The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	326305	336633	5233637	integrase,transposase	Enterobacteria_phage(22.22%)	10	319897:319910	333960:333973
319897:319910	attL	AACAAATTGCCGCC	NA	NA	NA	NA
WP_112033803.1|326305_327361_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	7.0e-119
WP_001285288.1|327648_328752_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893251.1|328763_330017_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
WP_000772642.1|330372_331587_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.5e-133
WP_000251023.1|331729_332611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083330.1|332808_333006_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	48.1	1.7e-07
WP_001035842.1|333005_333437_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	5.1e-28
WP_112033804.1|333449_333845_+	hypothetical protein	NA	A0A139ZPI9	Marinitoga_camini_virus	36.6	2.1e-07
WP_085948178.1|333870_335083_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
333960:333973	attR	GGCGGCAATTTGTT	NA	NA	NA	NA
WP_000942525.1|335562_336633_+	DNA cytosine methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
>prophage 2
NZ_CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	550431	630323	5233637	tRNA,capsid,head,protease,tail,transposase	Escherichia_phage(33.33%)	69	NA	NA
WP_000186631.1|550431_550911_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_000365177.1|551114_551909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001342071.1|552046_552388_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	2.1e-40
WP_000078269.1|552501_555006_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
WP_000883048.1|555267_556200_+	glutaminase A	NA	NA	NA	NA	NA
WP_000982172.1|556202_557495_+	amino acid permease	NA	NA	NA	NA	NA
WP_001026747.1|557619_558027_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000970323.1|558027_558486_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000904502.1|558482_559400_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_001157532.1|559545_560223_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	3.1e-27
WP_001345010.1|560209_560992_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001295322.1|561054_561909_-	chaperedoxin	NA	NA	NA	NA	NA
WP_000148941.1|561969_562779_-	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295836.1|562768_563392_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|563362_564049_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561841.1|564045_566460_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001320180.1|571081_571342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001158001.1|572573_573668_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|573736_574663_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|574892_575375_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|575452_576268_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001342079.1|576357_578139_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
WP_000943558.1|578151_578928_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|579027_579906_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|580074_581529_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006887.1|581588_582950_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001298987.1|583006_584308_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001315307.1|584329_585475_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
WP_000540946.1|585603_586389_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001301144.1|586399_587635_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703909.1|587656_588706_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580836.1|589022_590690_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495365.1|590699_591959_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152513.1|591969_592785_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855355.1|592781_593675_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815554.1|593811_594879_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|594875_595385_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|595502_596225_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|596227_596722_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912342.1|596895_598281_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_001143540.1|598316_598838_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|598945_599158_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|599159_600026_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|600506_601049_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988363.1|601268_601961_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001345007.1|601991_604601_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001255226.1|605652_606168_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|606170_606803_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001345004.1|608013_608346_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063245.1|608401_609427_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
WP_000158868.1|609468_609864_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752958.1|609875_610175_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.9	8.4e-46
WP_085947772.1|610195_611408_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000985132.1|611501_612080_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683103.1|612076_612472_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	1.4e-69
WP_001342267.1|612479_613220_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|613235_613658_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|613639_614074_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840226.1|614066_616247_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
WP_085948178.1|616252_617465_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000239881.1|617535_618204_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|618260_618566_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226384.1|618749_620234_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201824.1|620420_621374_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177454.1|621886_622648_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001224569.1|622830_623721_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001345000.1|623721_626694_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383942.1|626680_628918_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420935.1|629186_630323_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	849748	869073	5233637	holin,tail,integrase,transposase	Enterobacteria_phage(52.17%)	28	849661:849675	870400:870414
849661:849675	attL	GCTTTTTTATACTAA	NA	NA	NA	NA
WP_000263438.1|849748_850825_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	1.8e-199
WP_000638251.1|850838_851249_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.2	1.1e-64
WP_000145948.1|852534_852825_+	hypothetical protein	NA	K7PH23	Enterobacteria_phage	100.0	2.5e-50
WP_000818841.1|852897_853104_+	hypothetical protein	NA	G8C7M4	Escherichia_phage	98.5	7.9e-27
WP_000344554.1|853121_853484_+	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	67.9	4.4e-33
WP_000814614.1|853455_853866_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	98.5	2.1e-71
WP_001254255.1|853862_854039_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000386661.1|854041_854401_+	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
WP_000950962.1|854400_854577_+	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_001286917.1|854569_854782_+	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_000002251.1|854774_855065_+	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	97.9	7.1e-50
WP_001008192.1|855061_855424_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	98.3	3.5e-62
WP_000994516.1|855420_855609_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000750155.1|855820_856780_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032178163.1|857119_857242_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|857256_857946_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|858130_858874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|858959_859118_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000023272.1|859416_861267_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000411800.1|861714_861921_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_112033810.1|861920_862109_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	1.9e-19
WP_085948178.1|862111_863325_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001191368.1|863378_863582_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	97.0	1.4e-28
WP_000950982.1|863687_864569_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001369236.1|864792_865623_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	97.8	7.6e-153
WP_021351651.1|865746_866118_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_001002868.1|867336_867717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|867860_869073_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
870400:870414	attR	GCTTTTTTATACTAA	NA	NA	NA	NA
>prophage 4
NZ_CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	1079727	1122286	5233637	protease,holin,transposase	Escherichia_phage(38.46%)	54	NA	NA
WP_000156528.1|1079727_1081488_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1081673_1082126_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1082201_1083242_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1083598_1084108_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001444487.1|1084380_1084956_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1084918_1087081_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1087090_1087537_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001297106.1|1087659_1089714_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
WP_000424181.1|1089745_1090204_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1090299_1090962_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1091134_1091548_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1091592_1091910_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116302.1|1091967_1093158_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048244.1|1093252_1093531_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1093527_1093857_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375138.1|1093947_1094607_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
WP_000273151.1|1096007_1096250_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_085948178.1|1097412_1098626_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000048507.1|1098677_1100102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001090200.1|1100194_1100386_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1100382_1100571_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000394557.1|1101102_1101477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379580.1|1101488_1101641_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000103686.1|1101913_1102630_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000471549.1|1102679_1102895_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693949.1|1102891_1103317_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262389.1|1103388_1104459_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_001151153.1|1104499_1104922_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_001266135.1|1104918_1105215_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	7.5e-47
WP_001209481.1|1105211_1105673_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|1105650_1106007_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|1106057_1106270_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000224233.1|1106521_1106785_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|1106795_1107665_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|1107780_1107885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902696.1|1108073_1108286_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_032280206.1|1108453_1108714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265133.1|1108733_1109783_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001217436.1|1109795_1110167_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|1110156_1110528_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|1110679_1111498_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|1111784_1111982_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000261909.1|1112119_1112833_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874357.1|1113600_1115451_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000411814.1|1115898_1116105_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000138558.1|1116360_1116633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|1116792_1117326_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675929.1|1117546_1117660_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	97.3	5.6e-11
