The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030106	Acinetobacter baumannii strain DA33382 chromosome, complete genome	3947407	122295	136881	3947407		Acinetobacter_phage(50.0%)	25	NA	NA
WP_001038586.1|122295_122640_-	hypothetical protein	NA	A0A0P0IYD2	Acinetobacter_phage	78.8	7.4e-38
WP_000578498.1|122636_123146_-	hypothetical protein	NA	A0A0P0I8H3	Acinetobacter_phage	85.1	1.1e-32
WP_000609003.1|123142_123679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000464381.1|123671_123851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986116.1|123851_124142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000805204.1|124282_125311_-	ead/Ea22-like family protein	NA	A0A2I7QY11	Vibrio_phage	29.0	3.8e-13
WP_000645466.1|125323_126004_-	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
WP_000856471.1|126178_126550_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	40.0	6.4e-11
WP_001072361.1|126546_126876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000183423.1|126956_127295_-	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	39.3	1.6e-13
WP_000794429.1|127489_127774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001108434.1|127777_128542_-	S24 family peptidase	NA	A0A0P0I8E0	Acinetobacter_phage	63.0	1.6e-77
WP_000172739.1|128677_128881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818521.1|128916_129291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290739.1|129324_129525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200145.1|129521_129707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000575722.1|129703_130159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218440.1|130155_130794_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	39.9	9.0e-29
WP_000606802.1|130790_131765_+	phosphoadenosine phosphosulfate reductase family protein	NA	A4JX51	Burkholderia_virus	47.7	2.7e-77
WP_002029044.1|131770_132157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001055561.1|132153_133632_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	53.3	9.7e-135
WP_000124475.1|133635_134679_+	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	52.8	4.3e-28
WP_000994864.1|134675_135440_+	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	48.8	1.0e-63
WP_000991091.1|135436_135970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001136753.1|136425_136881_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	68.9	2.2e-53
>prophage 2
NZ_CP030106	Acinetobacter baumannii strain DA33382 chromosome, complete genome	3947407	273863	285533	3947407	capsid,terminase	Acinetobacter_phage(30.0%)	14	NA	NA
WP_001138417.1|273863_274322_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	46.6	2.0e-30
WP_001004672.1|274630_274975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113266.1|275722_276205_+	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	85.8	2.2e-67
WP_001086349.1|276182_277673_+|terminase	phage terminase large subunit	terminase	I3PGT7	Xanthomonas_phage	41.2	1.4e-88
WP_000852322.1|277681_279016_+	DUF1073 domain-containing protein	NA	M4SN90	Psychrobacter_phage	40.0	3.7e-85
WP_001273094.1|278960_279773_+|capsid	minor capsid protein	capsid	M4T3R2	Psychrobacter_phage	42.1	2.7e-54
WP_000032786.1|279852_280041_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001140766.1|280081_280714_+	hypothetical protein	NA	U5U717	Lactobacillus_phage	24.5	2.8e-06
WP_000653192.1|280767_281967_+	DUF2213 domain-containing protein	NA	A0A2I7R2U8	Vibrio_phage	28.5	2.0e-21
WP_000060043.1|281985_282456_+	hypothetical protein	NA	M4T3R5	Psychrobacter_phage	41.8	8.1e-19
WP_001990240.1|282459_282951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001990242.1|282947_283946_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_001068512.1|284006_284993_-	right-handed parallel beta-helix repeat-containing protein	NA	U5PSS0	Bacillus_phage	31.7	5.7e-14
WP_000433906.1|285143_285533_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	96.9	1.1e-64
>prophage 3
NZ_CP030106	Acinetobacter baumannii strain DA33382 chromosome, complete genome	3947407	1441950	1462858	3947407	tail,head,integrase	Acinetobacter_phage(42.11%)	39	1446818:1446833	1468777:1468792
