The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030327	Pseudomonas aeruginosa strain AR_458 chromosome, complete genome	6685102	1585399	1594739	6685102		Mycobacterium_phage(16.67%)	8	NA	NA
WP_033957462.1|1585399_1586446_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.2	3.9e-114
WP_003092262.1|1586884_1587391_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003098486.1|1587538_1588546_+	TolB family protein	NA	NA	NA	NA	NA
WP_003113873.1|1588671_1591239_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_003092272.1|1591305_1591629_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003113871.1|1592055_1593060_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003143263.1|1593164_1594058_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003098558.1|1594103_1594739_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
>prophage 2
NZ_CP030327	Pseudomonas aeruginosa strain AR_458 chromosome, complete genome	6685102	2347876	2354181	6685102		Pseudomonas_phage(57.14%)	8	NA	NA
WP_003085205.1|2347876_2348713_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
WP_003085203.1|2348709_2349759_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003101640.1|2349760_2350366_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.8	6.0e-75
WP_023102828.1|2350772_2351057_-	hypothetical protein	NA	A0A0A7DJU8	Pseudomonas_phage	64.5	1.3e-24
WP_023102827.1|2351053_2352448_-	hypothetical protein	NA	W8VLC7	Pseudomonas_phage	55.0	8.7e-93
WP_023102826.1|2352543_2352774_-	hypothetical protein	NA	A0A1W6JT87	Pseudomonas_phage	62.7	5.7e-18
WP_023085656.1|2352754_2353090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023102825.1|2353089_2354181_-	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	37.1	9.6e-47
>prophage 3
NZ_CP030327	Pseudomonas aeruginosa strain AR_458 chromosome, complete genome	6685102	2358500	2368202	6685102	tail,holin	Pseudomonas_phage(66.67%)	15	NA	NA
WP_003117974.1|2358500_2359103_-|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	57.3	6.5e-53
WP_003117973.1|2359157_2359928_-	hypothetical protein	NA	A0A2D1GNP8	Pseudomonas_phage	55.6	4.2e-81
WP_023102823.1|2359930_2360626_-|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	49.8	1.3e-68
WP_003113186.1|2360633_2360975_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
WP_112292550.1|2360967_2362803_-|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	35.8	2.0e-28
WP_003113188.1|2362849_2363104_-	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
WP_004352265.1|2363133_2363481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003113190.1|2363492_2363987_-	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
WP_003118919.1|2364302_2364560_-	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_014602438.1|2364556_2364919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023102821.1|2364915_2365545_-	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	5.5e-87
WP_017002346.1|2365560_2366004_-|holin	holin	holin	B5TK61	Pseudomonas_phage	51.8	6.5e-26
WP_003113201.1|2366366_2366726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085132.1|2366773_2366974_-	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003113202.1|2367431_2368202_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
>prophage 4
NZ_CP030327	Pseudomonas aeruginosa strain AR_458 chromosome, complete genome	6685102	4580494	4628941	6685102	transposase,integrase,capsid	Pseudomonas_phage(57.89%)	55	4560945:4560963	4624070:4624088
4560945:4560963	attL	CATCGACCTGCTCGACCAG	NA	NA	NA	NA
WP_003116532.1|4580494_4581097_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003116531.1|4581260_4582895_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_003085366.1|4584775_4585195_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_003098450.1|4585203_4585950_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_003110840.1|4586017_4587724_+	membrane protein	NA	NA	NA	NA	NA
WP_003085372.1|4587758_4588421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003120807.1|4588449_4588929_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_003120806.1|4588933_4589878_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003120805.1|4589877_4590303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003120804.1|4590312_4591299_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003116524.1|4591370_4592036_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003085391.1|4592018_4592924_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_003123056.1|4593002_4594319_-	MFS transporter	NA	NA	NA	NA	NA