WP_012816791.1|1117881_1118067_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1118593_1118908_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|1118989_1119214_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_085948178.1|1119263_1120477_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_012817858.1|1120563_1121457_-	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_001443410.1|1121902_1122286_-	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
>prophage 5
NZ_CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	1177822	1245071	5233637	protease,integrase,transposase	Escherichia_phage(23.53%)	58	1170059:1170073	1201285:1201299
1170059:1170073	attL	TTCTGGCGGCGGTAA	NA	NA	NA	NA
WP_000279869.1|1177822_1179025_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_000282209.1|1179211_1181029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303889.1|1182140_1182437_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|1182663_1182861_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335710.1|1183079_1184513_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282084.1|1185333_1185897_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000233452.1|1186051_1188412_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000998045.1|1189168_1190707_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.7e-299
WP_085948178.1|1190918_1192131_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000024297.1|1192988_1193348_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591991.1|1193440_1195060_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000134927.1|1195284_1195560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042352357.1|1195940_1196639_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000424145.1|1196729_1197032_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_000612150.1|1197040_1197361_+	urease subunit beta	NA	NA	NA	NA	NA
WP_000065682.1|1197353_1199057_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_112033812.1|1199066_1199531_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_001142973.1|1199531_1200206_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_001021388.1|1200217_1200835_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_000803992.1|1202046_1202310_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
1201285:1201299	attR	TTCTGGCGGCGGTAA	NA	NA	NA	NA
WP_001135715.1|1202611_1202752_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000435663.1|1206633_1207059_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000624701.1|1207055_1207406_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000088522.1|1207436_1209050_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000957251.1|1209992_1210334_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000042916.1|1210320_1210650_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_001176766.1|1210910_1211378_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506898.1|1211395_1212604_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797372.1|1212614_1213571_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182418.1|1213570_1214650_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_001040060.1|1214651_1215425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|1215417_1216560_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001035166.1|1216569_1217628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254140.1|1217949_1218531_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001054789.1|1218530_1219688_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|1219710_1220166_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|1220188_1221229_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|1221277_1221856_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301248.1|1221924_1222500_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_001053349.1|1222923_1223310_+	protein TerF	NA	NA	NA	NA	NA
WP_001223350.1|1223823_1225914_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_000477623.1|1227366_1227585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|1228218_1228554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|1229334_1229529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001377350.1|1229580_1229754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303898.1|1229842_1230115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001340489.1|1230398_1230614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958487.1|1230679_1230877_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001231525.1|1231606_1232731_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_001301456.1|1234084_1234543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|1235000_1235510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260386.1|1235598_1236222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124179.1|1236317_1236551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287881.1|1236603_1236795_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001345400.1|1237469_1238516_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_001304205.1|1239269_1241438_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000502842.1|1243155_1243794_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.9e-55
WP_085948274.1|1243857_1245071_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	1.4e-168
>prophage 6
NZ_CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	1345862	1410547	5233637	transposase,tRNA,capsid,holin,head,integrase,tail,terminase	Stx2-converting_phage(40.82%)	69	1340956:1340970	1347437:1347451
1340956:1340970	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074981.1|1345862_1346981_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	2.9e-83
WP_000003742.1|1346949_1347219_-	excisionase	NA	NA	NA	NA	NA
WP_000048442.1|1347280_1349746_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	8.8e-56
1347437:1347451	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_001090200.1|1349838_1350030_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1350026_1350215_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_122993436.1|1350554_1350695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|1350698_1350917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001447517.1|1350957_1351347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|1351642_1351921_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|1351922_1352114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169687.1|1352134_1352506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444689.1|1352603_1352906_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	1.5e-05
WP_000693943.1|1352902_1353328_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|1353350_1354313_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_085948178.1|1354807_1356021_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_072058819.1|1356058_1356199_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.0	2.2e-12
WP_012817871.1|1356366_1356639_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
WP_001369253.1|1356640_1357696_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.4e-87
WP_000140024.1|1357696_1358062_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_000640048.1|1358070_1358601_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|1358842_1359040_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935544.1|1359190_1360249_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.0	2.0e-198
WP_000874287.1|1361045_1362896_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_000411802.1|1363343_1363550_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000731236.1|1363554_1363899_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992167.1|1363949_1364483_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_001056806.1|1364753_1365323_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1365322_1365469_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1365696_1365882_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1366306_1366534_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279788.1|1366575_1366941_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
WP_000958415.1|1367231_1367795_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
WP_001369319.1|1367791_1369453_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
WP_000172984.1|1369516_1371454_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|1371498_1371720_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125988.1|1374408_1374735_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|1374744_1375095_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1375091_1375538_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1375534_1375879_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275472.1|1375945_1376662_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_001030042.1|1376667_1377042_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	6.6e-64
WP_001453698.1|1377137_1377347_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212932.1|1377398_1380641_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	98.5	0.0e+00
WP_000807928.1|1380633_1380975_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	95.6	5.3e-60
WP_001447444.1|1380974_1381673_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	4.4e-130
WP_001302649.1|1381689_1382010_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1382117_1382291_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_000967279.1|1383338_1384076_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	1.9e-147
WP_122996286.1|1384021_1384654_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_000514853.1|1384890_1388370_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	97.4	0.0e+00
WP_001230459.1|1388436_1389036_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_000268887.1|1389100_1390423_+|tail	tail fiber protein	tail	Q687E6	Enterobacteria_phage	99.1	2.4e-76
WP_001023356.1|1390424_1390694_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_115801847.1|1390800_1390890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1390909_1393258_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001369471.1|1393848_1397250_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.0e-219
WP_000145590.1|1397418_1397997_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001301834.1|1398019_1398145_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|1398224_1398500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938117.1|1398560_1399922_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	28.9	4.0e-50
WP_000799400.1|1400285_1401149_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|1401132_1402269_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359442.1|1402518_1403748_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1403893_1405015_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|1405090_1406551_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1406550_1407222_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1407389_1408760_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|1408763_1409405_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1409440_1410547_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	1511763	1584785	5233637	transposase,portal,holin,protease,tail,terminase	Enterobacteria_phage(43.14%)	78	NA	NA
WP_000268365.1|1511763_1512312_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	36.1	2.7e-21
WP_085948178.1|1514158_1515371_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000075578.1|1515435_1515972_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	71.9	4.1e-59
WP_072127369.1|1516004_1516286_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.8	1.6e-30
WP_001444682.1|1516282_1516579_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	4.4e-47
WP_001209477.1|1516575_1517037_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	95.2	6.9e-39
WP_000403788.1|1517014_1517371_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	6.7e-58
WP_000137950.1|1517466_1517838_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.9	2.7e-49
WP_000610381.1|1517834_1518188_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	65.0	5.5e-36
WP_000220602.1|1518393_1518693_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	96.0	1.6e-49
WP_001260976.1|1518698_1518956_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	88.0	6.6e-31
WP_001447497.1|1519091_1519370_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.9e-10
WP_001344904.1|1519371_1520421_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.0e-109
WP_000904137.1|1520433_1520808_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762902.1|1520804_1521626_+	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000917735.1|1521852_1522050_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483498.1|1522200_1523259_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.0	1.7e-205
WP_000142980.1|1523853_1525800_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	99.1	0.0e+00
WP_000143458.1|1525937_1526117_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290214.1|1526157_1526403_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
WP_001072901.1|1526480_1526696_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001344902.1|1526699_1526945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|1526970_1528183_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000992150.1|1528606_1529140_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
