The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	0	2283	4614212		Escherichia_phage(100.0%)	1	NA	NA
WP_065273924.1|0_2283_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
>prophage 2
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	8231	22991	4614212	plate,tail,tRNA	Escherichia_phage(36.36%)	13	NA	NA
WP_001093750.1|8231_8867_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_000127144.1|8863_9211_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	1.1e-57
WP_001121455.1|9215_10124_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	8.3e-161
WP_001285323.1|10116_10647_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	1.3e-102
WP_000104717.1|10657_13516_+|tail	phage tail protein	tail	A0A0A0YPY9	Escherichia_phage	76.7	0.0e+00
WP_000348282.1|13727_14840_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_001286736.1|16283_17474_+|tail	phage tail sheath protein	tail	Q858V1	Yersinia_virus	98.2	2.6e-223
WP_001251411.1|17486_18266_+|tail	major tail tube protein	tail	A0A0F7LDR0	Escherichia_phage	98.8	1.9e-73
WP_000468308.1|18347_18566_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|18838_20200_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_000929408.1|20345_20678_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|20868_21591_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675150.1|21587_22991_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 3
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	36762	38115	4614212		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469743.1|36762_38115_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	1.9e-07
>prophage 4
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	42832	53223	4614212		Catovirus(20.0%)	8	NA	NA
WP_001295424.1|42832_43474_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234777.1|43565_44147_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001252324.1|44168_46022_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001300971.1|46295_47879_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_000978094.1|48537_49677_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_000482901.1|49682_50126_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000137133.1|50128_52291_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	1.9e-17
WP_000654491.1|52383_53223_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	4.4e-07
>prophage 5
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	57467	64261	4614212		Synechococcus_phage(25.0%)	6	NA	NA
WP_000048190.1|57467_58589_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_000043654.1|58591_59557_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	51.1	1.3e-87
WP_000479835.1|59559_60039_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699709.1|60035_61259_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000079313.1|61261_62698_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	7.4e-47
WP_001374064.1|62890_64261_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	2.2e-32
>prophage 6
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	69859	78716	4614212		Enterobacteria_phage(42.86%)	8	NA	NA
WP_001115981.1|69859_71254_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
WP_000183060.1|71428_72322_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699450.1|72694_73780_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	3.9e-101
WP_001023616.1|73779_74679_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
WP_000857508.1|74737_75616_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	8.7e-107
WP_001100801.1|75620_76166_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.9	1.6e-47
WP_001060533.1|76169_77594_+	O7 family O-antigen flippase	NA	NA	NA	NA	NA
WP_000998544.1|77603_78716_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	25.7	1.3e-14
>prophage 7
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	84731	90538	4614212		Hokovirus(25.0%)	4	NA	NA
WP_000097983.1|84731_86156_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.7	8.4e-59
WP_000954427.1|86189_87554_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.8	2.9e-32
WP_000043460.1|87717_89124_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.6	2.8e-38
WP_000704860.1|89371_90538_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.7e-110
>prophage 8
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	97893	98793	4614212		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131757.1|97893_98793_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	7.0e-11
>prophage 9
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	105996	107163	4614212		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001320295.1|105996_107163_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	5.5e-226
>prophage 10
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	138089	138620	4614212		Escherichia_phage(100.0%)	1	NA	NA
WP_001079074.1|138089_138620_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 11
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	142164	142836	4614212		Bacillus_phage(100.0%)	1	NA	NA
WP_001339045.1|142164_142836_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 12
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	155923	157438	4614212		Cedratvirus(100.0%)	1	NA	NA
WP_001187819.1|155923_157438_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
>prophage 13
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	167525	173169	4614212		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_001297437.1|167525_169187_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000483187.1|169232_170834_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
WP_000204338.1|170852_171713_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036371.1|171715_172765_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|172779_173169_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 14
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	178421	180155	4614212	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025322.1|178421_180155_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 15
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	186771	188822	4614212		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019588.1|186771_187515_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|187555_187951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639274.1|188003_188822_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
>prophage 16
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	192840	200098	4614212		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|192840_193362_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024904.1|193363_193966_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072094247.1|194036_194102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580332.1|194240_194852_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|194860_195871_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571479.1|196211_196997_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202990.1|196993_197749_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001300644.1|197827_198760_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|198775_200098_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 17
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	204096	205572	4614212		Cyanophage(100.0%)	1	NA	NA
WP_000301720.1|204096_205572_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
>prophage 18
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	213628	218097	4614212		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944245.1|213628_214291_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011657.1|214314_214971_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|215072_215303_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168747.1|215441_215816_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879293.1|215819_216692_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976472.1|216704_217046_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812724.1|217440_218097_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
>prophage 19
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	225593	227642	4614212		Moraxella_phage(100.0%)	1	NA	NA
WP_001315679.1|225593_227642_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 20
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	232972	233182	4614212		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|232972_233182_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 21
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	238822	240379	4614212		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|238822_240379_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 22
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	244241	252348	4614212	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_000854972.1|244241_245603_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|245676_245856_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|245975_246335_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|246697_247042_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|247173_249084_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001220987.1|249141_249837_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290581.1|249876_250458_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_000758422.1|250662_252348_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 23
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	268226	272803	4614212		Bacillus_phage(100.0%)	3	NA	NA
WP_084831859.1|268226_269717_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	4.9e-09
WP_000616417.1|269897_271373_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|271519_272803_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 24
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	276121	276976	4614212		Indivirus(100.0%)	1	NA	NA
WP_001186371.1|276121_276976_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	2.5e-10
>prophage 25
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	285786	289872	4614212		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000723724.1|285786_286767_+	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	7.9e-08
WP_000719088.1|286903_287662_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001299574.1|287779_289138_+	MFS transporter	NA	NA	NA	NA	NA
WP_001135066.1|289230_289872_-	bifunctional pyrazinamidase/nicotinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
>prophage 26
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	294798	296760	4614212		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|294798_296760_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 27
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	302358	303012	4614212		Bacillus_phage(100.0%)	1	NA	NA
WP_001300558.1|302358_303012_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	5.1e-11
>prophage 28
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	309739	310960	4614212		Klosneuvirus(100.0%)	1	NA	NA
WP_000082032.1|309739_310960_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 29
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	318436	319264	4614212		Bacillus_virus(100.0%)	1	NA	NA
WP_000175052.1|318436_319264_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 30
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	325593	327855	4614212		Tupanvirus(100.0%)	1	NA	NA
WP_000077856.1|325593_327855_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	2.3e-143
>prophage 31
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	339149	358742	4614212	tRNA	Tupanvirus(22.22%)	18	NA	NA
WP_001144202.1|339149_341078_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
WP_001700733.1|341081_341624_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|341720_341918_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|341970_342327_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|342449_342494_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018596.1|342777_343761_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_000672380.1|343775_346163_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|346167_346467_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000956528.1|346567_347548_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154168.1|347610_348162_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029471.1|348161_348911_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	1.2e-08
WP_001209795.1|348988_349453_+	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_000175606.1|350474_351911_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270809.1|351914_352106_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082229.1|352237_353284_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|353440_354274_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069410.1|354606_356985_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	1.2e-171
WP_000553662.1|357041_358742_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	8.0e-32
>prophage 32
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	378109	383193	4614212		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367160.1|378109_378478_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_000089364.1|378486_379974_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948865.1|379983_380730_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	1.1e-06
WP_000908013.1|380704_381976_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000144539.1|381972_383193_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.2	1.1e-91
>prophage 33
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	391482	393749	4614212		Escherichia_phage(50.0%)	3	NA	NA
WP_001310861.1|391482_392151_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
WP_001069979.1|392147_392933_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587525.1|392936_393749_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 34
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	399253	408134	4614212		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|399253_399895_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098896.1|399934_401083_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_001182363.1|401373_402585_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269493.1|402697_403630_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|403626_404652_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|404950_405040_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701040.1|405205_406375_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|406609_407191_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101193.1|407318_408134_-	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 35
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	416936	418435	4614212		Indivirus(50.0%)	2	NA	NA
WP_000250656.1|416936_417833_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
WP_001296937.1|417913_418435_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 36
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	425346	426621	4614212	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001301026.1|425346_426621_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.1	3.3e-83
>prophage 37
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	446496	448308	4614212		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945901.1|446496_448308_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 38
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	477447	515229	4614212	tail,transposase,lysis	Escherichia_phage(32.14%)	45	NA	NA
WP_000148710.1|477447_478062_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|478104_478959_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|478960_479578_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|479588_482012_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041695.1|482072_484499_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	5.0e-213
WP_001300836.1|484697_485003_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|485110_485821_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|485823_486384_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|486418_486760_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|486894_487221_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|487426_488641_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836067.1|488652_489672_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001531709.1|489729_489834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296941.1|491173_491410_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048322.1|491497_493969_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.2	5.0e-59
WP_001083270.1|494062_494254_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854560.1|494250_494439_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000159335.1|494941_495142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001320327.1|495110_495476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379591.1|495487_495640_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_000381212.1|495808_496216_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000921596.1|496296_496524_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705360.1|496507_497029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054497.1|497009_497975_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	5.0e-55
WP_001151183.1|498015_498438_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.3e-65
WP_021568046.1|498721_499387_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000887491.1|499942_500155_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000981003.1|500371_500623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012775982.1|500689_500968_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265279.1|500969_501620_+	DUF968 domain-containing protein	NA	Q8SBE5	Shigella_phage	70.3	2.6e-68
WP_001204787.1|501637_502015_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_000780584.1|502170_502695_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_000878219.1|503064_503931_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|503927_504227_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001230558.1|505662_506262_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	96.0	4.5e-107
WP_112843490.1|506326_508705_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.8	3.4e-137
WP_001205170.1|508704_508986_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	4.5e-17
WP_000235975.1|508995_509700_+	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	62.3	5.4e-59