WP_003098438.1|4594389_4595784_-	amidase	NA	NA	NA	NA	NA
WP_003116522.1|4595910_4596531_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	39.6	2.2e-27
WP_003098436.1|4596564_4597467_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	40.8	1.1e-11
WP_003120801.1|4597721_4598360_-	type B chloramphenicol O-acetyltransferase	NA	M1HS53	Paramecium_bursaria_Chlorella_virus	32.4	3.1e-13
WP_003120800.1|4598452_4599232_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003145767.1|4599517_4600372_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003085421.1|4600487_4600784_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004348185.1|4600828_4601224_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_004348186.1|4601267_4601774_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	33.7	7.2e-13
WP_003085431.1|4601833_4602091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003123050.1|4602430_4602724_+	DUF2845 domain-containing protein	NA	NA	NA	NA	NA
WP_031633222.1|4602955_4603432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071534925.1|4603742_4604747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071534926.1|4604746_4605802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112292595.1|4605801_4606287_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_124141604.1|4606387_4607086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003455003.1|4607171_4607360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071534927.1|4607583_4607853_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_019725826.1|4607998_4608214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033977321.1|4608215_4608428_+	hypothetical protein	NA	Q56VP8	Pseudomonas_phage	95.7	4.4e-33
WP_034066644.1|4608431_4608722_+	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	94.8	2.4e-53
WP_031671954.1|4608725_4609103_+	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	98.4	4.0e-61
WP_003140508.1|4609237_4609672_+	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	100.0	3.8e-63
WP_003115130.1|4609688_4609781_+	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_003115979.1|4609793_4610045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003140506.1|4610057_4610306_+|capsid	phage capsid protein	capsid	Q56VP2	Pseudomonas_phage	100.0	2.1e-34
WP_052151594.1|4610459_4611788_+	hypothetical protein	NA	Q56VP1	Pseudomonas_phage	65.6	2.8e-80
WP_003114150.1|4611792_4612149_+	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
WP_003140504.1|4612152_4613436_+	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	99.8	1.1e-235
WP_034066647.1|4613665_4614958_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	94.4	9.7e-248
WP_112292596.1|4614957_4615413_+|integrase	integrase	integrase	Q56VN7	Pseudomonas_phage	52.7	3.2e-36
WP_112292490.1|4615505_4617005_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_003459721.1|4616997_4617801_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.2	4.0e-34
WP_112292597.1|4617972_4618863_-	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_019485624.1|4618884_4619343_-	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_023101528.1|4619421_4621251_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	41.3	7.6e-105
WP_023101527.1|4621278_4622709_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_023101526.1|4622725_4625575_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	40.8	4.5e-128
4624070:4624088	attR	CTGGTCGAGCAGGTCGATG	NA	NA	NA	NA
WP_023101525.1|4625668_4626238_-	Hsp20/alpha crystallin family protein	NA	A0A1D7SX46	Cyanophage	27.1	8.1e-05
WP_012761384.1|4626273_4626555_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016446188.1|4626839_4627217_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_023101524.1|4627861_4628941_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP030327	Pseudomonas aeruginosa strain AR_458 chromosome, complete genome	6685102	5787240	5858117	6685102	tRNA,terminase,tail,integrase,holin,protease	Pseudomonas_phage(49.21%)	83	5783426:5783445	5821828:5821847