WP_012578895.1|1529658_1529844_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000373407.1|1530319_1530796_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077625.1|1530792_1532916_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102413.1|1532912_1533125_+	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
WP_000974564.1|1533124_1534627_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1534571_1536596_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1536683_1537010_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1537002_1537284_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1537286_1537910_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1537922_1538321_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1538328_1539081_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1539094_1539517_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|1539543_1539852_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918237.1|1539895_1542541_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.4	0.0e+00
WP_000847298.1|1542537_1542867_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001344666.1|1543574_1544318_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_122996286.1|1544263_1544896_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_106895295.1|1545132_1548609_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.6	0.0e+00
WP_001230455.1|1548676_1549276_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_112033816.1|1549340_1550654_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
WP_001023476.1|1550655_1550925_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_000692020.1|1552060_1552651_+	protein kinase	NA	NA	NA	NA	NA
WP_001079509.1|1553687_1554194_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|1554239_1554740_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1554825_1555005_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|1555385_1556192_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|1556191_1557385_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_112033859.1|1557396_1558755_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763511.1|1558758_1560354_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194584.1|1560353_1561916_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1562007_1562052_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1562189_1563071_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1563067_1563688_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|1563788_1564661_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|1564700_1565291_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559281.1|1565287_1566046_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_000422045.1|1566265_1567315_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|1567350_1567602_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|1567981_1570579_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_000776253.1|1570788_1571763_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_000908596.1|1572057_1572222_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_001297116.1|1572224_1572392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310756.1|1572505_1572601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000099519.1|1572764_1575440_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_001176295.1|1575503_1576094_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
WP_001256539.1|1576263_1577028_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_000876286.1|1577176_1577485_+	lipopolysaccharide assembly protein LapA	NA	NA	NA	NA	NA
WP_000891353.1|1577491_1578661_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_000176278.1|1578852_1579590_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_001295580.1|1579589_1579916_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_000498253.1|1580041_1580260_-	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_001088625.1|1580528_1581278_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001288368.1|1581367_1581541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|1583571_1584785_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 8
NZ_CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	1645169	1740929	5233637	transposase,tRNA,capsid,holin,head,integrase,tail,terminase	Escherichia_phage(42.53%)	114	1703878:1703937	1734622:1735933
WP_000628065.1|1645169_1646402_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1646656_1647640_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001296046.1|1647914_1648088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123745.1|1648117_1649491_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|1649619_1650555_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|1650606_1651842_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|1651843_1652059_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|1652158_1652347_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|1652384_1652534_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|1652589_1653399_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105140.1|1653391_1655992_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_001344816.1|1656093_1656369_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|1656443_1656614_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|1656613_1656835_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|1657276_1657765_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1657761_1657917_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|1657927_1658107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|1658349_1658769_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|1658848_1659103_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|1659099_1659522_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001304174.1|1659599_1660388_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788980.1|1660394_1661141_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_000450712.1|1661163_1661925_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_001141110.1|1661940_1662363_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000935420.1|1662468_1662681_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000224233.1|1662932_1663196_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000208018.1|1663206_1663368_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000365100.1|1663446_1663692_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_001100703.1|1664123_1665275_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000016656.1|1665242_1666232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138556.1|1666231_1667623_-	ATPase	NA	NA	NA	NA	NA
WP_000940319.1|1668122_1668722_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247761.1|1668721_1669012_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000640158.1|1669008_1669563_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000466957.1|1670124_1670556_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000143077.1|1671126_1672980_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000284522.1|1673129_1673345_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|1673349_1673694_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992086.1|1673744_1674278_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_001344811.1|1674551_1675091_+	ant domain protein	NA	Q5MBW0	Stx1-converting_phage	99.4	3.0e-86
WP_085948178.1|1675093_1676307_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000285960.1|1676383_1676560_+	phage antirepressor	NA	Q5MBW0	Stx1-converting_phage	98.3	3.3e-26
WP_001280923.1|1676654_1676786_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_012817877.1|1677008_1677194_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_000828070.1|1677594_1677921_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|1678052_1678253_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829192.1|1678294_1678660_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958380.1|1678948_1679512_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001411753.1|1679508_1681170_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000173011.1|1681233_1683171_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001063025.1|1683215_1683437_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|1685801_1686128_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007911.1|1686137_1686488_+|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000573391.1|1686484_1686931_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|1686927_1687272_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275480.1|1687340_1688057_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.9	1.4e-126
WP_001030060.1|1688062_1688437_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001453698.1|1688532_1688742_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212770.1|1688793_1692036_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	99.0	0.0e+00
WP_000807964.1|1692028_1692370_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152159.1|1692369_1693068_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000194763.1|1693078_1693822_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_064732755.1|1693767_1694400_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000649829.1|1694590_1695118_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_112033817.1|1695251_1698725_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_001228290.1|1698792_1699392_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
WP_000216548.1|1699543_1700848_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	95.4	1.2e-72
WP_001023476.1|1700849_1701119_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_106409364.1|1702233_1702356_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|1702462_1703374_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
1703878:1703937	attL	CTGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCAT	NA	NA	NA	NA
WP_085948178.1|1703920_1705134_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303943.1|1706160_1706439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1706866_1707013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|1707149_1707797_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144879.1|1707980_1708571_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001261191.1|1711076_1711430_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000171274.1|1711520_1712240_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_112033818.1|1712279_1712678_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808667.1|1712782_1713322_-	septation protein A	NA	NA	NA	NA	NA
WP_000028550.1|1713351_1714095_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000737224.1|1714451_1715090_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000113674.1|1715135_1716266_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1716243_1716492_-	excisionase	NA	NA	NA	NA	NA
WP_112033819.1|1716556_1719028_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	5.5e-58
WP_000199480.1|1719123_1719312_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|1719308_1719497_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001342117.1|1719896_1720064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|1720057_1720291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1720268_1720676_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171894.1|1720698_1720917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1720989_1721289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1721553_1721961_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000705622.1|1722247_1722799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|1722770_1723811_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|1723722_1724265_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000450683.1|1724298_1725033_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.3	2.9e-108
WP_001505071.1|1725029_1725194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1725892_1726651_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|1726929_1727142_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|1727362_1727620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032178572.1|1727689_1727968_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.8e-11
WP_001265289.1|1727969_1729025_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_000140002.1|1729025_1729391_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|1729387_1730077_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000023139.1|1731603_1733373_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.8	0.0e+00
WP_085948178.1|1733424_1734637_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_064764776.1|1734603_1734726_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	86.1	4.3e-09
WP_001023452.1|1734727_1734997_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|1735137_1736013_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