WP_001250300.1|1441950_1444029_-	carbohydrate-binding protein	NA	A0A1B1IW99	uncultured_Mediterranean_phage	27.3	8.8e-33
WP_002039465.1|1444028_1444589_-	hypothetical protein	NA	A0A1B1IRI7	uncultured_Mediterranean_phage	37.4	9.0e-25
WP_000072947.1|1444654_1444825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001262752.1|1444900_1445800_-	hypothetical protein	NA	A0A1B1IRE8	uncultured_Mediterranean_phage	27.7	5.0e-17
WP_000931282.1|1445811_1446435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611266.1|1446427_1446913_-	hypothetical protein	NA	NA	NA	NA	NA
1446818:1446833	attL	TTCTTCCCAATCCTCA	NA	NA	NA	NA
WP_001293191.1|1446909_1448553_-|head,tail	head-tail connector protein	head,tail	A0A2H4J3N6	uncultured_Caudovirales_phage	44.6	7.3e-123
WP_000333834.1|1448554_1448785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000729216.1|1448784_1449108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000510483.1|1449381_1449585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070968.1|1449574_1449811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356496.1|1449807_1450131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204257.1|1450134_1450467_-	hypothetical protein	NA	E2GLW0	Acinetobacter_phage	44.7	2.0e-11
WP_001278405.1|1450459_1450645_-	hypothetical protein	NA	A0A0D4DCN1	Acinetobacter_phage	96.4	2.5e-24
WP_000066269.1|1450710_1450890_-	hypothetical protein	NA	A0A0D4DCD9	Acinetobacter_phage	83.1	1.0e-22
WP_000801897.1|1450882_1451263_-	hypothetical protein	NA	A0A068CDI0	Acinetobacter_phage	33.8	8.0e-09
WP_000826376.1|1451259_1451916_-	hypothetical protein	NA	A0A0N7IRF9	Acinetobacter_phage	93.1	1.2e-121
WP_001261846.1|1451912_1452317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223091.1|1452334_1452754_-	hypothetical protein	NA	H2DE79	Erwinia_phage	50.8	5.5e-27
WP_000754867.1|1452740_1453106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090108.1|1453954_1454827_-	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	39.3	6.7e-43
WP_000818542.1|1454866_1455202_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_001197739.1|1455210_1455393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000096815.1|1455504_1456188_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	39.2	6.9e-27
WP_001055215.1|1456205_1456697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001072331.1|1456891_1457083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001084983.1|1457082_1457280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000511577.1|1457279_1457600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000371048.1|1457592_1458348_+	hypothetical protein	NA	I2GUJ1	Acinetobacter_phage	53.5	1.8e-60
WP_001056652.1|1458344_1458731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000043905.1|1458730_1458958_+	hypothetical protein	NA	I2GUH8	Acinetobacter_phage	70.6	5.4e-21
WP_001102487.1|1458967_1459741_+	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	63.7	4.0e-55
WP_001023979.1|1459721_1460330_+	YqaJ viral recombinase family protein	NA	A0A2H4J882	uncultured_Caudovirales_phage	75.8	4.6e-83
WP_000998635.1|1460326_1460644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130791.1|1460654_1461035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783308.1|1461031_1461334_+	hypothetical protein	NA	A0A2I7QNA8	Vibrio_phage	35.7	7.8e-07
WP_001292264.1|1461330_1461516_+	hypothetical protein	NA	A0A1X9SFM6	Acinetobacter_phage	100.0	5.2e-30
WP_000512310.1|1461551_1461842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000775333.1|1461838_1462858_-|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	43.1	1.9e-68
1468777:1468792	attR	TGAGGATTGGGAAGAA	NA	NA	NA	NA
>prophage 4
NZ_CP030106	Acinetobacter baumannii strain DA33382 chromosome, complete genome	3947407	1517767	1551765	3947407	capsid,terminase,transposase	Acinetobacter_phage(100.0%)	42	NA	NA
WP_001197968.1|1517767_1517956_-	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	96.7	1.1e-27
WP_000079982.1|1518252_1518774_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000208716.1|1518940_1519495_-	lysozyme	NA	A0A068CDE9	Acinetobacter_phage	79.9	1.3e-79
WP_001083663.1|1519484_1519703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138204.1|1519699_1520056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598523.1|1520122_1523569_-	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	98.2	0.0e+00