5783426:5783445	attL	TCCTGGATCAGGCCCTGCAG	NA	NA	NA	NA
WP_003131114.1|5787240_5788368_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_003097654.1|5788411_5788882_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003122606.1|5788968_5791194_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003090436.1|5791552_5792809_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	81.5	3.1e-17
WP_003090435.1|5792881_5793154_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.8	1.1e-15
WP_003097649.1|5793380_5793749_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	41.6	4.9e-11
WP_003090432.1|5793776_5796053_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.8	3.4e-163
WP_002553999.1|5796134_5796353_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_003108766.1|5796457_5797165_-	arginyltransferase	NA	NA	NA	NA	NA
WP_112292615.1|5797219_5797900_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_003090421.1|5797937_5798888_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.0	9.2e-62
WP_003119977.1|5799115_5801551_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	52.8	1.9e-87
WP_003090414.1|5801576_5802203_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_023115288.1|5802212_5803538_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.2	2.5e-81
WP_003097631.1|5803659_5804940_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_003113366.1|5804941_5806339_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_016562014.1|5806343_5807318_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003097625.1|5807405_5808389_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	3.5e-141
WP_003119979.1|5808385_5808721_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	1.5e-38
WP_023115289.1|5808717_5809023_-	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	58.6	7.3e-21
WP_016562012.1|5809022_5809382_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.1e-34
WP_016562011.1|5809378_5809774_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	71.3	3.5e-47
WP_003090386.1|5809884_5810553_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
WP_031632843.1|5810888_5811956_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	68.2	5.4e-135
WP_003116724.1|5811957_5812194_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	53.2	3.8e-17
WP_112292616.1|5812272_5813205_-	hypothetical protein	NA	A0A2K8HL62	Pseudomonas_phage	37.9	2.0e-37
WP_057375059.1|5813314_5814076_-	hypothetical protein	NA	Q5QF32	Pseudomonas_virus	97.2	1.7e-146
WP_057375060.1|5814072_5814714_-	hypothetical protein	NA	Q5QF31	Pseudomonas_virus	95.3	3.8e-120
WP_031641771.1|5814710_5815034_-	DUF4406 domain-containing protein	NA	H2BD42	Pseudomonas_phage	98.1	2.3e-57
WP_057375084.1|5815030_5815549_-	DUF550 domain-containing protein	NA	L7TI87	Pseudomonas_virus	91.3	2.3e-91
WP_033866034.1|5815740_5816052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112292617.1|5816114_5818025_-	DNA cytosine methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	97.0	1.7e-296
WP_124117754.1|5818140_5818467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112292618.1|5818630_5819344_-	DNA polymerase III subunit epsilon	NA	A0A059VJT9	Pseudomonas_phage	47.7	5.5e-51
WP_112292619.1|5819393_5821139_-	AAA family ATPase	NA	H2BD46	Pseudomonas_phage	89.8	3.3e-283
WP_023121812.1|5821142_5821907_-	hypothetical protein	NA	J7I0T4	Pseudomonas_phage	76.8	2.7e-120
5821828:5821847	attR	TCCTGGATCAGGCCCTGCAG	NA	NA	NA	NA
WP_009314053.1|5821917_5822118_-	hypothetical protein	NA	J7I437	Pseudomonas_phage	100.0	1.9e-30
WP_112292620.1|5822124_5823024_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	70.6	1.2e-103
WP_003099033.1|5823036_5823945_-	endonuclease	NA	Q858E0	Salmonella_phage	72.0	1.6e-124
WP_034049706.1|5823954_5824164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003099037.1|5824160_5824382_-	hypothetical protein	NA	H2BD53	Pseudomonas_phage	100.0	1.2e-33
WP_003451719.1|5825090_5825462_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	99.2	2.5e-63
WP_016046659.1|5825494_5825758_-	hypothetical protein	NA	H2BD57	Pseudomonas_phage	100.0	1.3e-45
WP_099256683.1|5826259_5826511_-	DUF1654 domain-containing protein	NA	H2BD60	Pseudomonas_phage	43.1	6.5e-07