1734622:1735933	attR	ATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCAGGGGCTGAATGAAGTGGGCAGTGATACAGGCAGAACAGGAGAATGACATGAATATACTAAAAAAACTTATGCAGCGTCTGTGTGGTTGCGGAAAGCATGATGGCCGTGAACACGTGCAGTCGCTTACAGCACAACTGCGACTGGGGCCGGCAGACATCCTGGAGTCCGATGAGAATGGTATTATTCCGGAGCAGGACAGGGTAATCACGCAGGTGGTGATACTGGATGCGGATAAAAAGCAGATACAGTGCGTGGTAAGACCGCTGCAAATTCTGCGTGCTGACGGGAGGTGGGAAAATATTGGCGGAATGAAATAGCCGACAGCTTCACAAAAACCGGAGTCCGGCTCCGGTTTTTGTTGTCATGTCCGGTGGATGTTTGTTAGGAATGTTCAGACAGGTTTATTTTGAATTTACACAGAATCCTAAACAGGTTCGAAAATTAAGAAAGAGGTTGTATGTTTAGCATAAGAACCCTACTACCTATTAGCGCCAGCGTATCAGTTCCGACAAAACAATCTCAATCCATCCCAATAACTTTAGCAGGGAGAACAATCGAAAAAGCGCAAGAGAAAGAAGGATTACTTGTTTTTTTAGGAATGAAATCCGTTAATGACTATACTCTTAATATTCTTGGCCAAAATGTTTCAAGAGTCACAACGGGGAAAAAACCGTATGATTTATTATTCCTGAATGATGCTACAAAACAAGATTTTGATAAAAGGAAAATGGAGTTTACATATCCTGGAGCAAATAAAAGCCATCTACAATCAAGTAATAGCGATGTTGTTGCTGCTGCAGCTATAAGTATTACAGCGACAGAGATGAAAACCATCCTGCCAGATGATTTAACACTAGGAAAATACAACAAAATTTATCTGTCTGGGCATGGTTCTGCTGGTCTACCTCTTCTTAAGTGCGGAGATGAATTTTTATCACCGTCAGATATTGTCGACCGCATTGTTCAGCATAATCTTCATGAAATAGATGATATCAGATTAACATCCTGTAACTCAGCCAACATAATAAAAAACAAAGACTTCTCTCCTGATGAAATAGAAAAATCCGCAAATATGAATAACGGCTGGTTGGCCAGGGCATTATTTGGTCAAAAGAGGTCTTTAGCAGAACACGTCTATGCCGAGTTTGAACGTCGCGGAATTAACGTTTCTATATCAGGTTACCATGGCACTGGCGTTTTTTATGTACCAGAGCATGGTAAACCAACAACGCATCTACGCTCCACAACTGTGC	NA	NA	NA	NA
WP_001121225.1|1736237_1736888_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_096245710.1|1737483_1737798_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	81.9	1.3e-25
WP_000347482.1|1737857_1739141_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527750.1|1739229_1740690_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
WP_000214712.1|1740725_1740929_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 9
NZ_CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	1880151	2004089	5233637	terminase,capsid,portal,holin,head,integrase,protease,tail,lysis,transposase	Stx2-converting_phage(39.62%)	119	1961658:1961674	1999319:1999335
WP_000826406.1|1880151_1881360_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	9.2e-208
WP_001261013.1|1881886_1882555_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586732.1|1882857_1883451_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001341359.1|1883447_1884440_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001315480.1|1884631_1885543_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_000140877.1|1885537_1886074_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|1886136_1886361_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375956.1|1886500_1888156_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013783.1|1888380_1889724_-	VOC family protein	NA	NA	NA	NA	NA
WP_001345051.1|1889940_1890864_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098530.1|1890901_1892542_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|1892940_1893090_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|1893161_1893335_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|1893579_1894110_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000048667.1|1894298_1895300_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001027942.1|1896840_1897641_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139621.1|1897912_1901815_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048948.1|1902015_1902621_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627379.1|1902671_1903988_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000431813.1|1903977_1905735_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000890909.1|1905750_1906647_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000177525.1|1906646_1907252_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000477179.1|1907422_1909729_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000097801.1|1909792_1910653_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123455.1|1910883_1911474_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000041176.1|1911455_1912406_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632286.1|1912506_1913820_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206190.1|1913846_1915052_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|1915051_1915474_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973362.1|1915463_1916891_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969777.1|1916892_1917681_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|1917680_1918448_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206377.1|1918444_1919515_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189197.1|1919522_1920020_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072831.1|1920034_1920781_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|1920789_1921077_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191073.1|1921088_1922018_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186481.1|1922302_1924348_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535449.1|1924595_1926869_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001067510.1|1928648_1929554_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001345059.1|1929725_1930055_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698141.1|1930059_1930245_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900925.1|1930241_1932881_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|1933088_1934078_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001295716.1|1934188_1934611_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|1934607_1934874_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628171.1|1935147_1938672_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837930.1|1939038_1940172_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.3	1.2e-116
WP_001295593.1|1940312_1940747_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|1941327_1941969_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|1942050_1942680_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|1942752_1943328_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|1943440_1943710_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_000268965.1|1943711_1945025_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	7.9e-80
WP_001230550.1|1945089_1945689_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_112033822.1|1945759_1949257_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.8	0.0e+00
WP_096860308.1|1949599_1950232_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.1	2.3e-101
WP_001369422.1|1950177_1950921_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	1.1e-147
WP_001369426.1|1950926_1951625_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	7.6e-130
WP_000807940.1|1951624_1951966_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001369428.1|1951958_1953401_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	5.1e-229
WP_000091308.1|1953419_1953785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|1953784_1954972_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001453698.1|1957080_1957290_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030041.1|1957385_1957760_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	5.0e-64
WP_112033823.1|1957765_1958482_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	96.6	1.2e-125
WP_000133393.1|1958548_1958893_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|1958889_1959336_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|1959332_1959683_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|1959692_1960019_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_012817878.1|1960021_1962601_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.8	0.0e+00
1961658:1961674	attL	TGCTGCTCCAGCGCCTC	NA	NA	NA	NA
WP_001063099.1|1962546_1962768_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173011.1|1962812_1964750_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001369319.1|1964813_1966475_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
WP_000958415.1|1966471_1967035_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
WP_000279803.1|1967324_1967690_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	96.7	2.9e-64
WP_000095736.1|1967731_1967959_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000736096.1|1968327_1968552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|1968637_1968823_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000992122.1|1969340_1969874_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000731236.1|1969924_1970269_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411811.1|1970273_1970480_-|holin	holin	holin	O48430	Enterobacteria_phage	100.0	1.8e-31
WP_000143036.1|1970925_1972776_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_001344632.1|1973223_1973355_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_085948178.1|1973614_1974827_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000705364.1|1975511_1976033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|1976016_1976244_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|1976321_1976729_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379591.1|1976921_1977074_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001344637.1|1977085_1977451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328010.1|1977419_1977707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1978122_1978311_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|1978307_1978499_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_112033824.1|1978592_1979036_+	exonuclease VIII	NA	NA	NA	NA	NA
WP_085948178.1|1979075_1980289_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_112033825.1|1980352_1982377_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	2.7e-58
WP_001296941.1|1982464_1982701_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876990.1|1982735_1984016_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	1.9e-155
WP_001360138.1|1984035_1984146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836079.1|1984203_1985223_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|1985234_1986449_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1986654_1986981_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1987115_1987457_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1987491_1988052_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1988054_1988765_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|1988872_1989178_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041554.1|1989376_1991803_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
WP_001342196.1|1991863_1994287_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000213028.1|1994297_1994915_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|1994916_1995771_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1995813_1996428_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071526378.1|1996586_1997879_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919226.1|1997831_1998527_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225276.1|1998651_1999872_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
1999319:1999335	attR	TGCTGCTCCAGCGCCTC	NA	NA	NA	NA
WP_001019545.1|2000006_2000900_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|2001006_2002260_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743951.1|2002656_2002992_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233090.1|2003084_2003168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260840.1|2003267_2004089_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 10
NZ_CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	2127570	2165654	5233637	transposase,plate,tRNA,capsid,portal,holin,head,tail,terminase	Enterobacteria_phage(86.11%)	45	NA	NA
WP_100206497.1|2127570_2127849_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.4	6.2e-27
WP_000159459.1|2127859_2128138_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	78.3	1.5e-33
WP_000514277.1|2128149_2128392_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000165075.1|2128456_2129338_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	92.6	1.9e-114
WP_000686506.1|2130910_2131870_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	7.1e-179
WP_000211267.1|2131874_2132186_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_001390707.1|2132550_2132820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000236489.1|2133382_2133907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087824.1|2133921_2134968_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.1	1.9e-201
WP_000613748.1|2134967_2136719_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.3	0.0e+00
WP_001262673.1|2136873_2137710_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055104.1|2137733_2138786_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_000632344.1|2138831_2139632_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_000063082.1|2139734_2140229_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000864901.1|2140228_2140429_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|2140431_2140755_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|2140751_2141144_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780569.1|2141140_2141548_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	4.5e-66