WP_000355603.1|509710_510004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078178.1|510231_510822_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|511138_511372_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|511440_511554_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|512157_513441_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527826.1|513529_514990_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.3	2.8e-41
WP_000214712.1|515025_515229_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 39
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	520593	521484	4614212		Bacillus_phage(100.0%)	1	NA	NA
WP_000592802.1|520593_521484_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	6.2e-20
>prophage 40
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	524486	525864	4614212		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091199.1|524486_524870_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000843414.1|524889_525324_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000273128.1|525543_525864_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	42.3	7.2e-19
>prophage 41
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	533339	534758	4614212		Bacillus_phage(100.0%)	1	NA	NA
WP_000558032.1|533339_534758_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 42
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	558916	565852	4614212		Bacillus_phage(50.0%)	3	NA	NA
WP_000628583.1|558916_560602_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.6	7.7e-11
WP_000832450.1|560639_563012_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_001329127.1|563056_565852_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	3.4e-19
>prophage 43
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	571131	574938	4614212		Bacillus_virus(50.0%)	2	NA	NA
WP_000426272.1|571131_572514_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_012304876.1|572538_574938_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 44
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	579254	581160	4614212		Planktothrix_phage(100.0%)	2	NA	NA
WP_000193517.1|579254_580241_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	2.9e-18
WP_001285557.1|580233_581160_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	7.0e-14
>prophage 45
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	584433	585874	4614212		Tupanvirus(50.0%)	2	NA	NA
WP_000642433.1|584433_585444_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
WP_000781370.1|585589_585874_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 46
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	592030	592321	4614212		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|592030_592321_+	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 47
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	599205	600750	4614212		Escherichia_phage(100.0%)	1	NA	NA
WP_000702542.1|599205_600750_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	4.9e-20
>prophage 48
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	611999	614126	4614212		Ralstonia_phage(100.0%)	1	NA	NA
WP_112843491.1|611999_614126_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	7.7e-24
>prophage 49
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	619034	621137	4614212		Salmonella_phage(100.0%)	1	NA	NA
WP_000689311.1|619034_621137_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.0	3.4e-133
>prophage 50
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	628269	708478	4614212	transposase,lysis,integrase,tail,tRNA	Escherichia_phage(33.33%)	75	664449:664465	707611:707627
WP_000220396.1|628269_629283_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
WP_000047424.1|629300_630446_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000760626.1|630690_632097_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|632175_632592_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000813794.1|632637_632814_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_000494244.1|633035_633266_+	YncJ family protein	NA	NA	NA	NA	NA
WP_001301045.1|633357_635319_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	2.7e-23
WP_000429155.1|635391_635928_-	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_001326689.1|635980_637195_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000826416.1|637234_638443_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	1.7e-206
WP_001261013.1|638974_639643_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586744.1|639945_640539_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001301046.1|640535_641528_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234052.1|641651_642632_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_000140873.1|642623_643163_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|643225_643450_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375961.1|643589_645245_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013789.1|645469_646813_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414567.1|647029_647953_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098559.1|647990_649631_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|650029_650179_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|650250_650424_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|650668_651199_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000048667.1|652164_653166_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000115936.1|653207_654647_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027964.1|654843_655644_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139585.1|655915_659818_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.4	8.4e-53
WP_000048939.1|660018_660624_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627365.1|660674_661991_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000431845.1|661980_663738_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000890940.1|663753_664650_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
664449:664465	attL	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
WP_000177526.1|664649_665255_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000471481.1|665425_667732_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000878218.1|668346_669213_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|669209_669509_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000138605.1|671585_673085_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001320272.1|673320_674226_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000752043.1|674397_674724_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|674731_674917_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900914.1|674913_677553_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|677760_678750_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001298828.1|678860_679283_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|679279_679546_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628173.1|679819_683344_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837924.1|683710_684844_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001300461.1|684984_685419_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_001157925.1|685684_685858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795384.1|686197_686311_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|686379_686613_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078178.1|686929_687520_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000355360.1|687747_688041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000654171.1|688053_688332_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	2.9e-24
WP_024182056.1|688328_690353_-|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.3	3.2e-181
WP_000770037.1|690652_691417_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.5	3.9e-87
WP_001291101.1|691521_691953_-	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	58.7	3.3e-19
WP_001228696.1|693745_693931_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_000992105.1|694147_694681_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.0	4.8e-100
WP_000370546.1|694786_695059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193293.1|695024_695369_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_012775985.1|695373_695586_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	96.9	3.0e-29
WP_001169151.1|695729_695885_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|695881_696370_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|696811_697033_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|697032_697203_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|697277_697553_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105139.1|697654_700255_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.6	7.9e-249
WP_000166319.1|700247_701057_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|701113_701308_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_084831862.1|701300_701510_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	96.8	1.8e-26
WP_000079604.1|701588_701804_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040858.1|701805_703041_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
WP_001157407.1|703092_704028_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123737.1|704156_705530_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|706007_706991_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001301114.1|707245_708478_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	35.0	3.1e-17
707611:707627	attR	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
>prophage 51
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	714804	715320	4614212		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945005.1|714804_715320_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 52
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	731939	733022	4614212		Indivirus(100.0%)	1	NA	NA
WP_000057985.1|731939_733022_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.4	4.0e-13
>prophage 53
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	747027	748293	4614212		Klosneuvirus(100.0%)	1	NA	NA
WP_000069229.1|747027_748293_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.0e-24
>prophage 54
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	761207	766864	4614212		Bacillus_virus(50.0%)	5	NA	NA
WP_000573407.1|761207_762014_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000565727.1|762081_762435_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|762802_763591_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_001301103.1|763734_764862_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000484965.1|764929_766864_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.6	6.9e-32
>prophage 55
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	774678	775269	4614212		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|774678_775269_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 56
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	780193	785485	4614212	protease	Tupanvirus(33.33%)	4	NA	NA
WP_001297122.1|780193_782791_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_001031530.1|783170_783422_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422045.1|783457_784507_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559286.1|784726_785485_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
>prophage 57
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	793232	796190	4614212		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000763511.1|793232_794828_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|794831_796190_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
>prophage 58
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	807848	809863	4614212		Bacillus_virus(50.0%)	2	NA	NA
WP_084831867.1|807848_808853_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110945.1|808849_809863_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 59
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	818273	828457	4614212		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068089.1|818273_818891_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.7e-53
WP_001287378.1|819494_819908_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|820051_820960_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193447.1|821161_822175_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001295622.1|822266_823172_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001362540.1|823284_823743_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|823792_824635_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160110.1|825534_826212_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571699.1|826211_826922_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|826918_828457_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 60
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	839712	839943	4614212		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146444.1|839712_839943_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 61
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	843041	847049	4614212		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_000811065.1|843041_843896_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257044.1|843931_844741_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200373.1|844744_845137_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456454.1|845133_845967_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|845966_847049_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 62
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	850185	852937	4614212		Tupanvirus(50.0%)	2	NA	NA
WP_001298109.1|850185_851133_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|851257_852937_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
>prophage 63
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	879606	881294	4614212		Salmonella_phage(50.0%)	2	NA	NA
WP_000457616.1|879606_880875_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
WP_000897378.1|880874_881294_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 64
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	889827	890916	4614212		Escherichia_phage(100.0%)	1	NA	NA
WP_071524883.1|889827_890916_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	41.9	8.3e-75
>prophage 65
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	897990	901719	4614212		Enterobacteria_phage(66.67%)	5	NA	NA
WP_000332308.1|897990_898722_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|898942_899347_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032141808.1|899399_899510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001307134.1|900042_900366_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_000444487.1|900468_901719_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 66
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	904855	906226	4614212		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423729.1|904855_906226_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
>prophage 67
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	911246	913224	4614212		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000531601.1|911246_912383_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000799401.1|912366_913224_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
>prophage 68
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	916479	920220	4614212		Vibrio_phage(50.0%)	4	NA	NA
WP_000952737.1|916479_917319_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.7e-23
WP_000291262.1|917334_918246_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251384.1|918274_919519_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033695.1|919518_920220_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
>prophage 69
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	927509	927767	4614212		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|927509_927767_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 70
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	940098	941741	4614212		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267920.1|940098_941103_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257000.1|941099_941741_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 71
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	945013	945250	4614212		Ralstonia_phage(100.0%)	1	NA	NA
WP_000103754.1|945013_945250_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 72
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	958552	959494	4614212		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|958552_959494_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 73
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	975374	975620	4614212		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|975374_975620_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 74
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	980282	981203	4614212		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|980282_981203_+	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 75
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	990511	991045	4614212		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|990511_991045_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 76
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	995180	996014	4614212		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|995180_996014_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 77
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1000007	1002273	4614212	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000878218.1|1000007_1000874_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000409883.1|1000914_1002273_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	1.9e-20
>prophage 78
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1009092	1010157	4614212		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258765.1|1009092_1010157_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
>prophage 79
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1024795	1027070	4614212		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001028095.1|1024795_1025290_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001301229.1|1025310_1026639_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	1.3e-234
WP_001273658.1|1026896_1027070_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 80
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1031368	1043682	4614212		Klosneuvirus(20.0%)	13	NA	NA
WP_000420621.1|1031368_1032289_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000024560.1|1032288_1032594_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209868.1|1032745_1033345_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062090.1|1033341_1035888_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	2.0e-71
