The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030753	Actinobacillus pleuropneumoniae strain S4074 chromosome, complete genome	2318657	450521	457072	2318657		Staphylococcus_phage(50.0%)	7	NA	NA
WP_005596390.1|450521_451607_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	1.1e-47
WP_005596391.1|451653_452301_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	43.7	3.1e-45
WP_005596392.1|452361_453567_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.7	2.5e-96
WP_005596393.1|453677_454139_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.5	7.9e-43
WP_005596395.1|454227_454716_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_005596397.1|454725_455661_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.2	2.7e-37
WP_005596399.1|455788_457072_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	32.9	1.1e-30
>prophage 2
NZ_CP030753	Actinobacillus pleuropneumoniae strain S4074 chromosome, complete genome	2318657	575853	614551	2318657	integrase,holin,tail,portal,protease,terminase	Mannheimia_phage(36.67%)	48	575656:575687	617708:617739
575656:575687	attL	AAACCAAAATTAGTTCACTTAGACTTCAAACG	NA	NA	NA	NA
WP_043991764.1|575853_576894_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	87.0	4.0e-175
WP_005609876.1|577151_577373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005596624.1|577517_578045_-	class I SAM-dependent methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	69.7	1.0e-62
WP_043991767.1|578028_578817_-	DNA methyltransferase	NA	U4KJA1	Streptococcus_phage	61.6	7.1e-84
WP_005596628.1|578863_579097_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_005596630.1|579409_580207_-	DUF2303 family protein	NA	NA	NA	NA	NA
WP_005596631.1|580252_580612_-	hypothetical protein	NA	I6XKT1	Burkholderia_virus	36.4	3.8e-08
WP_005596633.1|580674_580989_-	hypothetical protein	NA	Q19US5	Mannheimia_phage	35.9	2.0e-05
WP_005596635.1|581011_581308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043991768.1|581297_581567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043991770.1|581576_581795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005596638.1|583028_583256_-	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	65.3	2.9e-22
WP_005596639.1|583520_583796_+	Plasmid maintenance system killer/protein killer protein	NA	A0A0M3LQB1	Mannheimia_phage	94.5	7.0e-47
WP_005596640.1|583805_584096_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	86.3	1.8e-40
WP_005596643.1|584463_585279_-	DNA adenine methylase	NA	A0A1Z1LWI0	Synechococcus_phage	25.1	8.8e-13
WP_005596645.1|585323_586934_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005596647.1|587001_587676_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	44.7	2.6e-42
WP_005596650.1|587784_588000_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	57.7	2.1e-14
WP_043991773.1|588058_588754_+	antirepressor	NA	A0A2I7RHG4	Vibrio_phage	48.4	6.5e-49
WP_005596652.1|588783_589119_+	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	54.9	1.1e-22
WP_005596653.1|589201_589774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005596654.1|589776_590301_+	DNA methylase	NA	A0A0M3LNW2	Mannheimia_phage	42.3	5.1e-30
WP_005596657.1|590495_591518_+	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	37.3	4.0e-55
WP_005596658.1|591589_591955_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	49.6	3.1e-26
WP_005596659.1|591944_592304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080550254.1|592744_593089_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_005596661.1|593192_593795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005596662.1|593860_595009_+	hypothetical protein	NA	A0A1S5SAB0	Streptococcus_phage	28.5	8.3e-33
WP_080550253.1|595333_596008_+	DNA-binding protein	NA	A0A0M3LR56	Mannheimia_phage	44.7	4.4e-18
WP_005596666.1|596320_596674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043991789.1|596868_597219_+|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	67.3	1.2e-35