WP_000835153.1|1523561_1523924_-	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	78.3	1.4e-50
WP_000368382.1|1523920_1524427_-	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	98.2	3.8e-91
WP_000277446.1|1524426_1524825_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	3.1e-72
WP_000991941.1|1524961_1525669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000959543.1|1525695_1526340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000134295.1|1526329_1527061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000046535.1|1527529_1531837_-	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	97.1	0.0e+00
WP_000106804.1|1531914_1532190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000722131.1|1532208_1532730_-	DUF4468 domain-containing protein	NA	A0A0P0I8L3	Acinetobacter_phage	67.8	7.8e-63
WP_000453244.1|1532816_1533053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065059.1|1533261_1534191_+	ORF6N domain-containing protein	NA	A0A0P0J0J7	Acinetobacter_phage	86.5	4.7e-87
WP_001258718.1|1534305_1535016_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_001185605.1|1535566_1536082_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	98.5	1.1e-72
WP_000094258.1|1536151_1537069_-	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	94.4	1.5e-162
WP_001285008.1|1537164_1538262_-	hypothetical protein	NA	A0A0N7IRE5	Acinetobacter_phage	41.0	7.1e-74
WP_000064569.1|1538261_1538612_-	hypothetical protein	NA	J7I469	Acinetobacter_phage	88.9	1.4e-52
WP_001277691.1|1538707_1538926_-	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	95.8	1.5e-31
WP_002040017.1|1538927_1539371_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	86.4	4.4e-67
WP_000539748.1|1539327_1539696_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	80.3	2.6e-52
WP_000247952.1|1539667_1540072_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	91.7	2.2e-65
WP_000524213.1|1540080_1540449_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	95.1	1.2e-62
WP_000008496.1|1540450_1540840_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	98.4	7.3e-66
WP_000692540.1|1540844_1541510_-	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	96.8	2.6e-111
WP_000214198.1|1541575_1542532_-	hypothetical protein	NA	A0A0D4DBM4	Acinetobacter_phage	97.5	4.8e-175
WP_000770049.1|1542559_1543327_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
WP_001139861.1|1543440_1543632_-	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
WP_000004363.1|1543849_1544092_-	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	100.0	3.6e-39
WP_001262455.1|1544190_1544469_-	hypothetical protein	NA	A0A0P0I8B5	Acinetobacter_phage	100.0	1.5e-44
WP_004746678.1|1544618_1545581_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_000179763.1|1545704_1546808_-|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	100.0	2.7e-206
WP_001286352.1|1546809_1548261_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	99.6	3.2e-284
WP_000102080.1|1548257_1549685_-|terminase	phage terminase large subunit	terminase	J7I460	Acinetobacter_phage	100.0	7.6e-270
WP_000212566.1|1549674_1550145_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
WP_000435252.1|1550203_1550845_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	98.1	6.7e-125
WP_000378508.1|1550813_1551248_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	100.0	3.4e-80
WP_001136767.1|1551309_1551765_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	98.0	1.0e-82
>prophage 5
NZ_CP030106	Acinetobacter baumannii strain DA33382 chromosome, complete genome	3947407	1555071	1680527	3947407	terminase,tail,capsid,integrase	Acinetobacter_phage(79.79%)	146	1563495:1563550	1660410:1660465
WP_001277128.1|1555071_1555548_-	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
WP_000206497.1|1555544_1555937_-	DUF559 domain-containing protein	NA	A0A1B1P9J0	Acinetobacter_phage	80.8	2.1e-52
WP_001123238.1|1555933_1556245_-	hypothetical protein	NA	A0A0D4DCM1	Acinetobacter_phage	95.1	1.1e-59
WP_000356498.1|1556235_1556685_-	hypothetical protein	NA	A0A0D4DBZ8	Acinetobacter_phage	64.1	3.4e-14