WP_001301216.1|1035887_1037060_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120125.1|1037189_1037882_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264935.1|1037854_1038883_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_012767717.1|1038965_1041710_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	2.7e-37
WP_000829668.1|1041781_1042855_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|1042902_1043076_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309400.1|1043065_1043296_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|1043270_1043459_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|1043469_1043682_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 81
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1062924	1063584	4614212	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375126.1|1062924_1063584_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	6.8e-48
>prophage 82
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1067817	1069872	4614212		Bacillus_phage(100.0%)	1	NA	NA
WP_001295354.1|1067817_1069872_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 83
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1082471	1084379	4614212		Tupanvirus(100.0%)	1	NA	NA
WP_000053099.1|1082471_1084379_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
>prophage 84
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1100298	1111268	4614212	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_001090506.1|1100298_1101066_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193841.1|1101108_1103721_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001297200.1|1103986_1105189_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|1105357_1106758_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|1107360_1108449_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|1108633_1109824_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109486.1|1110045_1110693_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|1110719_1111268_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 85
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1125973	1130515	4614212		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|1125973_1127722_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705764.1|1127758_1130023_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|1130230_1130515_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 86
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1135601	1136690	4614212		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|1135601_1136690_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 87
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1140787	1144002	4614212		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292822.1|1140787_1143070_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|1143261_1144002_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 88
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1150310	1230304	4614212	protease,plate,portal,lysis,integrase,capsid,terminase,tail,tRNA	Salmonella_phage(43.48%)	80	1146584:1146599	1233391:1233406
1146584:1146599	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000213098.1|1150310_1150928_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850303.1|1150938_1153383_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000886683.1|1153621_1154914_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|1155004_1156348_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|1156358_1156970_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077053.1|1157124_1161153_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|1161287_1161782_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|1162326_1163292_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043577.1|1163414_1165181_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_001202189.1|1165181_1166903_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
WP_001241678.1|1166944_1167649_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1167933_1168152_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934045.1|1169189_1171466_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	2.5e-166
WP_000520781.1|1171496_1171817_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|1172139_1172364_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188180.1|1172436_1174383_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746443.1|1174379_1175495_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001355621.1|1175645_1176602_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599802.1|1176598_1178257_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|1178681_1179377_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|1179871_1180771_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458809.1|1180914_1182567_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|1182578_1183547_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815335.1|1183679_1185398_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
WP_000566356.1|1185434_1186436_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136577.1|1186446_1187877_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|1187975_1188989_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255168.1|1188985_1189816_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|1189812_1190136_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270734.1|1190261_1190777_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|1190994_1191723_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|1191740_1192472_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|1192478_1193195_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|1193194_1193863_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|1194153_1194885_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149743.1|1195083_1196211_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_000389260.1|1196251_1196740_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061667.1|1196799_1197645_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105444.1|1197641_1198595_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996005.1|1198604_1199738_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126069.1|1199832_1200945_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|1201295_1201772_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|1201859_1202762_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|1202822_1203545_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|1203528_1203816_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|1203975_1204233_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|1204262_1204640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|1204909_1206595_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|1206830_1207049_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001318481.1|1207810_1208350_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	62.5	1.5e-56
WP_000368077.1|1208349_1208952_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	2.3e-98
WP_000280166.1|1208923_1209361_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	75.0	1.7e-55
WP_000104800.1|1209362_1210985_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	78.5	6.2e-151
WP_001086815.1|1210981_1211587_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	2.3e-111
WP_000268294.1|1211579_1212488_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_000177591.1|1212474_1212834_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	8.0e-51
WP_000993743.1|1212830_1213409_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	3.6e-93
WP_000115390.1|1213512_1214319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000829156.1|1214260_1214707_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.7	7.6e-59
WP_001039932.1|1214699_1215131_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	3.8e-71
WP_000196203.1|1215226_1215655_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	88.7	8.1e-58
WP_000216259.1|1215791_1216544_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	94.7	3.1e-113
WP_001098413.1|1216686_1218453_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
WP_000520360.1|1218452_1219478_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_001320043.1|1219495_1220458_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_001034589.1|1220620_1221544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059831.1|1222016_1222352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|1222544_1222778_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154431.1|1222788_1222977_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_000017603.1|1223129_1225544_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.3	0.0e+00
WP_000104175.1|1225540_1226398_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	92.6	5.4e-154
WP_000752619.1|1226394_1226622_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_001244230.1|1226621_1226855_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_000963472.1|1226922_1227264_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_000956182.1|1227227_1227428_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000460893.1|1227435_1227945_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_001247707.1|1227977_1228199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047321.1|1228324_1228894_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	3.8e-39
WP_001321204.1|1228909_1229101_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
WP_000290930.1|1229287_1230304_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.7	3.2e-105
1233391:1233406	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 89
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1236954	1238157	4614212		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001300708.1|1236954_1238157_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
>prophage 90
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1249492	1251364	4614212		Planktothrix_phage(100.0%)	1	NA	NA
WP_001301279.1|1249492_1251364_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 91
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1254579	1262848	4614212		Synechococcus_phage(33.33%)	6	NA	NA
WP_001301278.1|1254579_1255242_-	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.2	8.2e-25
WP_001338400.1|1255372_1256272_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209344.1|1256277_1258710_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
WP_000114272.1|1258855_1259671_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000168797.1|1259822_1261088_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000961458.1|1261255_1262848_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 92
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1267845	1273070	4614212		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|1267845_1268361_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|1268413_1268479_-	protein YliM	NA	NA	NA	NA	NA
WP_001295297.1|1268713_1269601_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|1269899_1270403_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|1270806_1271553_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|1271691_1272351_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569083.1|1272347_1273070_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
>prophage 93
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1276754	1291566	4614212		Erwinia_phage(14.29%)	13	NA	NA
WP_000710619.1|1276754_1277015_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430013.1|1277279_1279562_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990177.1|1279603_1280281_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146343.1|1280354_1280621_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|1280885_1281146_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443530.1|1281374_1282460_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386551.1|1282600_1283563_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001340191.1|1283590_1285741_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_001145126.1|1285860_1286343_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
WP_000007101.1|1286574_1287939_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|1288167_1288839_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000976400.1|1288838_1289837_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_012767712.1|1289829_1291566_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 94
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1302162	1303071	4614212		Streptococcus_phage(100.0%)	1	NA	NA
WP_001321368.1|1302162_1303071_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	31.5	8.3e-28
>prophage 95
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1309552	1323484	4614212	integrase,tail,terminase	Escherichia_phage(41.67%)	15	1311468:1311482	1323558:1323572
WP_001515101.1|1309552_1310842_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
WP_000767389.1|1310900_1311377_+	kinase inhibitor	NA	NA	NA	NA	NA
1311468:1311482	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_000603805.1|1312160_1313306_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	29.9	1.6e-20
WP_000394418.1|1313343_1314681_-	hypothetical protein	NA	A0A2D2W3A0	Escherichia_phage	56.4	5.5e-145
WP_000204789.1|1315073_1316099_+	acyltransferase	NA	G9L6E5	Escherichia_phage	28.9	2.4e-15
WP_001104982.1|1316140_1316536_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	36.6	1.6e-12
WP_001130801.1|1317804_1319427_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	0.0e+00
WP_001218995.1|1319429_1319981_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	69.8	7.2e-67
WP_001472362.1|1319934_1320549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113283.1|1320681_1320867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376718.1|1321376_1321661_+	DUF4752 family protein	NA	G9L657	Escherichia_phage	94.7	3.2e-47
WP_000002107.1|1321653_1321938_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_000545729.1|1322010_1322178_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	2.9e-27
WP_001303849.1|1322217_1322436_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|1322413_1323484_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
1323558:1323572	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 96
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1333194	1339768	4614212		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891692.1|1333194_1334253_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
WP_000604034.1|1334255_1334945_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000101984.1|1334944_1335718_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|1335884_1336034_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|1336162_1336951_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096869.1|1337018_1338491_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001265438.1|1338751_1339768_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
>prophage 97
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1344121	1347641	4614212		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109196.1|1344121_1345174_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
WP_000784351.1|1345489_1345870_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000951295.1|1345983_1346925_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	3.7e-23
WP_000345410.1|1346921_1347641_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
>prophage 98
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1383924	1384716	4614212		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114026.1|1383924_1384716_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	31.5	2.2e-08
>prophage 99
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1388094	1391036	4614212		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001032697.1|1388094_1389576_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
WP_000628034.1|1389614_1391036_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	2.3e-61
>prophage 100
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1402304	1408285	4614212		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_000087944.1|1402304_1404353_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.1	6.4e-28
WP_001297248.1|1404361_1404934_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001301349.1|1404926_1407611_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_000186074.1|1407607_1408285_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.1	3.4e-26
>prophage 101
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1416538	1417303	4614212		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773301.1|1416538_1417303_+	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 102
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1421583	1425397	4614212	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|1421583_1423248_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023126.1|1423450_1425397_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
>prophage 103
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1430163	1431828	4614212		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337081.1|1430163_1431828_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	7.9e-85
>prophage 104
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1435923	1437003	4614212		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|1435923_1437003_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 105
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1444948	1449927	4614212	transposase	Planktothrix_phage(33.33%)	4	NA	NA
WP_000631380.1|1444948_1445335_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	2.1e-09
WP_085947770.1|1445331_1446701_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001207520.1|1447237_1448173_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000367881.1|1448256_1449927_+	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.7	8.0e-77
>prophage 106
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1454068	1456651	4614212	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157886.1|1454068_1456651_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	2.3e-184
>prophage 107
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1463661	1466101	4614212		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231428.1|1463661_1464750_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|1464889_1466101_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 108