WP_023121825.1|5826620_5827043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057375085.1|5827082_5827733_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTC8	Pseudomonas_phage	62.0	1.7e-51
WP_023121827.1|5827845_5828076_+	helix-turn-helix transcriptional regulator	NA	A0A127KNT2	Pseudomonas_phage	70.6	7.4e-18
WP_009314063.1|5828116_5828713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112292621.1|5828716_5829679_+	hypothetical protein	NA	A0A2H4JCW9	uncultured_Caudovirales_phage	48.6	8.0e-13
WP_012075320.1|5829806_5830220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112292622.1|5830212_5830656_+	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	97.3	1.8e-76
WP_112292623.1|5830684_5831554_+	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	95.5	3.2e-162
WP_010793141.1|5831694_5831883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004349441.1|5832192_5832582_+	hypothetical protein	NA	H2BD73	Pseudomonas_phage	100.0	9.9e-63
WP_003116758.1|5832574_5832859_+|holin	phage holin family protein	holin	H2BD74	Pseudomonas_phage	100.0	1.2e-41
WP_112292624.1|5832867_5833464_+|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	50.3	2.3e-34
WP_112292625.1|5833450_5834737_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.8	3.1e-145
WP_112292626.1|5834736_5836545_+	DUF1073 domain-containing protein	NA	A0A2H4J4I9	uncultured_Caudovirales_phage	61.8	1.6e-216
WP_112292627.1|5836547_5837669_+	DUF2213 domain-containing protein	NA	A0A2H4J6J7	uncultured_Caudovirales_phage	66.0	2.8e-94
WP_112292628.1|5837668_5838124_+	DUF2190 family protein	NA	A0A2R3UAC1	Siphoviridae_environmental_samples	59.1	6.4e-37
WP_112292629.1|5838133_5839063_+	DUF2184 domain-containing protein	NA	L7TMZ5	Rhizobium_phage	61.2	2.3e-105
WP_009314076.1|5839075_5839519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112292651.1|5839576_5840095_+	hypothetical protein	NA	A0A059VG19	Pseudomonas_phage	54.7	1.0e-38
WP_048764696.1|5840091_5841084_+	hypothetical protein	NA	A0A2H4IY91	uncultured_Caudovirales_phage	49.6	1.2e-83
WP_078465395.1|5840998_5841463_+	hypothetical protein	NA	A0A059VA70	Pseudomonas_phage	48.4	2.3e-26
WP_003116768.1|5841462_5841858_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	50.8	1.4e-27
WP_112292630.1|5841854_5842262_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_112292631.1|5842323_5843493_+	Ig-like domain-containing protein	NA	A0A059VG08	Pseudomonas_phage	39.7	5.8e-58
WP_033950363.1|5843551_5844040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112292632.1|5844159_5844435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112292633.1|5844385_5847667_+|tail	tail length tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	35.4	5.7e-95
WP_049874140.1|5847666_5848137_+	hypothetical protein	NA	A0A125RNN3	Pseudomonas_phage	40.4	1.9e-28
WP_003116774.1|5848138_5848624_+	DUF1833 family protein	NA	A0A2H4J983	uncultured_Caudovirales_phage	45.0	5.4e-34
WP_034055624.1|5848627_5849041_+	hypothetical protein	NA	B5WZT7	Pseudomonas_phage	60.0	1.6e-39
WP_112292634.1|5849006_5851754_+	hypothetical protein	NA	A0A0H5ART3	Pseudomonas_phage	47.8	1.0e-238
WP_112292635.1|5851820_5853899_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A127KNR5	Pseudomonas_phage	58.8	1.0e-41
WP_112292636.1|5853895_5855050_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	31.4	2.9e-25
WP_112292637.1|5855084_5855714_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	93.8	2.5e-108
WP_033950351.1|5855710_5856079_+	hypothetical protein	NA	A0A0S2SY58	Pseudomonas_phage	66.4	8.2e-35
WP_033953369.1|5856075_5856339_+	hypothetical protein	NA	B5WZU5	Pseudomonas_phage	92.0	2.2e-37
WP_003116782.1|5856374_5856638_+	hypothetical protein	NA	A0A0U4JX18	Pseudomonas_phage	94.3	1.2e-43
WP_003116783.1|5856619_5857306_-	hypothetical protein	NA	A0A2K8I970	Pseudomonas_phage	90.8	9.7e-122
WP_112292638.1|5857601_5858117_-	hypothetical protein	NA	L7TIE6	Pseudomonas_virus	95.3	4.5e-95
>prophage 6
NZ_CP030327	Pseudomonas aeruginosa strain AR_458 chromosome, complete genome	6685102	6000307	6035633	6685102	protease,portal,integrase,capsid,holin,head	Pseudomonas_phage(57.58%)	44	5996395:5996410	6007225:6007240
5996395:5996410	attL	CCAGACCTCGCAGTCG	NA	NA	NA	NA
WP_016562002.1|6000307_6001336_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	56.9	2.3e-98