WP_001204257.1|1556688_1557021_-	hypothetical protein	NA	E2GLW0	Acinetobacter_phage	44.7	2.0e-11
WP_001278405.1|1557013_1557199_-	hypothetical protein	NA	A0A0D4DCN1	Acinetobacter_phage	96.4	2.5e-24
WP_000066269.1|1557264_1557444_-	hypothetical protein	NA	A0A0D4DCD9	Acinetobacter_phage	83.1	1.0e-22
WP_000801877.1|1557436_1557748_-	hypothetical protein	NA	A0A0P0I8J0	Acinetobacter_phage	73.1	1.8e-35
WP_001001967.1|1557744_1557921_-	hypothetical protein	NA	A0A0P0IRH7	Acinetobacter_phage	86.2	1.7e-17
WP_001068421.1|1557917_1558169_-	hypothetical protein	NA	A0A0P0IE39	Acinetobacter_phage	88.0	5.6e-35
WP_000106165.1|1558165_1559491_-	AAA family ATPase	NA	A0A0P0IVX0	Acinetobacter_phage	98.2	1.3e-247
WP_000200304.1|1559490_1560234_-	replication protein	NA	A0A0P0HSN8	Acinetobacter_phage	91.6	1.1e-46
WP_001070070.1|1560230_1560404_-	hypothetical protein	NA	A0A0P0J0G1	Acinetobacter_phage	96.5	1.8e-24
WP_000051088.1|1560600_1560867_-	hypothetical protein	NA	A0A1B1P9I3	Acinetobacter_phage	79.5	1.2e-32
WP_001068245.1|1560877_1561108_-	hypothetical protein	NA	A0A1B1P9I7	Acinetobacter_phage	100.0	1.6e-36
WP_000867174.1|1561232_1561979_+	helix-turn-helix domain-containing protein	NA	A0A1B1P9J5	Acinetobacter_phage	100.0	1.3e-140
WP_000418027.1|1561988_1562198_+	hypothetical protein	NA	A0A1B1P9G7	Acinetobacter_phage	98.5	2.5e-28
WP_000923284.1|1562343_1562853_+	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	36.5	1.3e-17
WP_000560785.1|1563281_1563497_-	hypothetical protein	NA	NA	NA	NA	NA
1563495:1563550	attL	CATAACAAACTCCATCCAACCCACCCCGTGTGGGTTTTCTTTTGTCTATTAAAGCA	NA	NA	NA	NA
WP_001021797.1|1563699_1564077_+	hypothetical protein	NA	A0A068CDD9	Acinetobacter_phage	38.3	7.7e-12
WP_000991217.1|1564096_1564363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453627.1|1564362_1564653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000993522.1|1564662_1565514_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	G8CLD3	Synechococcus_phage	31.6	9.5e-34
WP_001056663.1|1565516_1566413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000839.1|1566417_1566675_+	hypothetical protein	NA	K4HYN5	Acinetobacter_phage	77.5	3.6e-29
WP_000717852.1|1566671_1566935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000028947.1|1567283_1567493_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	94.2	3.7e-32
WP_001291999.1|1567489_1567705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123991.1|1567716_1567986_+	hypothetical protein	NA	A0A1B1P9G0	Acinetobacter_phage	100.0	4.7e-48
WP_000135937.1|1567982_1568969_-|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	97.9	2.9e-183
WP_000128669.1|1569266_1570202_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	8.3e-23
WP_001010536.1|1570198_1570972_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000110172.1|1570968_1571781_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A126HHM5	Vibrio_phage	37.2	5.0e-40
WP_001115740.1|1571804_1572455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000075224.1|1572583_1573726_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_000951088.1|1573745_1574747_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_170318972.1|1575085_1575655_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	45.5	1.9e-22
WP_000835608.1|1576210_1576663_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_000118659.1|1576703_1577021_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_001091858.1|1577022_1577739_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_000554500.1|1577833_1578658_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000182520.1|1578755_1579241_-	DUF3465 domain-containing protein	NA	NA	NA	NA	NA
WP_000125378.1|1579306_1580182_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_001982118.1|1580319_1581072_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_001089491.1|1581281_1582109_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000976525.1|1582313_1583432_+	OmpW family protein	NA	NA	NA	NA	NA
WP_000097626.1|1583841_1585188_+	MFS transporter	NA	NA	NA	NA	NA