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1470915	1471563	4614212		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|1470915_1471299_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|1471353_1471563_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 109
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1486981	1489096	4614212		Morganella_phage(50.0%)	2	NA	NA
WP_000278509.1|1486981_1487410_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|1487530_1489096_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 110
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1492826	1493456	4614212		uncultured_marine_virus(100.0%)	1	NA	NA
WP_000502936.1|1492826_1493456_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	3.8e-56
>prophage 111
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1507992	1514035	4614212		Klosneuvirus(50.0%)	3	NA	NA
WP_000140647.1|1507992_1508808_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_000096701.1|1508804_1509938_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000077809.1|1510153_1514035_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
>prophage 112
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1519015	1573194	4614212	protease,transposase,lysis,integrase,tail	Enterobacteria_phage(48.15%)	53	1549446:1549492	1573208:1573254
WP_001300563.1|1519015_1520128_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956455.1|1520204_1520357_-	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_105929221.1|1520454_1520583_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	3.3e-15
WP_001130654.1|1522626_1523745_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682514.1|1523810_1524059_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|1524123_1524492_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351477.1|1524585_1525239_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153155.1|1525346_1526594_+	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000786310.1|1526661_1528038_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573928.1|1528139_1531283_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	1.7e-59
WP_000717157.1|1531294_1532518_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709865.1|1532533_1532866_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074253.1|1533023_1534397_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770941.1|1534553_1535237_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	2.3e-30
WP_000253838.1|1535226_1536675_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_089581168.1|1538972_1539419_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	37.2	7.2e-17
WP_000889443.1|1539451_1539712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300892.1|1539837_1539999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420970.1|1540963_1542100_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001300620.1|1544594_1547567_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224575.1|1547567_1548458_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177481.1|1548640_1549402_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
1549446:1549492	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201845.1|1549915_1550869_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|1551117_1551867_-	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_000355602.1|1552542_1552836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235987.1|1552846_1553551_-	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	61.7	9.2e-59
WP_000654156.1|1553560_1553842_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_000290529.1|1553838_1556184_-|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	45.4	9.5e-92
WP_103857208.1|1556242_1559074_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	87.5	0.0e+00
WP_001415975.1|1559982_1560177_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000738423.1|1560537_1560831_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|1560921_1561104_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135280.1|1561320_1561818_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_000839596.1|1561817_1562033_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|1562621_1563704_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204780.1|1563893_1564277_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000971071.1|1564362_1564503_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	2.5e-08
WP_001099655.1|1564499_1564862_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	97.4	7.3e-60
WP_000774479.1|1564858_1565149_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_000224907.1|1565141_1565312_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001054340.1|1565311_1565767_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_001303586.1|1565763_1565865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|1565981_1566779_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001306955.1|1566788_1567340_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|1567804_1569331_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001299444.1|1569388_1569538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070454.1|1569585_1569918_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|1569985_1570288_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001386642.1|1570907_1571189_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763373.1|1571287_1571506_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000488419.1|1571553_1571832_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	98.9	1.7e-48
WP_000446905.1|1571803_1572175_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_001318654.1|1572030_1573194_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	1.3e-198
1573208:1573254	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 113
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1580273	1583404	4614212	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_000729160.1|1580273_1581140_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|1581141_1581354_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143561.1|1581461_1581983_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|1582018_1583404_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 114
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1594923	1596069	4614212		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706355.1|1594923_1596069_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 115
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1602259	1604041	4614212		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096881.1|1602259_1604041_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
>prophage 116
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1610414	1618222	4614212		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_000014858.1|1610414_1614695_-	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000561803.1|1615124_1617539_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001110573.1|1617535_1618222_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 117
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1621358	1622036	4614212		Bacillus_virus(100.0%)	1	NA	NA
WP_001157551.1|1621358_1622036_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 118
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1626575	1629838	4614212		uncultured_virus(50.0%)	2	NA	NA
WP_000083955.1|1626575_1629080_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
WP_000806442.1|1629496_1629838_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
>prophage 119
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1638082	1646644	4614212		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801849.1|1638082_1639042_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.7	2.2e-15
WP_001250117.1|1639038_1640001_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|1640236_1640881_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678201.1|1641061_1642936_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|1643045_1643651_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|1643650_1643980_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122013.1|1644032_1645964_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|1646092_1646644_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 120
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1653652	1656802	4614212		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|1653652_1656802_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 121
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1665638	1669185	4614212		Bacillus_phage(100.0%)	2	NA	NA
WP_001256174.1|1665638_1667420_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
WP_001235579.1|1667412_1669185_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	3.4e-49
>prophage 122
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1672508	1673204	4614212		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817236.1|1672508_1673204_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	8.4e-89
>prophage 123
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1676344	1681391	4614212	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|1676344_1676617_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|1676825_1679180_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|1679367_1680642_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|1680767_1681391_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 124
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1705233	1714213	4614212	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|1705233_1705704_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150456.1|1705792_1706896_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	1.7e-54
WP_000543535.1|1706899_1707349_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001301329.1|1707499_1708039_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|1708337_1709222_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|1709398_1709746_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|1709873_1710845_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|1710855_1712703_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|1712730_1713063_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|1713085_1714213_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 125
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1721165	1731242	4614212		Bacillus_phage(60.0%)	7	NA	NA
WP_000893580.1|1721165_1722461_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	2.9e-26
WP_000113933.1|1722518_1723208_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221319.1|1723397_1724600_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698909.1|1724596_1727743_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_012767698.1|1727868_1729053_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219309.1|1729297_1730206_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|1730330_1731242_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 126
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1737085	1738201	4614212		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|1737085_1738201_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 127
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1745616	1746774	4614212		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830738.1|1745616_1746774_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 128
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1753667	1754435	4614212		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939399.1|1753667_1754435_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-25
>prophage 129
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1757621	1758731	4614212		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842100.1|1757621_1758731_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 130
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1762112	1764073	4614212		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_001013494.1|1762112_1763126_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	9.2e-44
WP_000044314.1|1763122_1764073_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
>prophage 131
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1769483	1773763	4614212		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805902.1|1769483_1770566_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
WP_000177906.1|1770688_1773763_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	100.0	0.0e+00
>prophage 132
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1778303	1779203	4614212		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952503.1|1778303_1779203_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 133
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1782307	1784194	4614212		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010267.1|1782307_1784194_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	1.6e-52
>prophage 134
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1792967	1794017	4614212		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_000692754.1|1792967_1794017_-	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.6	2.8e-72
>prophage 135
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1805404	1811324	4614212	holin	Vibrio_phage(50.0%)	4	NA	NA
WP_000131044.1|1805404_1807438_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001301261.1|1807566_1808154_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089084.1|1808167_1809640_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159087.1|1809653_1811324_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	3.6e-61
>prophage 136
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1816899	1818225	4614212		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001046311.1|1816899_1818225_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	1.2e-112
>prophage 137
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1838431	1845995	4614212		Streptococcus_phage(50.0%)	6	NA	NA
WP_000667062.1|1838431_1840630_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	1.5e-38
WP_000122394.1|1840639_1841596_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111356.1|1841574_1841985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000893272.1|1842301_1843555_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	7.5e-96
WP_001285288.1|1843566_1844670_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749880.1|1844957_1845995_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.1	4.3e-113
>prophage 138
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1857517	1861436	4614212		Clostridioides_phage(50.0%)	6	NA	NA
WP_001353765.1|1857517_1858291_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|1858476_1858737_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615981.1|1858739_1859018_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|1859173_1859914_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333379.1|1859884_1860652_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|1860857_1861436_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 139
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1869827	1877459	4614212		Bradyrhizobium_phage(25.0%)	9	NA	NA
WP_001300756.1|1869827_1870559_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.1	1.3e-39
WP_000917883.1|1870623_1871091_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|1871087_1871810_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052717.1|1871843_1872599_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|1872670_1874029_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000016015.1|1874076_1874700_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001230983.1|1874703_1875504_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648577.1|1875744_1876659_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997050.1|1876655_1877459_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	1.4e-39
>prophage 140
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1884064	1885096	4614212		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|1884064_1885096_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 141
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1898099	1902215	4614212		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294774.1|1898099_1901582_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569405.1|1901618_1902215_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.3	6.0e-27
>prophage 142
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1911043	1911802	4614212		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|1911043_1911802_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 143
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1924399	1925824	4614212	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|1924399_1925824_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 144
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1929753	1930098	4614212		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|1929753_1930098_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 145
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1936132	1936930	4614212		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|1936132_1936930_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 146
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1942164	1948970	4614212	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_001301345.1|1942164_1944594_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	28.8	1.3e-40
WP_001294674.1|1944667_1945198_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396020.1|1945212_1945917_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_084831846.1|1946094_1946550_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937398.1|1946586_1947513_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174632.1|1947551_1948970_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 147
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1958876	1959779	4614212		Sodalis_phage(100.0%)	1	NA	NA
WP_000339954.1|1958876_1959779_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	7.4e-61
>prophage 148
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1963041	1969664	4614212		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150637.1|1963041_1963968_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|1964076_1964739_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|1964779_1965316_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_001297052.1|1965521_1967912_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_001189577.1|1968113_1969664_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 149