WP_000920593.1|2141685_2142153_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
WP_000356341.1|2142145_2142781_+|tail	tail protein	tail	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_001271894.1|2142777_2143359_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.0e-100
WP_000213447.1|2143355_2143706_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111942.1|2143709_2144606_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
WP_000071739.1|2144598_2145129_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_000108519.1|2145131_2147264_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.7	4.2e-131
WP_000144026.1|2147263_2147842_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	1.7e-95
WP_000954196.1|2147885_2148458_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979957.1|2148614_2149103_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	3.0e-85
WP_112033826.1|2149115_2151923_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.8	0.0e+00
WP_000333503.1|2151909_2152065_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651581.1|2152073_2152448_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	6.9e-37
WP_000290445.1|2152503_2153016_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.2	7.8e-92
WP_000005431.1|2153015_2154200_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
WP_000132811.1|2154357_2155467_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	9.6e-204
WP_001035742.1|2155692_2157195_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000488103.1|2157438_2157699_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078923.1|2157889_2158030_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
WP_001229265.1|2158336_2158636_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672378.1|2158640_2161028_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018594.1|2161042_2162026_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|2162309_2162354_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2162476_2162833_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2162885_2163083_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2163179_2163722_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|2163725_2165654_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 11
NZ_CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	2385277	2476306	5233637	terminase,capsid,portal,holin,head,integrase,tail,transposase	Enterobacteria_phage(33.33%)	106	2385236:2385295	2481898:2483211
2385236:2385295	attL	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
WP_085948178.1|2385277_2386491_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_146868618.1|2386496_2387621_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	91.4	9.8e-188
WP_000879833.1|2389012_2389810_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000734033.1|2389819_2390371_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|2390539_2390872_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|2391205_2391520_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994449.1|2391733_2393392_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2393384_2394380_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282694.1|2394372_2395059_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213292.1|2395058_2396432_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|2396450_2396894_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620092.1|2396890_2398018_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133124.1|2398122_2398587_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|2398591_2399596_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|2399592_2400006_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001302429.1|2400008_2400374_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253450.1|2400373_2401111_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|2401120_2401390_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000942326.1|2401397_2402183_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103994.1|2402472_2403096_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|2403139_2403382_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2403490_2403718_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000949111.1|2404015_2404831_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001377491.1|2404827_2406522_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009309.1|2406692_2406875_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|2406953_2407871_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001210913.1|2408043_2408964_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|2408952_2409423_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157238.1|2409403_2410822_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000365565.1|2410888_2411584_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_001313057.1|2411623_2411989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824375.1|2412555_2413719_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	7.2e-109
WP_000218214.1|2414309_2415161_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826738.1|2415268_2416627_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001339045.1|2416626_2417298_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920136.1|2417430_2417844_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000730130.1|2417952_2418957_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240109.1|2418957_2419593_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007759.1|2419849_2420500_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079074.1|2420842_2421373_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_122993429.1|2422607_2423621_-	peptidase M85	NA	NA	NA	NA	NA
WP_001023476.1|2424026_2424296_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_000279057.1|2424297_2425611_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
WP_001230455.1|2425675_2426275_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000514851.1|2426342_2429819_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_122996286.1|2430065_2430698_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_001369128.1|2430643_2431387_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
WP_001152113.1|2431392_2432091_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
WP_000847298.1|2432090_2432420_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081781.1|2432416_2435029_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
WP_000533440.1|2435009_2435423_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|2435449_2435872_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235098.1|2435885_2436638_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000683079.1|2436645_2437041_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_001204554.1|2437586_2437940_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201501.1|2437932_2438316_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522591.1|2438367_2439396_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256823.1|2439453_2439801_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253979.1|2439837_2441343_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_001369121.1|2441332_2442925_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_000259002.1|2442921_2443128_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001426431.1|2443111_2445040_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.6e-262
WP_001426432.1|2445011_2445518_-	DNA-packaging protein	NA	O64316	Escherichia_phage	47.3	7.4e-34
WP_001444498.1|2445944_2446169_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.3e-19
WP_001302717.1|2446250_2446565_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012817896.1|2447090_2447276_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	83.6	4.0e-22
WP_001092858.1|2447793_2448327_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
WP_000638258.1|2448369_2448774_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	83.5	8.2e-52
WP_085948178.1|2448757_2449971_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000284516.1|2450202_2450418_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_001290231.1|2450494_2450767_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2450807_2450987_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_024222300.1|2451124_2453062_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.4	0.0e+00
WP_000466957.1|2453540_2453972_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000422741.1|2454059_2454485_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_112033831.1|2454481_2454832_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	3.1e-39
WP_000080194.1|2454862_2456476_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	64.0	4.4e-181
WP_000301789.1|2456961_2457675_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917764.1|2457809_2458007_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
WP_000640033.1|2458230_2458785_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	8.0e-66
WP_001217447.1|2458793_2459153_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_001265229.1|2459165_2460215_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2460216_2460489_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2460610_2460955_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2461074_2461287_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2461520_2462078_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2462079_2462298_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000034815.1|2462425_2462737_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000699809.1|2462729_2462957_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2462953_2463235_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450617.1|2463267_2463984_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_000788760.1|2464005_2464752_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_001262366.1|2464758_2465829_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000693883.1|2465900_2466326_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391948.1|2466309_2466591_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362152.1|2466690_2467110_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_001345283.1|2467375_2467528_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000394546.1|2467539_2468178_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2468178_2468388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2468958_2469147_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2469143_2469335_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_112033832.1|2469427_2470423_+	exonuclease	NA	NA	NA	NA	NA
WP_000091308.1|2470457_2470823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|2470822_2472010_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001300307.1|2473878_2474676_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001345280.1|2475031_2476306_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.9	1.4e-76
2481898:2483211	attR	GATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCAGACATTATTATAACAATCCACTAATACCCTGGCTTTATCTTCCCCTTTTGGTCCATGAACGATCACTATTGGTATATCTGTTTCACTTTGAATTTTTGCTATTAGATTTTCTGCAATCGATAATGAAAATGTACGTTCCTGCGAGCTACCTTCTAAATTAAGCGCAATGTAAGATCCTAACGATCGCATTTCCTCGCGCACCTCATCGAGTACATCCTCACTTAGTGGCAATTCATATATTGGCCTGACTGCTGGAAAACCCGCCTCACGCATCATAAATGCCCATGTCATGGGTACGGGAGCCCGGAGATTCTGATCCATCCGGGACGCGTTCTTGCACAAAGGGGAGTAGCACTTCATGGTTAAATCAACAACCTGAAAATTCGTTTTTGCTTTCAACTGACTGATAAATATCATCGTTTTCAGGTTCTTTTTACGCATCGCCTCTATACAAAGATCCGGCGTACCGTATTGCTGTGTTATGTTCTTTGCTAAATCTTTTATTTCTTTTAATGTTGCGTGATCCTGCATAGTCATTGTGACTAATGTTAATTTAGTCTTTTCAAGTTTAAGTGCATTAAACACTTCTAAATTAATTGTCGACGTAACAATTAAAAGATGCTTAATTTTATGCAATTCAAGCGCCCGAATAACAGGAAAGATGGCCATAGCATCGCCAATCTGGTCGGGAATATGGATGACAACAAAGTCTGTTTTTTCAATATTGAAATTATAAGCTTTATAATCGTAGTAACTAAATGCAATACGTCTCAACAATGATGCTAAAAACATACCTAACCTCGCCTCCCTACTGGTTATAATACAATGCAGTCTATCAGACTCATCAGGGTGCCATTTTGTGCATATGCGGACTTTTATGTTTCATATCTCTAACCTGTGGGTCCTCTGCTTAATCCTTAAACAACACCAGCAACTCCTGCGCTTTCATCTTCCATCGAATTTTTCATGTTGCCGCTAATCAGCCATAAAAACATTTGCAGATGCGCTCTGTCGAGGTAGTCTCATAAGGTTCGTTTATAGATCGACGGCAATGTGAGTTACCTTTTCCATACTAATTATAAAAAGACAGTACAAACAGGATCATTATGGACTCCACGCTCATCTCCACTCGTCCCGATGAAGGGACGCTTTCGTTAAGTCGCGCCCGACGAGCTGCGTTAGGCAGCTTCGCTGGTGCCGTCGTCGACTGGTATGATTTTTTACTCTATGGCATCACCGCCGCACTGGTGTTTA	NA	NA	NA	NA
>prophage 12
NZ_CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	2701366	2770264	5233637	terminase,capsid,holin,integrase,protease,lysis,transposase	Enterobacteria_phage(20.0%)	64	2739306:2739341	2771204:2771239
WP_000101907.1|2701366_2702608_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.6e-98
WP_000387403.1|2703104_2703311_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001345228.1|2703265_2705074_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	41.1	2.9e-08
WP_023981888.1|2705289_2705529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|2705501_2705735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205000.1|2705727_2705961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|2705966_2706266_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833625.1|2706262_2707663_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