WP_000169408.1|1585362_1586577_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137505.1|1586820_1588233_-	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_002000727.1|1588414_1589443_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_000576648.1|1589726_1592192_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000043121.1|1592295_1592679_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_001196998.1|1592717_1593254_-	peptidase C39	NA	NA	NA	NA	NA
WP_000994842.1|1593475_1594858_+	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	30.6	2.0e-41
WP_000167013.1|1594929_1595766_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_001078588.1|1595784_1596507_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000016038.1|1596641_1599491_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000342684.1|1599727_1601998_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_001198539.1|1602089_1603328_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.3	1.6e-90
WP_001254962.1|1603377_1604553_-	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	29.6	8.0e-07
WP_001284922.1|1604746_1605505_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_000208082.1|1605650_1606277_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_000464149.1|1606897_1607341_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000082790.1|1607350_1607551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830596.1|1607661_1609119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000205474.1|1609229_1610108_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_001231791.1|1610104_1610614_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000061267.1|1610739_1612155_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_000872627.1|1612889_1614431_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	99.4	5.7e-287
WP_000999140.1|1614427_1616230_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	97.5	0.0e+00
WP_002123268.1|1616717_1617914_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0D4DBR3	Acinetobacter_phage	99.7	9.7e-226
WP_000098296.1|1617910_1618105_-	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	100.0	3.8e-31
WP_071543439.1|1618496_1618814_-	anaerobic dehydrogenase	NA	E5KY21	Escherichia_phage	58.5	6.7e-25
WP_072292239.1|1618814_1619360_-	glycoside hydrolase family 108 protein	NA	A0A0D4DCJ5	Acinetobacter_phage	92.7	1.5e-93
WP_031974910.1|1619398_1619788_-	hypothetical protein	NA	J7I481	Acinetobacter_phage	84.5	4.3e-58
WP_113139251.1|1619874_1628430_-|tail	phage tail protein	tail	A0A0R6PIC9	Moraxella_phage	39.8	2.3e-10
WP_004644302.1|1628496_1629168_-|tail	tail assembly protein	tail	A0A0R6PIW1	Moraxella_phage	47.3	4.1e-40
WP_000778488.1|1629151_1629907_-	C40 family peptidase	NA	A0A0R6PIM4	Moraxella_phage	57.4	4.5e-88
WP_000175075.1|1629913_1630612_-|tail	phage minor tail protein L	tail	A0A0R6PIG8	Moraxella_phage	68.1	4.8e-92
WP_000985763.1|1630621_1630972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072292230.1|1631026_1631368_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_004644300.1|1631485_1635451_-	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	44.7	2.9e-165
WP_000720591.1|1635511_1635913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005070359.1|1635993_1636398_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	89.6	2.7e-63
WP_000838146.1|1636462_1636645_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
WP_001185622.1|1636976_1637510_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	59.9	6.3e-44
WP_032050731.1|1637553_1638483_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	40.6	4.0e-54
WP_000121166.1|1638590_1638803_-	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	75.4	1.3e-21
WP_001132270.1|1638804_1639203_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	71.2	4.0e-51
WP_072292231.1|1639204_1639573_-	hypothetical protein	NA	A0A0P0IDX0	Acinetobacter_phage	95.4	4.6e-54
WP_072292232.1|1639544_1639949_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	93.3	9.0e-67
WP_001197735.1|1639957_1640371_-	hypothetical protein	NA	J7I467	Acinetobacter_phage	76.6	5.6e-56
WP_000008492.1|1640327_1640717_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	98.4	9.5e-66
WP_000767881.1|1640721_1641387_-	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	67.4	5.2e-72
WP_000214195.1|1641451_1642408_-	Ig domain-containing protein	NA	A0A0D4DBM4	Acinetobacter_phage	93.7	5.6e-168