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1977409	1978834	4614212		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|1977409_1978834_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 150
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1987461	1988013	4614212		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|1987461_1988013_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 151
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1992258	1993302	4614212		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217335.1|1992258_1993302_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.0	6.3e-104
>prophage 152
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2019391	2021116	4614212		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425661.1|2019391_2021116_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.4e-36
>prophage 153
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2033818	2034517	4614212		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916325.1|2033818_2034517_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 154
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2040965	2046388	4614212		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035693.1|2040965_2043317_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	3.0e-37
WP_001117011.1|2043481_2046388_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 155
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2054132	2055532	4614212		Microcystis_phage(50.0%)	2	NA	NA
WP_000257192.1|2054132_2054975_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
WP_000624375.1|2055052_2055532_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 156
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2063425	2069085	4614212		Vibrio_phage(50.0%)	3	NA	NA
WP_000787118.1|2063425_2064940_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	1.6e-07
WP_000347117.1|2064970_2066113_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000351506.1|2067531_2069085_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	2.0e-34
>prophage 157
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2074679	2075828	4614212		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|2074679_2075828_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 158
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2080271	2083088	4614212	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286879.1|2080271_2083088_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	1.2e-77
>prophage 159
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2090896	2101315	4614212	transposase	uncultured_Caudovirales_phage(20.0%)	10	NA	NA
WP_000681360.1|2090896_2092063_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
WP_000935262.1|2092592_2092802_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001300563.1|2092995_2094108_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001118446.1|2094254_2095385_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|2095473_2097390_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843568.1|2097766_2098171_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102353.1|2098196_2098910_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|2099058_2099625_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094682.1|2099659_2100247_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130189.1|2100361_2101315_-	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
>prophage 160
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2113082	2115196	4614212		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_001219614.1|2113082_2114507_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
WP_001188664.1|2114506_2115196_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
>prophage 161
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2118479	2123834	4614212		Bacillus_phage(33.33%)	3	NA	NA
WP_000409456.1|2118479_2120417_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|2120627_2122295_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|2122601_2123834_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
>prophage 162
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2130577	2131900	4614212		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|2130577_2131900_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 163
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2137839	2140715	4614212		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|2137839_2138001_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|2138127_2138733_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175940.1|2139125_2140715_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
>prophage 164
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2148611	2149891	4614212		Salmonella_phage(50.0%)	2	NA	NA
WP_000098818.1|2148611_2149151_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|2149153_2149891_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 165
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2153116	2158471	4614212		Tupanvirus(50.0%)	3	NA	NA
WP_000106030.1|2153116_2154139_-	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_000410113.1|2155405_2156767_+	MFS transporter	NA	NA	NA	NA	NA
WP_000919572.1|2156815_2158471_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 166
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2196964	2197519	4614212		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151855.1|2196964_2197519_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 167
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2204087	2205548	4614212		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208176.1|2204087_2205548_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	6.2e-49
>prophage 168
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2216965	2225323	4614212	transposase	uncultured_Caudovirales_phage(20.0%)	8	NA	NA
WP_000684856.1|2216965_2217922_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|2217922_2218690_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|2219246_2219504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088391.1|2220437_2220740_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000336726.1|2220775_2221594_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_001293436.1|2221747_2223745_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000625671.1|2223807_2224221_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_085948656.1|2224155_2225323_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
>prophage 169
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2234974	2235994	4614212		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001318460.1|2234974_2235994_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
>prophage 170
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2241121	2250397	4614212	tRNA	Klebsiella_phage(33.33%)	6	NA	NA
WP_001294573.1|2241121_2242624_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.2	4.6e-84
WP_001295681.1|2242784_2243867_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|2243866_2244967_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|2245233_2246745_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786393.1|2247098_2247542_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416403.1|2247541_2250397_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
>prophage 171
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2258739	2264836	4614212		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013046.1|2258739_2259675_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|2259687_2260149_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|2260221_2260608_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471889.1|2260813_2263510_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|2263650_2263704_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181324.1|2263888_2264836_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
>prophage 172
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2268474	2271236	4614212		Vibrio_phage(50.0%)	2	NA	NA
WP_000187778.1|2268474_2270613_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106238.1|2270771_2271236_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
>prophage 173
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2275552	2282040	4614212		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|2275552_2276551_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|2276583_2277579_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001297255.1|2277565_2278588_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000210558.1|2278601_2280104_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265933.1|2280243_2281200_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|2281509_2282040_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
>prophage 174
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2322059	2323223	4614212		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943964.1|2322059_2323223_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
>prophage 175
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2327155	2340186	4614212	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
WP_000076332.1|2327155_2329597_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
WP_001177644.1|2329635_2330061_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|2330265_2331564_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089294.1|2331667_2331865_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|2331946_2332951_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|2332953_2334213_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|2334298_2335579_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|2335654_2335963_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|2336048_2336999_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122505.1|2336991_2338839_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000640382.1|2338848_2340186_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 176
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2344101	2344647	4614212		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|2344101_2344647_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 177
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2352074	2353052	4614212		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|2352074_2353052_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 178
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2357972	2358509	4614212		Morganella_phage(100.0%)	1	NA	NA
WP_001238379.1|2357972_2358509_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	3.6e-47
>prophage 179
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2363013	2364997	4614212		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|2363013_2364660_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|2364703_2364997_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 180
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2379274	2382486	4614212	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856841.1|2379274_2380732_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	8.9e-48
WP_001295090.1|2380968_2382486_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.0e-87
>prophage 181
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2403682	2405185	4614212		Burkholderia_virus(100.0%)	1	NA	NA
WP_001298520.1|2403682_2405185_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 182
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2410421	2411210	4614212		Cedratvirus(100.0%)	1	NA	NA
WP_001193397.1|2410421_2411210_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	4.2e-12
>prophage 183
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2416814	2418364	4614212		Bacillus_virus(50.0%)	2	NA	NA
WP_001075514.1|2416814_2417573_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
WP_000611405.1|2417683_2418364_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
>prophage 184
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2424598	2430967	4614212		Bacillus_virus(50.0%)	5	NA	NA
WP_000235257.1|2424598_2426131_+	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.4	4.4e-13
WP_000507106.1|2426109_2427090_+	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_001311314.1|2427100_2427796_+	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001171687.1|2427779_2428709_+	allose kinase	NA	NA	NA	NA	NA
WP_001066028.1|2428981_2430967_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	1.6e-148
>prophage 185
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2436212	2438360	4614212		Escherichia_phage(100.0%)	1	NA	NA
WP_012767779.1|2436212_2438360_+	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	25.2	4.7e-29
>prophage 186
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2447982	2449941	4614212		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|2447982_2449941_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 187
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2455527	2456877	4614212		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|2455527_2456877_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 188
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2460694	2464308	4614212		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|2460694_2461231_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357744.1|2461485_2464308_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.0	0.0e+00
>prophage 189
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2468495	2471043	4614212		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_001147328.1|2468495_2469575_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|2469627_2471043_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 190
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2477670	2478279	4614212		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|2477670_2478279_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 191
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2502653	2506337	4614212		Dickeya_phage(100.0%)	1	NA	NA
WP_000095995.1|2502653_2506337_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 192
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2521978	2523568	4614212		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187559.1|2521978_2523568_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.9e-68
>prophage 193
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2528930	2530694	4614212		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|2528930_2529203_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940106.1|2529389_2529980_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|2530022_2530694_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 194
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2539911	2548240	4614212		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|2539911_2544135_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|2544211_2548240_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 195
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2552356	2555409	4614212		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|2552356_2553541_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|2554458_2555409_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 196
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2582694	2589941	4614212		Serratia_phage(33.33%)	5	NA	NA
WP_000184830.1|2582694_2584992_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|2585042_2585363_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|2585377_2586457_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001185138.1|2586765_2589267_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424841.1|2589278_2589941_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	4.2e-29
>prophage 197
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2607863	2612367	4614212		Erwinia_phage(50.0%)	5	NA	NA
WP_001293341.1|2607863_2609195_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|2609261_2610188_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|2610280_2610766_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|2610850_2611096_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|2611521_2612367_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 198
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2623941	2628802	4614212		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033722.1|2623941_2624640_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580413.1|2624636_2626010_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270260.1|2626115_2626790_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|2626938_2627922_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|2628181_2628802_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 199
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2645124	2648175	4614212		Escherichia_phage(100.0%)	1	NA	NA
WP_010723259.1|2645124_2648175_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 200
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2655492	2658272	4614212		Escherichia_phage(50.0%)	3	NA	NA
WP_000059678.1|2655492_2656278_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_000621656.1|2656311_2657208_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718889.1|2657375_2658272_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 201
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2674496	2676967	4614212		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|2674496_2675546_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001329395.1|2675557_2676967_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 202
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2681044	2683831	4614212		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|2681044_2683831_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 203
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2697616	2698231	4614212		Streptococcus_phage(100.0%)	1	NA	NA
WP_001301303.1|2697616_2698231_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	2.8e-19
>prophage 204
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2707112	2710399	4614212		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|2707112_2707889_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|2707891_2708407_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|2708410_2708680_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|2708758_2710399_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 205
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2736975	2738805	4614212		Catovirus(100.0%)	1	NA	NA
WP_012767774.1|2736975_2738805_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	9.7e-84
>prophage 206
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2747113	2750972	4614212		Bacillus_phage(100.0%)	3	NA	NA
