The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019613	Mycobacterium tuberculosis strain H112 chromosome, complete genome	4406346	418602	456874	4406346	protease,integrase,terminase,tRNA,capsid,head	Mycobacterium_phage(30.0%)	47	447403:447430	457027:457054
WP_003413486.1|418602_420681_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|420789_421017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031651465.1|421013_422399_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|422743_423244_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|423260_423701_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|423847_424525_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|424509_424863_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|424875_425301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901438.1|425297_425972_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|426049_426871_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|427006_427900_+	universal stress protein TB31.7	NA	NA	NA	NA	NA
WP_003413594.1|427902_428721_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|428735_429917_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|429975_430407_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|430920_432162_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|432471_432834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003902322.1|433180_434305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|434306_434846_+	archease	NA	NA	NA	NA	NA
WP_003413616.1|434985_436284_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|436322_436604_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|436748_437234_-	non-heme di-iron catalase	NA	NA	NA	NA	NA
WP_003908019.1|437260_437515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|437518_439855_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|439883_440126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|440126_440804_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|440999_441656_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|441818_442265_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|442439_442772_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|442891_443251_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|443352_443811_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|443946_444327_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|444323_445820_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|446054_446246_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
447403:447430	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|447536_447968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|447964_448963_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|448976_449441_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003908028.1|449428_449680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901443.1|449850_451290_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_031666072.1|451297_451831_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.3	2.0e-05
WP_003899413.1|451983_452610_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899414.1|452641_452965_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|453044_453290_-	type II toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|453286_454714_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|454715_455108_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|455104_455365_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|455381_455744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|455746_456874_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
457027:457054	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 2
NZ_CP019613	Mycobacterium tuberculosis strain H112 chromosome, complete genome	4406346	1183445	1228341	4406346	transposase,tRNA,protease	Burkholderia_virus(25.0%)	23	NA	NA
WP_087902221.1|1183445_1184707_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009937401.1|1185000_1185162_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003902445.1|1185183_1186713_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003417413.1|1186645_1187584_-	sigma-70 family RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
WP_003902446.1|1187592_1188960_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.8	9.0e-18
WP_003417415.1|1189028_1190246_+	D-alanyl-D-alanine carboxypeptidase DacB1	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
WP_003417416.1|1190341_1191850_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_003417418.1|1191846_1192998_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003417421.1|1193188_1194034_-|protease	PDZ-interacting protease regulator Ppr1	protease	NA	NA	NA	NA
WP_003900026.1|1194508_1194949_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003417435.1|1194982_1195852_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_003417440.1|1195872_1196883_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003905041.1|1197155_1197800_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003417452.1|1197866_1199096_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003900028.1|1199378_1200728_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
WP_003417458.1|1200739_1201879_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003417461.1|1201875_1202607_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_023644582.1|1202615_1210187_-	PPE family protein	NA	NA	NA	NA	NA
WP_031654342.1|1210235_1211216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417619.1|1216505_1216763_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003901612.1|1217018_1226492_-	PPE family protein	NA	NA	NA	NA	NA
WP_049961743.1|1227117_1227564_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003911006.1|1227600_1228341_-|transposase	transposase	transposase	NA	NA	NA	NA