WP_000770051.1|1642435_1643203_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	97.3	7.3e-118
WP_000159880.1|1643316_1643631_-	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	48.5	3.4e-13
WP_072292233.1|1643699_1644212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072292234.1|1644403_1645507_-|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	93.5	9.6e-196
WP_113139252.1|1645513_1646959_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	98.8	1.1e-281
WP_072292261.1|1646955_1648383_-|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	89.3	1.2e-254
WP_000729373.1|1648372_1648843_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	89.7	2.6e-73
WP_000372127.1|1648900_1649542_-	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	97.2	4.4e-124
WP_072292262.1|1649510_1649978_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	76.1	6.3e-64
WP_000359988.1|1649967_1650141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001989822.1|1651411_1651642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214487.1|1651822_1652386_-	hypothetical protein	NA	A0A1B1P9I8	Acinetobacter_phage	52.5	3.2e-46
WP_001279874.1|1652407_1652692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000203140.1|1652701_1653109_-	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	51.8	4.0e-22
WP_001293626.1|1653105_1653507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039747.1|1653493_1653676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057221993.1|1653672_1654071_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	48.5	8.9e-27
WP_000017854.1|1654067_1654475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072292263.1|1654471_1655221_-	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	96.0	1.6e-133
WP_057222079.1|1655213_1656143_-	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	99.7	3.7e-172
WP_001267985.1|1656135_1656498_-	hypothetical protein	NA	A0A0D4DBI9	Acinetobacter_phage	99.1	2.4e-55
WP_001084139.1|1656494_1656791_-	hypothetical protein	NA	J7HXM0	Acinetobacter_phage	98.0	8.9e-48
WP_072292266.1|1656787_1657063_-	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	97.8	1.3e-40
WP_000041063.1|1657118_1657475_-	hypothetical protein	NA	J7I452	Acinetobacter_phage	98.3	8.8e-58
WP_000996060.1|1657484_1657736_-	hypothetical protein	NA	A0A0N7IRE1	Acinetobacter_phage	95.2	2.4e-38
WP_032007139.1|1657844_1658609_+	helix-turn-helix domain-containing protein	NA	A0A0P0J076	Acinetobacter_phage	95.3	1.5e-139
WP_032001490.1|1658623_1658839_+	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	95.7	3.9e-29
WP_017817034.1|1658940_1659804_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	51.1	7.1e-69
WP_032001491.1|1659862_1660075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032001492.1|1660061_1660337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072292264.1|1660607_1661048_+	hypothetical protein	NA	A0A0D4DBH9	Acinetobacter_phage	98.6	1.3e-74
1660410:1660465	attR	CATAACAAACTCCATCCAACCCACCCCGTGTGGGTTTTCTTTTGTCTATTAAAGCA	NA	NA	NA	NA
WP_000656410.1|1661047_1661338_+	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	99.0	1.6e-49
WP_032007137.1|1661330_1661654_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	97.2	1.7e-55
WP_032063646.1|1661665_1662787_+	ATP-binding protein	NA	A0A0N7IRE0	Acinetobacter_phage	99.7	2.0e-212
WP_000664312.1|1662783_1662990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072292265.1|1662994_1663954_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	82.1	5.7e-144
WP_004700232.1|1663992_1664202_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	3.3e-33
WP_038405739.1|1664205_1664613_+	hypothetical protein	NA	A0A0P0I8H3	Acinetobacter_phage	97.0	1.3e-12
WP_000004577.1|1664609_1665005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877062.1|1665001_1665337_+	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	62.4	3.7e-34
WP_000529848.1|1665337_1665607_+	hypothetical protein	NA	A0A0P0J067	Acinetobacter_phage	100.0	8.7e-42
WP_000566783.1|1665730_1666306_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	99.5	4.2e-110
WP_000960544.1|1666401_1669101_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	97.8	0.0e+00