WP_000383407.1|2747113_2749276_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213584.1|2749359_2750076_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130686.1|2750075_2750972_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	1.1e-24
>prophage 207
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2761289	2762945	4614212		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395844.1|2761289_2762945_+	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.0e-44
>prophage 208
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2771019	2777163	4614212		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612043.1|2771019_2772150_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145183.1|2772154_2772829_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|2772806_2773688_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226602.1|2773706_2774774_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	3.0e-101
WP_000006621.1|2774773_2776036_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_000866670.1|2776032_2777163_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
>prophage 209
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2781205	2786617	4614212		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|2781205_2781535_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|2781665_2782931_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_000535976.1|2783064_2784549_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238890.1|2784595_2786617_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
>prophage 210
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2795089	2796736	4614212		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012606.1|2795089_2796736_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	2.5e-67
>prophage 211
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2810120	2817419	4614212	transposase	Enterobacteria_phage(25.0%)	5	NA	NA
WP_001056273.1|2810120_2811011_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|2811035_2812001_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387752.1|2812005_2813511_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_085947770.1|2813797_2815166_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000102319.1|2815550_2817419_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 212
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2820587	2821580	4614212		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845101.1|2820587_2821580_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	1.3e-50
>prophage 213
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2833534	2841141	4614212		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
WP_000933736.1|2833534_2834905_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334099.1|2835066_2836896_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_000867146.1|2837209_2838250_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|2838335_2839295_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251978.1|2839294_2840185_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|2840367_2841141_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 214
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2852130	2853468	4614212		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|2852130_2853468_+	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 215
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2863666	2871035	4614212		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|2863666_2863924_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|2863887_2864247_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|2864263_2864404_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|2864633_2864714_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059111.1|2865010_2866414_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|2866418_2867519_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|2867518_2868592_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072067.1|2868620_2871035_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 216
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2875741	2876890	4614212		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|2875741_2876890_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 217
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2881317	2882271	4614212		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|2881317_2881731_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|2881842_2882271_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 218
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2889052	2898074	4614212		Aeromonas_phage(25.0%)	10	NA	NA
WP_001087145.1|2889052_2890768_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
WP_000828527.1|2890764_2892258_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.6	2.3e-30
WP_000511289.1|2892304_2892754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027452.1|2892862_2893210_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|2893199_2893562_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148063.1|2893558_2894056_+	radical SAM protein	NA	NA	NA	NA	NA
WP_000828746.1|2894063_2895248_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000060506.1|2895527_2895617_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001300753.1|2896181_2896280_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168475.1|2896385_2898074_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	3.2e-57
>prophage 219
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2905379	2906714	4614212		Moraxella_phage(100.0%)	1	NA	NA
WP_012767770.1|2905379_2906714_+	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	8.6e-66
>prophage 220
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2917362	2920860	4614212		Escherichia_phage(100.0%)	1	NA	NA
WP_001038839.1|2917362_2920860_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.8	3.5e-98
>prophage 221
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2924244	2924730	4614212		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000157061.1|2924244_2924730_-	single-stranded DNA-binding protein	NA	Q1MVN2	Enterobacteria_phage	63.8	4.4e-52
>prophage 222
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2932258	2933443	4614212	integrase	Enterobacteria_phage(100.0%)	1	2917159:2917173	2942465:2942479
2917159:2917173	attL	TTCAGTGATCGCCTG	NA	NA	NA	NA
WP_001218910.1|2932258_2933443_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	2.6e-162
WP_001218910.1|2932258_2933443_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	2.6e-162
2942465:2942479	attR	CAGGCGATCACTGAA	NA	NA	NA	NA
>prophage 223
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2939722	2941114	4614212		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|2939722_2941114_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 224
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2946235	2952985	4614212		Bordetella_phage(25.0%)	6	NA	NA
WP_000280494.1|2946235_2948344_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|2948362_2948638_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|2948692_2949316_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000870047.1|2949573_2951256_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	1.5e-22
WP_000924289.1|2951252_2951870_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001300958.1|2952160_2952985_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	76.6	2.4e-90
>prophage 225
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2956358	2960921	4614212		Xanthomonas_phage(25.0%)	7	NA	NA
WP_000976070.1|2956358_2956817_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
WP_000050139.1|2956794_2958015_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001321683.1|2958186_2958855_+	RadC family protein	NA	NA	NA	NA	NA
WP_000091955.1|2959071_2959308_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|2959328_2959496_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114543.1|2959593_2960403_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|2960441_2960921_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 226
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2968359	2970453	4614212		Archaeal_BJ1_virus(50.0%)	2	NA	NA
WP_000364777.1|2968359_2969385_+	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	26.1	7.2e-12
WP_000064010.1|2969469_2970453_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
>prophage 227
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2973861	2983368	4614212		Synechococcus_phage(16.67%)	9	NA	NA
WP_000587764.1|2973861_2974794_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
WP_001213837.1|2975007_2976204_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	1.1e-35
WP_000646014.1|2976213_2977239_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982115.1|2977477_2978512_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000483856.1|2978498_2979458_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_032201712.1|2979461_2980745_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116565.1|2980754_2982299_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|2982543_2982975_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|2983116_2983368_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 228
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3005465	3015615	4614212	tRNA	uncultured_Caudovirales_phage(66.67%)	6	NA	NA
WP_140441354.1|3005465_3006299_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.9	1.5e-23
WP_000072850.1|3006451_3007294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112843493.1|3007314_3011448_-	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.3	9.3e-26
WP_000779792.1|3011676_3012285_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000206275.1|3012382_3013774_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000582441.1|3013770_3015615_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
>prophage 229
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3050984	3051980	4614212		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182642.1|3050984_3051980_-	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.8	3.5e-11
>prophage 230
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3055817	3057818	4614212	transposase	Macacine_betaherpesvirus(50.0%)	3	NA	NA
WP_085947770.1|3055817_3057187_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001135732.1|3057266_3057419_+	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_000014594.1|3057605_3057818_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 231
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3061472	3063806	4614212		Escherichia_phage(100.0%)	1	NA	NA
WP_000013961.1|3061472_3063806_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.8	3.1e-71
>prophage 232
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3074018	3076003	4614212		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196486.1|3074018_3075002_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
WP_000107012.1|3074998_3076003_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
>prophage 233
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3123707	3124355	4614212		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|3123707_3124355_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 234
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3127748	3129883	4614212		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065769.1|3127748_3128174_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
WP_000922639.1|3128186_3129476_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008957.1|3129529_3129883_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 235
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3133228	3135271	4614212		Indivirus(100.0%)	1	NA	NA
WP_001295214.1|3133228_3135271_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 236
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3148874	3151610	4614212		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149156.1|3148874_3151610_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
>prophage 237
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3154985	3160637	4614212		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_112843495.1|3154985_3159221_-	rhs element protein RhsB	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	9.6e-26
WP_001190062.1|3159423_3159825_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173665.1|3159830_3160637_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
>prophage 238
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3168530	3172662	4614212		Dickeya_phage(50.0%)	4	NA	NA
WP_001100469.1|3168530_3169196_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
WP_000130621.1|3169416_3169662_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106517.1|3169763_3171962_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.1	2.5e-118
WP_000964718.1|3172035_3172662_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 239
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3175668	3178487	4614212		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617726.1|3175668_3176337_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	3.8e-14
WP_001042003.1|3176329_3177388_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|3177632_3178487_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 240
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3184220	3185703	4614212		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|3184220_3184988_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416895.1|3184989_3185703_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 241
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3189244	3191055	4614212		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907792.1|3189244_3190315_+	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073599.1|3190311_3191055_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	2.9e-10
>prophage 242
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3211065	3213513	4614212		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|3211065_3213513_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 243
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3222421	3223648	4614212		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105478.1|3222421_3223648_+	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	59.5	4.9e-132
>prophage 244
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3228027	3230421	4614212		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081903.1|3228027_3230421_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 245
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3236390	3237269	4614212		Sodalis_phage(100.0%)	1	NA	NA
WP_000039090.1|3236390_3237269_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 246
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3243832	3247599	4614212		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|3243832_3244552_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253696.1|3244548_3245901_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001265681.1|3245976_3247599_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 247
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3264505	3265342	4614212		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|3264505_3265342_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 248
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3290366	3299907	4614212		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601847.1|3290366_3290930_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
WP_000963792.1|3291015_3292236_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_012775971.1|3292302_3294393_-	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|3294443_3295076_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|3295377_3295782_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|3295836_3296706_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|3296759_3296978_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057356.1|3296971_3297994_-	hydrolase	NA	NA	NA	NA	NA
WP_000634798.1|3297993_3299907_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 249
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3305477	3314036	4614212		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
WP_001209710.1|3305477_3305864_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
WP_000820720.1|3305863_3306223_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_000903377.1|3306230_3306518_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|3306643_3307018_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|3307114_3307585_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|3307681_3309796_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|3309866_3311051_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000773143.1|3311342_3314036_+	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	35.7	3.3e-40
>prophage 250
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3322866	3324819	4614212		Vibrio_phage(100.0%)	1	NA	NA
WP_001326512.1|3322866_3324819_-	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	9.2e-32
>prophage 251
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3346034	3347506	4614212	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004473.1|3346034_3346982_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|3346996_3347506_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 252
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3358012	3362166	4614212		Bacillus_virus(50.0%)	4	NA	NA
WP_000078349.1|3358012_3358771_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
WP_001301413.1|3358778_3359882_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000019664.1|3359891_3361073_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738568.1|3361140_3362166_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
>prophage 253
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3368670	3369555	4614212		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258917.1|3368670_3369555_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.5	6.4e-25
>prophage 254
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3380120	3381164	4614212		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3380120_3381164_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 255
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3397933	3400458	4614212	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497724.1|3397933_3399001_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|3399090_3400458_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 256