WP_001080641.1|2707864_2708110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391151.1|2708240_2708435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018604.1|2708438_2708600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229488.1|2708727_2709216_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	41.7	3.9e-24
WP_001369202.1|2709378_2710302_+|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.9	1.2e-13
WP_001113637.1|2713676_2714324_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001211568.1|2714358_2715411_-	cytochrome c-type biogenesis thiol:disulfide oxidoreductase CcmH	NA	NA	NA	NA	NA
WP_000824439.1|2715407_2715965_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_000982426.1|2715961_2717905_-	cytochrome c-type biogenesis heme lyase CcmF	NA	NA	NA	NA	NA
WP_001026418.1|2717901_2718381_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000186540.1|2718377_2718587_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001295447.1|2718583_2719321_-	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000971722.1|2719362_2720025_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000888560.1|2720021_2720639_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000528376.1|2720657_2721260_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000835176.1|2721269_2721719_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000013506.1|2721715_2722579_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091291.1|2722565_2723261_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000778069.1|2723267_2725754_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000557378.1|2725750_2726014_-	chaperone NapD	NA	NA	NA	NA	NA
WP_000686723.1|2726003_2726498_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000849214.1|2726906_2727395_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000758043.1|2727543_2729190_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000422230.1|2729407_2731051_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|2731126_2731777_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786386.1|2731776_2732841_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|2732914_2733970_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|2734081_2735173_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_001249151.1|2735911_2738584_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061917.1|2738600_2739251_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
2739306:2739341	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACG	NA	NA	NA	NA
WP_000876014.1|2739450_2742300_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001225855.1|2742574_2743351_-	YfaP family protein	NA	NA	NA	NA	NA
WP_001104541.1|2743355_2745005_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_162630518.1|2745005_2749400_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001025665.1|2750201_2751524_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.5	9.7e-227
WP_072145680.1|2752217_2752856_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.0	2.4e-34
WP_085948178.1|2752893_2754106_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000881316.1|2754146_2754671_-	hypothetical protein	NA	A0A0N7CEE8	Salmonella_phage	89.7	1.2e-84
WP_000092247.1|2754820_2755258_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.9	5.0e-71
WP_000075144.1|2755254_2755752_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
WP_000284524.1|2755751_2755967_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|2756109_2756508_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|2756588_2756747_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001235460.1|2757839_2758463_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001028854.1|2758459_2759125_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223927.1|2759121_2759724_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001108084.1|2759698_2760265_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_042352449.1|2760824_2761757_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	6.1e-151
WP_001345214.1|2761795_2762623_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.6	1.6e-150
WP_001254228.1|2763126_2763309_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001281192.1|2763465_2763810_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001444001.1|2763915_2764134_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_000533670.1|2764111_2765182_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001215757.1|2765176_2765803_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000012296.1|2765799_2767488_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001281242.1|2767636_2770264_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
2771204:2771239	attR	CGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
>prophage 13
NZ_CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	3119984	3204609	5233637	terminase,tRNA,portal,integrase,protease,tail,transposase	Enterobacteria_phage(68.52%)	86	3187966:3187981	3211413:3211428
WP_001298974.1|3119984_3120722_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|3120853_3122188_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|3122397_3123279_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|3123382_3123970_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3124025_3124409_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|3124712_3125402_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|3125449_3126487_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3126693_3127113_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001341635.1|3127181_3127880_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000083007.1|3127911_3130572_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3130685_3132041_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000464877.1|3132065_3132410_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|3132406_3133705_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|3139557_3142131_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|3142260_3142992_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079107.1|3142988_3143969_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3144103_3144841_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3145111_3145453_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3145556_3145604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|3145702_3146863_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225214.1|3146905_3148027_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|3148037_3149108_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000976004.1|3149317_3149683_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3149832_3150351_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969032.1|3150340_3151567_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589821.1|3151582_3152065_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3152141_3152489_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264774.1|3152530_3153298_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3153328_3153877_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3153895_3154144_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460032.1|3154392_3155754_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001189267.1|3155845_3156712_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|3156732_3158019_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3158073_3158667_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|3158789_3159668_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|3159753_3161415_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3161563_3161905_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3161966_3162257_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3162246_3162723_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3162854_3163337_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217540.1|3164185_3164434_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	100.0	2.4e-38
WP_001023452.1|3164801_3165071_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000279058.1|3165072_3166395_-|tail	tail fiber protein	tail	Q687E6	Enterobacteria_phage	99.1	3.7e-77
WP_001230455.1|3166459_3167059_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000514851.1|3167126_3170603_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_122996286.1|3170849_3171482_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_001369128.1|3171427_3172171_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
WP_001152113.1|3172176_3172875_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
WP_000847298.1|3172874_3173204_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_085948178.1|3175752_3176965_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000682711.1|3176968_3177115_-	hypothetical protein	NA	Q687G0	Enterobacteria_phage	100.0	3.5e-21
WP_000974958.1|3177127_3177751_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_001281348.1|3177753_3178035_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_001097065.1|3178027_3178354_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|3178441_3180466_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|3180410_3181913_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102413.1|3181912_3182125_-	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
WP_001077625.1|3182121_3184245_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000373407.1|3184241_3184718_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816791.1|3185192_3185378_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000752026.1|3186381_3186651_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_112033838.1|3186660_3187608_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	99.7	1.6e-170
3187966:3187981	attL	TTTTTAAGATTTTGTT	NA	NA	NA	NA
WP_001204849.1|3188114_3188549_-	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000144764.1|3188541_3188736_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001108006.1|3188732_3189338_-	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
WP_000211413.1|3190135_3190840_-	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	100.0	9.6e-133
WP_001254256.1|3191114_3191297_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|3191293_3191821_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001303571.1|3191817_3192264_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|3192220_3192457_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|3192467_3192683_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|3192815_3193094_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_001036037.1|3193163_3193433_-	hypothetical protein	NA	Q687G4	Enterobacteria_phage	100.0	8.4e-45
WP_000131492.1|3193432_3194869_-	AAA family ATPase	NA	Q8VNP7	Enterobacteria_phage	100.0	6.1e-275
WP_000065668.1|3194858_3195758_-	hypothetical protein	NA	Q8VNP8	Enterobacteria_phage	100.0	1.6e-164
WP_000166207.1|3195750_3195897_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_001177653.1|3195931_3196210_-	transcriptional regulator	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
WP_085948178.1|3196302_3197515_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000532424.1|3197746_3198259_+	single-stranded DNA-binding protein	NA	Q8VNQ1	Enterobacteria_phage	100.0	1.8e-75
WP_001111331.1|3198272_3198566_+	DUF2856 family protein	NA	Q687G7	Enterobacteria_phage	100.0	8.5e-51
WP_001214463.1|3198576_3198744_+	DUF2737 family protein	NA	Q687G8	Enterobacteria_phage	100.0	3.0e-24
WP_001289947.1|3198740_3199340_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	100.0	1.8e-111
WP_112033839.1|3199341_3200613_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	7.0e-182
WP_000448925.1|3200651_3201068_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214990.1|3201140_3202889_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_001426837.1|3202890_3204609_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.7	5.5e-307
3211413:3211428	attR	TTTTTAAGATTTTGTT	NA	NA	NA	NA
>prophage 14
NZ_CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	3276137	3283277	5233637		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|3276137_3278699_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141347.1|3278804_3279461_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001272549.1|3279511_3280309_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_000847985.1|3280474_3281383_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590389.1|3281379_3282642_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_001278994.1|3282638_3283277_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 15
NZ_CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	3532379	3588355	5233637	protease,transposase,tRNA	Escherichia_phage(40.0%)	50	NA	NA
WP_001297457.1|3532379_3533138_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_001169551.1|3533193_3533937_-	2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000193113.1|3533923_3535033_-	D-glucosaminate-6-phosphate ammonia lyase	NA	NA	NA	NA	NA
WP_160333632.1|3535036_3535897_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_000380263.1|3535893_3536643_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001284302.1|3536668_3537154_-	PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	NA	NA	NA	NA	NA