WP_080550258.1|597298_597655_+	lysozyme	NA	A0A068CDE9	Acinetobacter_phage	53.5	4.4e-25
WP_080550255.1|597647_598010_+	DUF2570 domain-containing protein	NA	A0A0M3LSP1	Mannheimia_phage	83.0	2.5e-15
WP_005596669.1|598467_598947_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	57.0	6.3e-43
WP_043991774.1|598946_601064_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	66.6	5.1e-270
WP_043991775.1|601060_601285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043991776.1|601284_602793_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	58.5	4.0e-160
WP_005596672.1|602824_604783_+|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	55.3	2.8e-198
WP_005596673.1|604856_605180_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	41.7	3.3e-11
WP_005596674.1|605172_605475_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_005596676.1|605477_606005_+|tail	tail protein	tail	Q8VNN3	Enterobacteria_phage	30.6	1.1e-08
WP_005596678.1|606001_606418_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_005596679.1|606417_606798_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_005596680.1|606867_607146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005596681.1|607323_610806_+|tail	phage tail tape measure protein	tail	A0A125RN77	Pseudomonas_phage	41.8	2.0e-37
WP_005609921.1|611617_612100_+	hypothetical protein	NA	A0A0N7MKP8	Acinetobacter_phage	29.1	1.1e-18
WP_125121632.1|612099_612507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005596685.1|612508_614551_+	hypothetical protein	NA	A0A0P1KL86	Acinetobacter_phage	28.1	6.2e-63
617708:617739	attR	AAACCAAAATTAGTTCACTTAGACTTCAAACG	NA	NA	NA	NA
>prophage 3
NZ_CP030753	Actinobacillus pleuropneumoniae strain S4074 chromosome, complete genome	2318657	1057069	1091311	2318657	transposase,tail,integrase	Pseudomonas_phage(68.97%)	43	1055781:1055797	1091485:1091501
1055781:1055797	attL	TTACAAAATATGAAAAA	NA	NA	NA	NA
WP_005597454.1|1057069_1057546_-	hypothetical protein	NA	A0A0M5MXL4	Ralstonia_phage	38.0	2.6e-12
WP_005597456.1|1057591_1057753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005597458.1|1057749_1057962_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005597460.1|1057958_1058483_-	host-nuclease inhibitor protein Gam	NA	F6MIJ0	Haemophilus_phage	49.4	1.4e-40
WP_005597463.1|1058475_1058724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005597467.1|1058716_1059889_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	55.3	3.8e-110
WP_005597469.1|1059911_1061714_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	J9SGQ3	Pseudomonas_phage	40.1	4.2e-116
WP_005597471.1|1061724_1062711_-	hypothetical protein	NA	J9SND0	Pseudomonas_phage	27.4	1.9e-22
WP_005597473.1|1062721_1063024_-	helix-turn-helix domain-containing protein	NA	A0A0S4L7B4	Pseudomonas_phage	44.0	5.6e-13
WP_005597478.1|1063248_1063443_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_005597479.1|1063539_1063992_+	helix-turn-helix domain-containing protein	NA	A0A1S5NPU3	Burkholderia_phage	30.8	3.1e-07
WP_005597482.1|1063992_1064412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005601429.1|1064433_1064952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005597484.1|1064987_1066025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005597487.1|1066021_1066477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005597489.1|1066598_1066853_-	hypothetical protein	NA	B7SDP6	Haemophilus_phage	51.9	7.4e-19
WP_005597491.1|1067068_1067443_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	52.2	3.7e-22
WP_005597492.1|1067445_1068054_+	transglycosylase SLT domain-containing protein	NA	J9SH25	Pseudomonas_phage	61.2	4.2e-60
WP_005597494.1|1068248_1068479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005619736.1|1068581_1068932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005597499.1|1068933_1069239_+	hypothetical protein	NA	Q5ZQY7	Pseudomonas_phage	51.0	5.1e-22
WP_005597501.1|1069248_1069788_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	52.2	3.1e-46