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3404424	3404922	4614212	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|3404424_3404922_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 257
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3408626	3410117	4614212		Burkholderia_virus(100.0%)	1	NA	NA
WP_000108459.1|3408626_3410117_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 258
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3419813	3434608	4614212		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001299745.1|3419813_3420743_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|3420838_3423175_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001300411.1|3423404_3424058_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047091.1|3424054_3424783_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620405.1|3424779_3425412_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|3425625_3425898_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|3425894_3426749_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|3426794_3427286_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|3427403_3427691_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|3427713_3429147_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|3429194_3429920_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_084831852.1|3429926_3430484_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030530.1|3430452_3431028_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030016.1|3431024_3431591_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001295557.1|3431611_3432598_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922900.1|3432611_3433589_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|3433798_3434608_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 259
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3438676	3440155	4614212		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|3438676_3438955_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|3439183_3440155_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 260
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3446929	3449802	4614212	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|3446929_3448864_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|3448953_3449802_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 261
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3453884	3460523	4614212		Dickeya_phage(50.0%)	4	NA	NA
WP_000207665.1|3453884_3455228_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.1	3.1e-63
WP_001300397.1|3455858_3456311_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031057.1|3456338_3457826_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133044.1|3457850_3460523_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 262
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3466004	3467894	4614212		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|3466004_3467894_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 263
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3473596	3481390	4614212		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189314.1|3473596_3473899_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
WP_000449030.1|3473949_3474393_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|3474372_3474891_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001301320.1|3475018_3475654_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147624.1|3475726_3476767_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|3476880_3477456_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158034.1|3477465_3478056_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246830.1|3478075_3478471_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249099.1|3478428_3480465_-	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000809262.1|3480529_3481390_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
>prophage 264
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3504399	3505545	4614212		Streptococcus_phage(100.0%)	1	NA	NA
WP_001300387.1|3504399_3505545_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 265
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3513646	3515941	4614212		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|3513646_3515941_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 266
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3536736	3537702	4614212		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|3536736_3537702_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 267
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3550556	3566752	4614212	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_001082928.1|3550556_3553649_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	6.5e-157
WP_000212475.1|3553832_3554816_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_084831847.1|3555034_3555367_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000627220.1|3555408_3556899_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-33
WP_000094721.1|3557205_3558726_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_000018003.1|3558879_3559503_-	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_001059839.1|3559790_3560555_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228937.1|3560808_3561315_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437375.1|3561393_3563235_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918827.1|3563429_3565175_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|3565285_3565501_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264352.1|3565738_3566752_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 268
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3573135	3574374	4614212	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708487.1|3573135_3574374_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 269
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3579511	3580945	4614212		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|3579511_3580945_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 270
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3590460	3601423	4614212		Staphylococcus_phage(20.0%)	12	NA	NA
WP_001076997.1|3590460_3591114_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|3591375_3591546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295627.1|3591603_3592377_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000188362.1|3592492_3593308_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|3593345_3594506_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|3594511_3595183_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|3595330_3596812_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|3597016_3597646_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|3597646_3598069_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444752.1|3598093_3598921_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|3598920_3599502_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195296.1|3599530_3601423_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 271
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3605250	3605643	4614212		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|3605250_3605643_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 272
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3608953	3618304	4614212		Bacillus_virus(33.33%)	7	NA	NA
WP_001281877.1|3608953_3611212_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000965712.1|3611445_3612183_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059388.1|3612257_3613670_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095154.1|3613780_3616000_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848528.1|3616042_3616300_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000691619.1|3616350_3617277_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013149.1|3617476_3618304_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 273
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3624380	3625265	4614212		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|3624380_3625265_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 274
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3647478	3648651	4614212		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524970.1|3647478_3648651_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	5.5e-40
>prophage 275
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3695680	3696664	4614212		Tetraselmis_virus(100.0%)	1	NA	NA
WP_024181915.1|3695680_3696664_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.4	1.4e-36
>prophage 276
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3700891	3703026	4614212		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692300.1|3700891_3701113_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
WP_001347688.1|3701175_3701652_-	RadC family protein	NA	NA	NA	NA	NA
WP_000849578.1|3701667_3702153_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.4	2.0e-12
WP_001234644.1|3702207_3703026_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.3	7.4e-44
>prophage 277
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3735405	3736560	4614212		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|3735405_3736560_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 278
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3764855	3766088	4614212		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|3764855_3766088_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 279
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3774223	3779596	4614212		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_000195061.1|3774223_3777097_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	3.7e-263
WP_000951948.1|3777362_3778106_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012775976.1|3778162_3779596_-	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.1	4.4e-31
>prophage 280
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3783520	3798912	4614212	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|3783520_3784417_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715216.1|3784441_3785152_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813212.1|3785157_3786891_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_001701073.1|3786981_3788079_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003071.1|3788089_3789607_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192790.1|3789649_3790198_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|3790252_3790324_+	protein YqfH	NA	NA	NA	NA	NA
WP_001050745.1|3790320_3790446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|3790447_3791896_-	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001300605.1|3792331_3794251_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838422.1|3794250_3794739_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012163.1|3794774_3796142_-	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001301062.1|3796177_3797494_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280199.1|3797511_3798912_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 281
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3823370	3825947	4614212	transposase	Clostridium_phage(50.0%)	2	NA	NA
WP_001301085.1|3823370_3824126_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
WP_000878219.1|3825080_3825947_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
>prophage 282
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3831137	3833632	4614212		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603518.1|3831137_3831899_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
WP_000256436.1|3832213_3833632_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.0e-24
>prophage 283
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3843263	3850036	4614212		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|3843263_3843977_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082201.1|3844045_3844735_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|3845419_3845950_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957907.1|3845962_3848209_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	4.6e-11
WP_000204658.1|3848359_3849235_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816234.1|3849241_3850036_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 284
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3855513	3871061	4614212	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_001138150.1|3855513_3858402_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
WP_001285992.1|3858394_3861937_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.9	1.5e-08
WP_000775931.1|3861936_3863763_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
WP_000237947.1|3863824_3865156_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|3865387_3866641_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000678646.1|3867219_3868317_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117728.1|3868555_3869362_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000184261.1|3869412_3869856_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001300698.1|3869855_3871061_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	3.0e-73
>prophage 285
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3879283	3880783	4614212		Bacillus_virus(100.0%)	1	NA	NA
WP_000004944.1|3879283_3880783_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.8	3.9e-14
>prophage 286
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3887500	3888346	4614212		Bacillus_phage(100.0%)	1	NA	NA
WP_001214598.1|3887500_3888346_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.6e-10
>prophage 287
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3893114	3893963	4614212		Vibrio_phage(100.0%)	1	NA	NA
WP_000100420.1|3893114_3893963_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	8.0e-41
>prophage 288
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3901498	3905613	4614212		Hokovirus(50.0%)	2	NA	NA
WP_000186439.1|3901498_3904255_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	1.9e-54
WP_000046810.1|3904311_3905613_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	3.9e-39
>prophage 289
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3909645	3914565	4614212		Only_Syngen_Nebraska_virus(33.33%)	5	NA	NA
WP_000210878.1|3909645_3911283_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|3911370_3912669_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_001268460.1|3912728_3913601_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001288228.1|3913614_3913755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001199973.1|3913893_3914565_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 290
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3919466	3920252	4614212		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021321.1|3919466_3920252_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 291
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3936513	3938546	4614212		Hokovirus(50.0%)	2	NA	NA
WP_001090386.1|3936513_3937941_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.1	1.1e-29
WP_001173673.1|3937940_3938546_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 292
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3941658	3954841	4614212		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|3941658_3942420_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|3942413_3943040_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|3943179_3944319_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|3944381_3945374_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104459.1|3945467_3946832_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136925.1|3946920_3947697_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|3947701_3948340_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590371.1|3948336_3949599_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	4.9e-135
WP_000847971.1|3949595_3950504_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_001272546.1|3950669_3951467_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	4.5e-70
WP_001141307.1|3951517_3952174_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	8.6e-51
WP_001272928.1|3952279_3954841_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 293
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3972669	3973680	4614212		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001320117.1|3972669_3973680_+	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.6	3.5e-27
>prophage 294
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3981155	3982121	4614212		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287420.1|3981155_3982121_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 295
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3987588	3992974	4614212	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|3987588_3988086_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963143.1|3988165_3989227_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140508.1|3989295_3989796_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047185.1|3989923_3992554_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|3992788_3992974_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 296
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4006022	4011317	4614212		Bacillus_virus(20.0%)	5	NA	NA
WP_000985494.1|4006022_4007225_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777972.1|4007578_4008538_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	1.0e-132
WP_000246527.1|4008547_4010692_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
WP_000080947.1|4010664_4011075_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|4011071_4011317_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 297
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4015252	4019377	4614212		Clostridium_phage(50.0%)	4	NA	NA
WP_000522424.1|4015252_4015702_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|4015702_4016365_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001301367.1|4016385_4017786_-	GABA permease	NA	NA	NA	NA	NA
WP_000097642.1|4018096_4019377_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	4.2e-33
>prophage 298
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4026306	4030601	4614212	integrase	Clostridium_phage(33.33%)	3	4015796:4015809	4030911:4030924
4015796:4015809	attL	TACCGCCGCAGTCA	NA	NA	NA	NA
WP_000135616.1|4026306_4027863_-	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	30.0	3.2e-19
WP_001062342.1|4028145_4029375_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	86.6	4.6e-207
WP_000162574.1|4030118_4030601_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