WP_000214203.1|3537164_3537593_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001252647.1|3537711_3540510_-	transcriptional regulator DagR	NA	NA	NA	NA	NA
WP_000105566.1|3540768_3541689_-	agmatinase	NA	NA	NA	NA	NA
WP_000758903.1|3541824_3542556_-	membrane protein	NA	NA	NA	NA	NA
WP_001344776.1|3542701_3544678_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001338822.1|3544686_3544818_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|3544953_3545169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3545472_3546627_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3547062_3548457_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|3548533_3549031_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|3549125_3549833_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222508.1|3549912_3550644_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|3550656_3551607_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000126441.1|3551643_3552279_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|3552278_3552695_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001055633.1|3552870_3553851_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3553868_3554573_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3554590_3555157_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3555153_3555444_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174743.1|3555451_3556045_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239919.1|3556037_3557174_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000784004.1|3557487_3558474_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577033.1|3558518_3559022_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378946.1|3559021_3560323_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745216.1|3560378_3561386_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394117.1|3561502_3562549_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3562724_3563444_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|3563627_3563954_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3563953_3564673_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001321419.1|3564833_3565886_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3565913_3566189_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|3566253_3567333_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|3567534_3568791_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839773.1|3568840_3570976_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234516.1|3571373_3572081_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_085948178.1|3573476_3574690_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_085948178.1|3575475_3576688_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001121747.1|3578727_3580377_+	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_000953028.1|3580985_3581975_+	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.2	4.1e-97
WP_000609741.1|3582023_3582698_+	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_000823907.1|3584614_3585433_-	YjiK family protein	NA	NA	NA	NA	NA
WP_001358534.1|3585560_3586706_-	type III secretion system LEE effector EspG	NA	NA	NA	NA	NA
WP_000878223.1|3587192_3588059_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.9e-51
WP_000169527.1|3588055_3588355_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	4828555	4863546	5233637	tRNA,capsid,holin,head,tail,terminase	Stx2-converting_phage(48.28%)	33	NA	NA
WP_001047110.1|4828555_4829308_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_001339373.1|4829617_4829770_+	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_000143076.1|4830587_4832438_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.9	0.0e+00
WP_000411802.1|4832886_4833093_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|4833092_4833590_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_001208681.1|4833806_4833992_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|4834519_4834834_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000958398.1|4835734_4836298_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
WP_009453642.1|4836294_4837956_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.7	0.0e+00
WP_000173088.1|4838019_4839957_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.4	0.0e+00
WP_001063096.1|4840001_4840223_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|4842586_4842913_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|4842922_4843273_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|4843269_4843716_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|4843712_4844057_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275461.1|4844123_4844840_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	2.1e-127
WP_001030043.1|4844845_4845220_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001453698.1|4845315_4845525_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212952.1|4845576_4848819_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.2	0.0e+00
WP_000807964.1|4848811_4849153_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152209.1|4849152_4849851_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	3.1e-131
WP_000194763.1|4849861_4850605_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_126303346.1|4850550_4851183_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.5	1.2e-97
WP_112033856.1|4851418_4854895_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.0	0.0e+00
WP_001216290.1|4854963_4855587_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_000279033.1|4855651_4856965_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001023417.1|4856966_4857236_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_000442132.1|4857396_4857819_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001345294.1|4857949_4859008_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001117798.1|4859086_4859737_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132154.1|4859919_4860510_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|4861011_4861260_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000543817.1|4862508_4863546_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 17
NZ_CP028432	Escherichia coli strain RM9975 chromosome, complete genome	5233637	4947134	4993669	5233637	protease,transposase	Escherichia_phage(25.0%)	37	NA	NA
WP_085948178.1|4947134_4948347_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001239084.1|4948716_4958388_-	lymphostatin Efa1/LifA	NA	NA	NA	NA	NA
WP_000609742.1|4960261_4960936_-	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_000953030.1|4960984_4961974_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	1.1e-97
WP_085948178.1|4964671_4965885_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_072098057.1|4967312_4967927_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	4.7e-43
WP_001345309.1|4968366_4969161_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4969231_4969681_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4969722_4969950_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4969954_4970269_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4970275_4970671_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4970997_4971273_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4971401_4972088_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|4972087_4972942_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4972951_4973602_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776505.1|4973615_4974080_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218360.1|4974089_4974395_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001300695.1|4974410_4975808_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|4976162_4977227_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|4977334_4978090_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569730.1|4978086_4978836_-	esterase	NA	NA	NA	NA	NA
WP_000254642.1|4979017_4979347_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4979495_4979771_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001299838.1|4979887_4981513_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943991.1|4981596_4982760_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_000101670.1|4982762_4983401_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4983410_4983809_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012546.1|4983826_4984486_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|4984536_4985235_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|4985253_4985655_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293281.1|4985781_4986513_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076318.1|4986692_4989053_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.2e-67
WP_001177639.1|4989091_4989517_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4989721_4991020_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4991123_4991321_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4991402_4992407_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4992409_4993669_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 1
NZ_CP028433	Escherichia coli strain RM9975 plasmid pRM9975-1, complete sequence	120253	0	119510	120253	portal,integrase,tail,tRNA,terminase,transposase	Salmonella_phage(81.31%)	123	1102:1161	52781:54092
WP_001293471.1|0_1056_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	91.0	5.4e-172
1102:1161	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_085948178.1|1155_2368_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_085948178.1|2715_3928_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001229345.1|4171_4384_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
WP_000644408.1|4383_4719_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	6.6e-39
WP_001755515.1|4934_5210_-	hypothetical protein	NA	J9Q738	Salmonella_phage	74.7	2.0e-33
WP_033803584.1|5265_5691_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	76.1	2.9e-60
WP_000715581.1|5782_6613_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
WP_021520138.1|6616_6817_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	59.1	7.2e-09
WP_085948178.1|7674_8887_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000066497.1|12744_12960_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	77.1	2.9e-24
WP_001240351.1|13289_13853_-	hypothetical protein	NA	J9Q7G7	Salmonella_phage	67.7	1.3e-66
WP_001090697.1|14392_14824_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	83.9	9.9e-64
WP_112033863.1|14941_15982_+	regulator	NA	J9Q7Z3	Salmonella_phage	89.9	4.9e-117
WP_001755518.1|16042_16987_+	5'-3' exonuclease SAM fold family protein	NA	J9Q7S6	Salmonella_phage	88.9	1.0e-161
WP_162630519.1|17360_17699_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	7.4e-06
WP_085948178.1|17664_18878_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_112033864.1|19122_20358_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	80.8	2.0e-197
WP_112033865.1|20453_22562_-	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	67.2	2.5e-229
WP_001098353.1|22660_22873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282576.1|23124_23511_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000797845.1|23505_24609_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
WP_072328047.1|24782_25193_-	toxin YafO	NA	NA	NA	NA	NA
WP_024219443.1|25202_25655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072328049.1|25906_26152_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	3.5e-13
WP_001755525.1|26325_27234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000067985.1|28746_29037_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	79.2	2.4e-37
WP_000636536.1|29182_29398_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.1	9.7e-20
WP_104772314.1|29394_30717_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	91.1	3.4e-240
WP_112033866.1|30713_30971_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	56.6	5.6e-14
WP_104772315.1|31251_32034_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	43.4	3.0e-58
WP_000038288.1|32159_32573_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	48.1	3.9e-25
WP_059244885.1|32803_33949_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_162630520.1|33940_35056_-	DNA primase	NA	J9Q720	Salmonella_phage	91.6	1.1e-204
WP_032203361.1|35203_36544_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	93.3	9.8e-235
WP_001717320.1|36587_37328_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.6	2.2e-127
WP_000342417.1|37610_38378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160378290.1|38430_38784_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_000161228.1|38789_39458_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
WP_085948178.1|39633_40846_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001351987.1|41089_41359_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_112033868.1|41366_41888_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000901559.1|42056_42308_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	75.6	2.0e-24