WP_043991822.1|1069787_1071407_+	hypothetical protein	NA	Q6QIC1	Burkholderia_phage	64.2	6.8e-182
WP_005597506.1|1071409_1072921_+	DUF935 family protein	NA	Q5ZQY4	Pseudomonas_phage	52.7	2.2e-142
WP_005597508.1|1072913_1074164_+	hypothetical protein	NA	J9STS2	Pseudomonas_phage	46.6	8.0e-106
WP_005597511.1|1074270_1074762_+	phage virion morphogenesis protein	NA	Q5ZQY1	Pseudomonas_phage	38.4	2.8e-30
WP_005597513.1|1074985_1076002_+	peptidase	NA	Q5ZQY0	Pseudomonas_phage	61.2	3.0e-42
WP_005597515.1|1075998_1076367_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_005597517.1|1076417_1077344_+	hypothetical protein	NA	A0A0S4L2T7	Pseudomonas_phage	63.6	1.4e-107
WP_005597519.1|1077352_1077862_+	DUF1320 domain-containing protein	NA	Q5ZQX5	Pseudomonas_phage	41.8	1.7e-30
WP_005597521.1|1077854_1078307_+	hypothetical protein	NA	J9SH57	Pseudomonas_phage	33.3	5.8e-14
WP_005597522.1|1078303_1078561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005597524.1|1078560_1079304_+	hypothetical protein	NA	A0A2D1GNQ7	Pseudomonas_phage	49.4	2.3e-60
WP_005597527.1|1079350_1079758_+	hypothetical protein	NA	A0A2D1GNY5	Pseudomonas_phage	37.6	6.3e-20
WP_005597533.1|1079959_1080172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005597535.1|1080183_1083543_+	tape measure protein	NA	A0A2D1GNK1	Pseudomonas_phage	31.6	1.1e-106
WP_005597537.1|1083545_1084544_+	hypothetical protein	NA	A0A2D1GMZ0	Marinobacter_phage	28.1	4.7e-24
WP_005597539.1|1084546_1085512_+	hypothetical protein	NA	A0A0U2KZ01	Pseudomonas_phage	27.5	2.3e-20
WP_005597541.1|1085511_1087194_+	hypothetical protein	NA	A0A2D1GNY4	Pseudomonas_phage	38.3	5.1e-63
WP_005597543.1|1087238_1088048_+	DUF2163 domain-containing protein	NA	A0A2D1GNT2	Pseudomonas_phage	50.5	3.6e-75
WP_005597545.1|1088065_1088317_+	hypothetical protein	NA	A0A2D1GNV4	Pseudomonas_phage	64.5	2.0e-24
WP_005597546.1|1088321_1088525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005597548.1|1088524_1091311_+|tail	phage tail protein	tail	A0A2D1GNP9	Pseudomonas_phage	45.9	1.7e-177
1091485:1091501	attR	TTACAAAATATGAAAAA	NA	NA	NA	NA
>prophage 4
NZ_CP030753	Actinobacillus pleuropneumoniae strain S4074 chromosome, complete genome	2318657	1328083	1337195	2318657		uncultured_Caudovirales_phage(16.67%)	9	NA	NA
WP_005597987.1|1328083_1328716_+	repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	48.5	1.2e-09
WP_005597989.1|1328775_1329456_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_005597990.1|1329541_1330273_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	48.0	3.6e-42
WP_043993299.1|1330387_1331425_+	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	42.9	6.8e-18
WP_005597991.1|1331505_1332681_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2P1ELP3	Moumouvirus	32.1	2.3e-14
WP_005597992.1|1332888_1334199_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	59.4	1.2e-131
WP_005597993.1|1334274_1334904_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_005597994.1|1334917_1335328_+	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_005597995.1|1335386_1337195_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.7	2.1e-86
>prophage 5
NZ_CP030753	Actinobacillus pleuropneumoniae strain S4074 chromosome, complete genome	2318657	1667548	1673002	2318657		Enterobacteria_phage(50.0%)	7	NA	NA
WP_043991890.1|1667548_1668286_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	27.6	2.7e-13
WP_005598692.1|1668293_1669079_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005598689.1|1669091_1669634_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.2	4.7e-55
WP_005598688.1|1669633_1670509_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.9	1.2e-42
WP_005598687.1|1670508_1671387_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.3	1.2e-108
WP_005598686.1|1671427_1672489_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.2	2.2e-104
WP_005598685.1|1672660_1673002_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	49.5	5.5e-25