4030911:4030924	attR	TGACTGCGGCGGTA	NA	NA	NA	NA
>prophage 299
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4044234	4045305	4614212		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168045.1|4044234_4045305_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 300
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4051210	4053784	4614212		Enterobacteria_phage(100.0%)	1	NA	NA
WP_084831874.1|4051210_4053784_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
>prophage 301
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4059552	4060851	4614212		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|4059552_4060851_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 302
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4066144	4072403	4614212	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|4066144_4066564_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|4066770_4067808_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262713.1|4067855_4068545_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	9.3e-56
WP_000627807.1|4068849_4069233_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189210.1|4069288_4069876_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001300638.1|4069978_4070860_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|4071068_4072403_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 303
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4078174	4081917	4614212		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|4078174_4079974_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|4079989_4080964_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|4081236_4081917_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 304
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4085376	4085637	4614212		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|4085376_4085637_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 305
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4090532	4101822	4614212		Bacillus_phage(50.0%)	7	NA	NA
WP_000970117.1|4090532_4094420_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	5.9e-131
WP_001297612.1|4094977_4096405_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_001215861.1|4096569_4097283_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001295369.1|4097272_4098607_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|4098667_4099006_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883122.1|4099050_4100241_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|4100568_4101822_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 306
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4107714	4109226	4614212		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493466.1|4107714_4109226_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.7	1.8e-11
>prophage 307
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4124544	4130881	4614212		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|4124544_4125759_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|4125786_4126173_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|4126189_4126513_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384413.1|4126608_4127124_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196611.1|4127140_4128991_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124469.1|4128992_4129328_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|4129339_4129540_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133580.1|4129597_4130881_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
>prophage 308
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4141091	4141523	4614212		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|4141091_4141523_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 309
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4150353	4157613	4614212		Escherichia_phage(66.67%)	7	NA	NA
WP_000937912.1|4150353_4151724_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.4e-42
WP_001299507.1|4151885_4153352_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138270.1|4153420_4154998_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755173.1|4155090_4155630_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_162633420.1|4156788_4156938_-	hypothetical protein	NA	G9L6F1	Escherichia_phage	100.0	5.3e-17
WP_000076001.1|4157251_4157443_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017552.1|4157460_4157613_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 310
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4163859	4167861	4614212		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028614.1|4163859_4164498_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001295474.1|4164497_4165535_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|4165859_4166486_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|4166571_4167861_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 311
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4189105	4189819	4614212		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|4189105_4189819_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 312
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4207107	4208058	4614212		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|4207107_4208058_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 313
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4226811	4230533	4614212		Deep-sea_thermophilic_phage(50.0%)	5	NA	NA
WP_000102886.1|4226811_4227681_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406000.1|4227894_4228320_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_001300381.1|4228306_4228756_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838937.1|4228962_4229538_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|4229633_4230533_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
>prophage 314
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4234186	4234978	4614212		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000517428.1|4234186_4234978_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.2e-17
>prophage 315
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4237995	4250665	4614212		Streptococcus_phage(40.0%)	12	NA	NA
WP_000021019.1|4237995_4239093_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.9	1.4e-29
WP_001295461.1|4239226_4240138_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	7.7e-58
WP_000710495.1|4240342_4241077_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_000719959.1|4241109_4241484_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096674.1|4241588_4242440_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|4242482_4242992_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|4243032_4244760_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|4244804_4245062_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|4245445_4246417_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|4246601_4247363_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001297862.1|4247592_4248579_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443700.1|4248649_4250665_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	5.9e-151
>prophage 316
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4272211	4272946	4614212		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|4272211_4272946_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 317
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4276764	4277685	4614212		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|4276764_4277685_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 318
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4281376	4288953	4614212		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283490.1|4281376_4283071_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
WP_000955025.1|4283140_4284085_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001296867.1|4284158_4285304_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_001326970.1|4285359_4288953_-	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	1.1e-09
>prophage 319
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4296816	4309194	4614212	integrase	Enterobacteria_phage(50.0%)	12	4296728:4296743	4308111:4308126
4296728:4296743	attL	ATGGTGTCCCCTGCAG	NA	NA	NA	NA
WP_001163428.1|4296816_4297017_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001281201.1|4297140_4297485_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	97.4	1.1e-57
WP_001593216.1|4297930_4299769_+	hypothetical protein	NA	A0A192Y934	Salmonella_phage	74.6	4.0e-247
WP_000766785.1|4299793_4300183_-	hypothetical protein	NA	I6S5X4	Salmonella_phage	88.4	3.0e-59
WP_001211768.1|4300198_4300534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090234.1|4300530_4300785_-	Arc family DNA-binding protein	NA	A5VW60	Enterobacteria_phage	91.2	1.4e-33
WP_000677939.1|4300875_4301037_+	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	98.1	2.7e-22
WP_000835339.1|4301105_4301984_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	78.9	1.1e-96
WP_112843497.1|4302085_4304734_+	hypothetical protein	NA	A5VW57	Enterobacteria_phage	76.5	8.3e-60
WP_112843498.1|4304780_4306106_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_084831851.1|4306792_4307950_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.5	2.8e-222
WP_000368117.1|4308261_4309194_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.4	2.3e-166
4308111:4308126	attR	ATGGTGTCCCCTGCAG	NA	NA	NA	NA
>prophage 320
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4327871	4328957	4614212		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|4327871_4328957_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 321
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4337493	4338630	4614212		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699145.1|4337493_4338630_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.9e-23
>prophage 322
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4345106	4346624	4614212		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|4345106_4346624_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 323
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4350835	4352696	4614212		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293613.1|4350835_4351609_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000156140.1|4351805_4352696_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.2	5.2e-67
>prophage 324
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4363256	4366484	4614212		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203392.1|4363256_4363907_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.4	3.1e-08
WP_001012899.1|4363993_4365826_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813860.1|4365884_4366484_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 325
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4385432	4386790	4614212	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_085950470.1|4385432_4386790_-|transposase	IS3-like element ISEcB1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.9	2.5e-76
>prophage 326
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4402402	4407406	4614212		Tupanvirus(50.0%)	4	NA	NA
WP_000860273.1|4402402_4404385_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
WP_000461657.1|4404384_4405353_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_001295286.1|4405356_4406496_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.5e-29
WP_000879113.1|4406803_4407406_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	2.6e-09
>prophage 327
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4411009	4415325	4614212	transposase	Oenococcus_phage(50.0%)	4	NA	NA
WP_001319848.1|4411009_4412215_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
WP_012767744.1|4412271_4413561_+	MFS transporter	NA	NA	NA	NA	NA
WP_000992954.1|4413578_4414382_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_000140557.1|4414422_4415325_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.4	2.1e-68
>prophage 328
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4421217	4427372	4614212		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000779102.1|4421217_4422294_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.0e-08
WP_000301050.1|4422756_4423407_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135040.1|4423460_4423715_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|4423714_4424845_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001075164.1|4425086_4427372_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
>prophage 329
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4432816	4435444	4614212		Bacillus_virus(100.0%)	1	NA	NA
WP_001281254.1|4432816_4435444_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
>prophage 330
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4450367	4455210	4614212		Bacillus_phage(50.0%)	2	NA	NA
WP_000559135.1|4450367_4452194_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
WP_000876025.1|4452360_4455210_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	2.4e-41
>prophage 331
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4461830	4465264	4614212		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_000710372.1|4461830_4462895_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	2.4e-18
WP_084831849.1|4462894_4463545_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	32.7	2.9e-06
WP_000422182.1|4463620_4465264_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.2e-13
>prophage 332
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4474712	4475330	4614212		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|4474712_4475330_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 333
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4487204	4494852	4614212		Vibrio_phage(50.0%)	7	NA	NA
WP_000050798.1|4487204_4488212_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	6.9e-84
WP_000494183.1|4488350_4488635_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578061.1|4488759_4490520_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	2.4e-100
WP_001234850.1|4490668_4491364_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213361.1|4491391_4492582_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_000202794.1|4492914_4493259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194943.1|4493262_4494852_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	3.2e-19
>prophage 334
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4500606	4504907	4614212		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|4500606_4501173_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_001300998.1|4501584_4502298_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198822.1|4502336_4503323_-	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001091940.1|4503440_4504907_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.3e-43
>prophage 335
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4519404	4520262	4614212		Catovirus(100.0%)	1	NA	NA
WP_000873881.1|4519404_4520262_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
>prophage 336
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4524332	4528118	4614212		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489227.1|4524332_4526324_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
WP_000425438.1|4526355_4527192_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|4527449_4528118_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 337
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4531812	4533333	4614212		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_084831864.1|4531812_4533333_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 338
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4553735	4563177	4614212		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569344.1|4553735_4554662_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
WP_000783120.1|4554666_4555398_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216966.1|4555378_4555486_-	protein YohO	NA	NA	NA	NA	NA
WP_001240403.1|4555545_4556277_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|4556498_4558184_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4558180_4558900_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4558946_4559417_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|4559457_4559919_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001300967.1|4560043_4562044_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001300968.1|4562040_4563177_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 339
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4574809	4576843	4614212	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001300978.1|4574809_4576843_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	2.3e-54
>prophage 340
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4584609	4586127	4614212		Streptococcus_phage(100.0%)	1	NA	NA
WP_058128041.1|4584609_4586127_+	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	30.1	1.3e-30
>prophage 341
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4589137	4589713	4614212		Mycobacterium_phage(100.0%)	1	NA	NA
WP_058128045.1|4589137_4589713_-	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	38.7	1.4e-25
>prophage 342
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4595977	4599534	4614212		Paenibacillus_phage(50.0%)	4	NA	NA
WP_001300994.1|4595977_4596796_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	2.9e-24
WP_000434038.1|4596847_4597594_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011997.1|4597567_4598533_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846243.1|4598529_4599534_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	5.8e-14
>prophage 343
NZ_CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4608746	4613951	4614212	integrase	Salmonella_phage(37.5%)	9	4601673:4601685	4613329:4613341
4601673:4601685	attL	TAACTCCGCCTTT	NA	NA	NA	NA
WP_000807361.1|4608746_4609646_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001318299.1|4610050_4610368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985261.1|4610633_4611647_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_000020919.1|4611762_4612062_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|4612183_4612459_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000217677.1|4612636_4613137_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000557697.1|4613200_4613425_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	95.9	1.5e-31
4613329:4613341	attR	AAAGGCGGAGTTA	NA	NA	NA	NA
WP_001277898.1|4613424_4613724_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113266.1|4613726_4613951_+	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	1.5e-34
