319.1|178624_179776_-	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_004196925.1|179772_180357_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.4	2.0e-11
WP_011251317.1|180667_181726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026599.1|181737_182880_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.2	6.3e-33
WP_004026598.1|182872_183646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026596.1|183647_184727_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	1.7e-40
WP_004026594.1|184726_185683_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_004026592.1|185693_186917_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_004026591.1|186919_187378_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_004026588.1|187857_188496_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026586.1|188520_189162_+	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
WP_004026585.1|189162_189801_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026583.1|189893_190934_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026581.1|190933_192667_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_004026579.1|192694_194194_+	LPS kinase	NA	NA	NA	NA	NA
WP_112295291.1|194644_195640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026570.1|195901_196819_-	hypothetical protein	NA	NA	NA	NA	NA
197509:197528	attL	ATGTCTACTGTATGCGATAT	NA	NA	NA	NA
WP_017146616.1|198302_198617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026565.1|198860_199313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026564.1|199815_200751_-|protease	omptin family outer membrane protease Kop	protease	NA	NA	NA	NA
WP_001166628.1|201507_201963_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294656.1|202034_202400_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|202415_202691_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|202718_203144_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|203182_204868_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|204885_205251_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|205247_205484_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|205467_205587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|205549_205762_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001389365.1|205999_206764_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000376623.1|207270_207771_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|207898_208738_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|208731_209079_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|209242_210034_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|210126_211386_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_112295293.1|211647_212439_-	AadA family aminoglycoside 3''-O-nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000845054.1|212584_213598_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
219623:219642	attR	ATATCGCATACAGTAGACAT	NA	NA	NA	NA
>prophage 2
NZ_CP030270	Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence	236809	228651	236080	236809	transposase	Stx2-converting_phage(28.57%)	7	NA	NA
WP_004213807.1|228651_229620_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
WP_004902302.1|229947_231540_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_004189161.1|231570_231921_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004215130.1|231917_232358_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
WP_004902307.1|232554_232737_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
WP_004117790.1|233942_234914_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_004211841.1|234913_236080_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