WP_016562001.1|6001336_6001549_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_121500375.1|6002956_6003697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034058646.1|6003753_6004023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034066690.1|6004019_6006098_-	DNA methyltransferase	NA	A0A140IES2	Pseudomonas_phage	84.1	0.0e+00
WP_034066689.1|6006621_6007419_-	hypothetical protein	NA	A0A0E3M3Z6	Verrucomicrobia_phage	43.3	7.7e-46
6007225:6007240	attR	CCAGACCTCGCAGTCG	NA	NA	NA	NA
WP_124171382.1|6007534_6007861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034061655.1|6008028_6009774_-	AAA family ATPase	NA	H2BD46	Pseudomonas_phage	97.2	6.0e-301
WP_034061658.1|6009777_6010758_-	cell division protein FtsK	NA	H2BD47	Pseudomonas_phage	61.2	6.7e-92
WP_009314053.1|6010770_6010971_-	hypothetical protein	NA	J7I437	Pseudomonas_phage	100.0	1.9e-30
WP_014602814.1|6010977_6011877_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	73.6	3.2e-104
WP_034061661.1|6011889_6012798_-	endonuclease	NA	Q858E0	Salmonella_phage	71.3	1.4e-123
WP_023113718.1|6012864_6013149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029528657.1|6013272_6013512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014602817.1|6013504_6013687_-	hypothetical protein	NA	Q9MC67	Pseudomonas_phage	100.0	1.7e-25
WP_003099037.1|6013683_6013905_-	hypothetical protein	NA	H2BD53	Pseudomonas_phage	100.0	1.2e-33
WP_003099041.1|6014611_6014983_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	100.0	8.5e-64
WP_009314060.1|6015018_6015231_-	hypothetical protein	NA	L7TKR9	Pseudomonas_virus	97.1	8.9e-34
WP_124074828.1|6015330_6015642_+	hypothetical protein	NA	A0A2H4J0J8	uncultured_Caudovirales_phage	50.5	9.1e-19
WP_033982144.1|6016345_6016657_+	DUF1654 domain-containing protein	NA	A0A0S2SYC9	Pseudomonas_phage	61.1	1.6e-26
WP_071542656.1|6017041_6017647_+	sce7726 family protein	NA	A0A291I9I8	Lactobacillus_phage	39.5	1.4e-07
WP_079382220.1|6017594_6018713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015648953.1|6018702_6019269_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	35.0	2.4e-09
WP_065424967.1|6019273_6019885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015648951.1|6019920_6020754_-	Cro/CI family transcriptional regulator	NA	A0A0S2SYF7	Pseudomonas_phage	88.8	9.6e-140
WP_015648950.1|6020843_6021023_+	Cro/CI family transcriptional regulator	NA	A0A0S2SYB8	Pseudomonas_phage	98.3	1.9e-24
WP_015648949.1|6021055_6021439_+	hypothetical protein	NA	H2BD65	Pseudomonas_phage	97.6	5.5e-58
WP_023096627.1|6021606_6022179_+	hypothetical protein	NA	H2BD67	Pseudomonas_phage	99.5	1.2e-101
WP_034061664.1|6022181_6023192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034061691.1|6023319_6023733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019396730.1|6023725_6024169_+	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	99.3	2.1e-77
WP_034061667.1|6024197_6025067_+	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	94.5	7.4e-159
WP_021263386.1|6025157_6025733_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	52.7	2.4e-28
WP_019486655.1|6025773_6025953_-	type II toxin-antitoxin system HicA family toxin	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	55.0	3.2e-08
WP_003119044.1|6026412_6026748_+|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	100.0	2.2e-58
WP_034058608.1|6026744_6027362_+	glycoside hydrolase family 19 protein	NA	A0A0U4JP23	Pseudomonas_phage	89.3	8.2e-104
WP_034061670.1|6027331_6027811_+	hypothetical protein	NA	A0A0U4JX95	Pseudomonas_phage	86.2	5.7e-52
WP_034061674.1|6027907_6028645_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	46.2	2.5e-43
WP_014602833.1|6028910_6029405_+	DNA packaging protein	NA	A0A1B0Z033	Pseudomonas_phage	64.2	1.7e-51
WP_034061677.1|6031319_6031544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023111700.1|6031543_6033019_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	70.3	1.4e-197
WP_023111701.1|6033015_6034212_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	58.0	4.1e-115
WP_079382219.1|6034211_6034571_+|head	head decoration protein	head	A0A2H4JF15	uncultured_Caudovirales_phage	52.3	2.0e-17
WP_014602838.1|6034637_6035633_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	69.9	5.7e-131