WP_012640731.1|42309_43002_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	93.9	1.8e-123
WP_000064175.1|43015_43339_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	88.8	2.9e-44
WP_112033869.1|43541_46205_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	39.2	2.2e-68
WP_085948178.1|51572_52786_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_024171470.1|53718_54312_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	90.9	3.4e-99
52781:54092	attR	AGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCATACCCCAGCGTAAGTGTTACTGGACTCGTTATAGTTTGAAGGTACTCGAATTTTTAGGCCACGCACCAGATAAGAGCGAGATGGCATGGTGCTACCGAATTGCTCAGAGTTTACCTTCAATCCAACCAAAACAGAGTTTGGATAGTTCATCGGTGTATCGACAATTTCCCCGATTGAATCCACCCATGTATCGTTATAGAGATACTGGCTACTGTTATCATCGGTAATACGGACTACACGAACCTTGTATGCGCGTCCAGGCTTAGGCAGCTTCAGCTCGTAGCTACGGTAATAAACGCCGGTCTTCTTTGCTGTTAGCTTAATGCCAACGCTTTTTTCACCTTCCGCGACCACATCTACAAATGTTGAGTCGCCATTTGCTATCTGGAACTTGTACTCAACAGTCGTACCGTTCGTGTCACCAGTTTTTTTATCTATGCTTCGCAAAGAAGGAAACTTCATGATGACACGAACCCGATCAGCTTCATCGTTATCGATTGAAACCGTTACATAATGTGTTTTTTTTAACTGGATATTGACGGATTTAGGCGTTTCAACGAAATCAAAGCCAGACATTGGAGTCTGGTCTTGTGAACCGTCGCGAAAATCCCATGTGATTCCGCTGAAGTTGGAGGAACCGTCTTCATTTACAATCGGCAGATCGTCGATAAAAATAGATCTTGCGCCATTTACTAAGCCGCCAATTACCCCTTCCCCAAGAAGATCGAGGATAGCGGCCATTGCACGAGAATTTACGGTATCGTCGGCTTCAACCGGTGTACGGCTGGAGCTTTTGCTGCTTTTTTTACCACCCGCACCGGCAATAAACAGCGGTAGCTTTTTCTTCTTGAACTGTTCCATGTTCAAAAAATCCTTGTTTACATTAGCTGGTCAATCGTGATTGAAGAACTCACAACCTGTGAGCCAACCAGAATTTCCTCGCCATAGATAAGTTGTACTGGGTTGCCCTGGTTTTCTGTATTTTGAGGGCCGTCGAAATAATAAGAGTTCGAGTTATCTGCCTGTCTCACACTTTCGTTAGTGGCTTGCGGCGATATGATTTGTGATATGCCGCCCATCATCAGTGACAAACCGAGAGGTGCTAAAGCAGGCATCACTACCGCCGATACAACCAACAAAGCGGCCCCTACTACCGTCTGAAACCACCCAAAAGCAGATCCACCGCTTCCTCGCGGAACAGGTGTAATGCGGATTTTGGCAATGTTGTCAGACTGCCCCATCATCTGATATT	NA	NA	NA	NA
WP_089568137.1|54299_55097_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	93.2	1.9e-153
WP_053900116.1|55869_56205_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	1.8e-52
WP_089568136.1|56247_60807_-	tape measure protein	NA	J9Q712	Salmonella_phage	80.0	0.0e+00
WP_000952686.1|60814_61039_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.6	8.8e-32
WP_000163861.1|61164_61482_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	96.2	8.6e-49
WP_048958837.1|61537_62284_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	92.7	2.4e-121
WP_061158047.1|62358_62742_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	82.7	1.2e-57
WP_000523628.1|62743_63217_-	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
WP_001027663.1|63207_63552_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
WP_061158048.1|63631_64465_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.4	2.7e-142
WP_061158049.1|64464_64899_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.2	9.7e-59
WP_061158050.1|64943_65864_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	83.9	1.3e-132
WP_061158051.1|65937_66813_-	hypothetical protein	NA	J9Q710	Salmonella_phage	93.8	1.5e-154
WP_061158052.1|66838_67726_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	87.9	1.1e-130
WP_000422361.1|67747_69322_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	92.9	2.4e-285
WP_001007299.1|69348_70605_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.4	7.5e-245
WP_048958825.1|70604_71237_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	83.3	1.2e-89
WP_000176292.1|71435_71702_-	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_000129633.1|71711_72602_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.6	2.6e-167
WP_061158053.1|72598_73264_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.6	2.8e-110
WP_000161986.1|73260_73929_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
WP_000382660.1|73928_74609_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	88.1	2.7e-108
WP_061158054.1|74691_76251_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.9	1.3e-278
WP_001291061.1|76253_76532_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	58.2	4.6e-22
WP_061158055.1|76564_77164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061158056.1|77549_78350_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	31.3	6.0e-06
WP_023145147.1|78452_78974_+	repressor of phase-1 flagellin	NA	J9Q6L0	Salmonella_phage	79.7	1.2e-66
WP_029305755.1|79269_79920_+	hypothetical protein	NA	J9Q754	Salmonella_phage	84.7	1.1e-98
WP_000255469.1|79969_80173_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	91.0	5.9e-27
WP_059277742.1|80193_80421_+	hypothetical protein	NA	A0A1S6KV93	Providencia_phage	41.3	2.5e-05
WP_001009193.1|81030_81513_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	7.9e-62
WP_086118731.1|81717_81999_-	ABC transporter	NA	J9Q753	Salmonella_phage	77.4	1.1e-36
WP_047659410.1|82843_83239_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	53.8	1.2e-31
WP_000749407.1|83365_83677_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	63.1	5.7e-29
WP_089568284.1|83830_84160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021520100.1|85690_86251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000910476.1|86413_86599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001717178.1|86635_86857_-	hypothetical protein	NA	J9Q750	Salmonella_phage	58.2	1.9e-18
WP_021547919.1|87096_89130_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
WP_000004356.1|89287_90388_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_000506720.1|90425_90815_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	93.0	8.6e-67
WP_000108705.1|91616_92243_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	71.1	3.3e-07
WP_112033872.1|92619_93537_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	44.2	2.3e-46
WP_053272001.1|93536_93722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053272000.1|93696_94263_-	ead/Ea22-like family protein	NA	A0A222YWM9	Escherichia_phage	59.5	1.7e-42
WP_053271999.1|94259_94715_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	60.2	1.2e-19
WP_053271998.1|94853_95234_-	hypothetical protein	NA	J9Q801	Salmonella_phage	69.8	5.9e-28
WP_052988679.1|95233_95938_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	76.9	7.2e-88
WP_001090447.1|95999_97685_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	92.3	0.0e+00
WP_000467662.1|97788_98403_-	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	82.8	1.2e-99
WP_021533177.1|98405_98687_-	hypothetical protein	NA	A0A0E3JPT1	Enterobacteria_phage	76.3	3.2e-39
WP_001718087.1|98742_99312_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	61.4	1.4e-52
WP_014962273.1|99451_99610_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_021533179.1|99609_100035_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	83.0	2.8e-58
WP_021533180.1|100128_100326_-	hypothetical protein	NA	J9Q800	Salmonella_phage	56.9	2.6e-11
WP_021533181.1|100335_100830_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	55.4	8.8e-24
WP_162630521.1|100975_101623_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	82.3	1.1e-98
WP_032203380.1|102153_102384_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	85.5	2.0e-31
WP_000559568.1|102569_103163_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	86.3	2.0e-99
WP_053902537.1|103346_104156_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.2	1.3e-64
WP_112033873.1|104314_104830_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	82.2	3.1e-80
WP_085948178.1|104878_106092_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001718079.1|106194_106614_-	hypothetical protein	NA	J9Q743	Salmonella_phage	71.9	3.2e-51
WP_000386469.1|106675_107320_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	81.3	7.8e-97
WP_160378288.1|107319_107790_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	90.4	2.8e-80
WP_001348729.1|107792_108206_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	84.7	2.3e-62
WP_162630522.1|108207_109311_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	86.9	8.4e-192
WP_001011861.1|109482_110352_-	hypothetical protein	NA	J9Q742	Salmonella_phage	80.6	5.3e-133
WP_000122502.1|110429_111572_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
WP_000623683.1|111678_113994_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.3	0.0e+00
WP_000037962.1|114067_114637_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	1.1e-91
WP_112033874.1|114646_115390_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	47.2	1.5e-51
WP_021520140.1|115379_117296_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	73.0	4.9e-248
WP_000174803.1|117525_118611_-	exonuclease	NA	J9Q7S9	Salmonella_phage	87.5	8.0e-187
WP_000364573.1|118865_119510_-	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
>prophage 1
NZ_CP028434	Escherichia coli strain RM9975 plasmid pRM9975-2, complete sequence	78526	2288	65955	78526	transposase	Escherichia_phage(21.43%)	56	NA	NA
WP_000937595.1|2288_3476_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|3475_3841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997720.1|3979_4234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034091.1|4740_8706_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	39.9	1.1e-230
WP_085952195.1|9025_10239_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
WP_000445936.1|10878_11274_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000921961.1|11273_12233_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.6	6.0e-61
WP_077629034.1|12505_13408_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086162.1|13792_14164_+	restriction endonuclease subunit M	NA	A0A2I7RE86	Vibrio_phage	33.9	1.4e-10
WP_000937595.1|14270_15458_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|15457_15823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|16098_17286_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|17285_17651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072106536.1|18023_18326_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271680.1|18372_18795_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027516.1|18791_18983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|20020_20251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170683.1|20302_21664_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_071600428.1|22424_22685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032175643.1|22735_22930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290792.1|23157_23685_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	54.1	4.6e-47
WP_000006004.1|23740_23974_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	3.9e-06
WP_001145472.1|24032_25991_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.9	6.6e-22
WP_000845949.1|26045_26480_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276234.1|26476_27196_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001299721.1|27207_27396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|27475_27634_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_032351767.1|28134_28323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000107535.1|28555_28843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234469.1|28963_29785_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
WP_001151524.1|31004_31388_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_000283394.1|31574_32264_+	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_001309237.1|32362_32758_+	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_000994781.1|32790_33150_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000012104.1|33164_33476_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000399800.1|33497_34064_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_072095570.1|34074_34779_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000146670.1|34778_36206_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_000002783.1|36195_36786_+	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_001369729.1|36772_36895_+	DUF2689 domain-containing protein	NA	NA	NA	NA	NA
WP_085948178.1|38676_39890_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000628099.1|41606_42116_+	conjugal transfer entry exclusion protein TraS	NA	NA	NA	NA	NA
WP_000850424.1|42129_42861_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_001369365.1|43113_45267_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000986985.1|45266_50537_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000205714.1|50556_51303_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	7.1e-09
WP_000704529.1|51361_52222_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
WP_000139321.1|52324_52885_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001171554.1|53034_53415_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000998093.1|53809_55348_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	3.8e-299
WP_001213544.1|56166_57606_-	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_000987096.1|57609_59730_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	1.6e-45
WP_000217744.1|59779_62776_-	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000839950.1|62777_63293_-	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000091308.1|64402_64768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|64767_65955_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