WP_000281154.1|1669179_1671912_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	97.7	0.0e+00
WP_001982145.1|1672268_1673318_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000608308.1|1673327_1674134_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	99.6	1.8e-146
WP_000066126.1|1674143_1674839_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_001164227.1|1674849_1675833_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	99.4	1.0e-188
WP_001076820.1|1675839_1678215_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	98.9	0.0e+00
WP_000893691.1|1678216_1679716_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	96.6	2.3e-277
WP_001187844.1|1679978_1680527_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
>prophage 6
NZ_CP030106	Acinetobacter baumannii strain DA33382 chromosome, complete genome	3947407	2269892	2333499	3947407	head,integrase,terminase,tail,portal,holin,tRNA,plate,capsid	uncultured_Caudovirales_phage(28.57%)	72	2275423:2275438	2322040:2322055
WP_000986451.1|2269892_2271671_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	21.9	6.2e-19
WP_001251490.1|2271810_2272026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001985908.1|2272086_2272860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000598629.1|2272861_2273989_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.0	3.2e-29
WP_000721907.1|2274168_2274984_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_000909273.1|2275002_2275896_+	hypothetical protein	NA	NA	NA	NA	NA
2275423:2275438	attL	GAATTTCCATTGAAAT	NA	NA	NA	NA
WP_000706918.1|2275892_2276927_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_072292268.1|2276938_2277703_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_086225846.1|2277699_2278431_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000697427.1|2278451_2279480_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_000548427.1|2279502_2280393_-	mitochondrial fission ELM1 family protein	NA	NA	NA	NA	NA
WP_001046506.1|2280460_2281387_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_000990839.1|2281411_2284162_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_000194110.1|2284230_2285499_-	HAMP domain-containing histidine kinase	NA	B5LWN0	Feldmannia_species_virus	24.8	1.3e-07
WP_001284079.1|2286831_2287830_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	53.2	6.4e-98
WP_000289874.1|2287829_2289638_-|terminase	terminase	terminase	Q9ZXM5	Pseudomonas_virus	58.5	1.9e-201
WP_000748563.1|2289775_2290603_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	45.8	6.3e-59
WP_001243259.1|2290655_2291645_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	54.5	1.5e-94
WP_000950641.1|2291655_2292402_+|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	42.9	1.2e-37
WP_000015691.1|2292505_2292958_+|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	46.5	1.2e-24
WP_000659474.1|2292958_2293168_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	59.7	5.2e-18
WP_001114936.1|2293176_2293527_+	membrane protein	NA	NA	NA	NA	NA
WP_000571491.1|2293523_2293793_+|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	38.5	7.7e-06
WP_000600982.1|2293789_2294620_+	DUF3380 domain-containing protein	NA	A4JWU0	Burkholderia_virus	42.6	2.8e-46
WP_000742888.1|2294616_2295144_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	50.0	2.8e-36
WP_001059843.1|2295140_2295590_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	48.2	4.8e-29
WP_000990625.1|2295662_2296295_+|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	35.1	7.3e-23
WP_000987745.1|2296291_2296639_+	GPW/gp25 family protein	NA	A0A2H4JE52	uncultured_Caudovirales_phage	51.8	8.1e-24
WP_000109738.1|2296635_2297538_+|plate	baseplate J/gp47 family protein	plate	A0A0F7LCJ3	Escherichia_phage	48.5	6.0e-71
WP_001050805.1|2297537_2298143_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	38.2	1.1e-28
WP_000729646.1|2298154_2300107_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	42.9	2.9e-30
WP_000963361.1|2300256_2301432_+|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	68.3	1.4e-149
WP_001207612.1|2301444_2301963_+|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	58.5	6.1e-52
WP_001071615.1|2302029_2302371_+|tail	phage tail assembly protein	tail	E5E3U8	Burkholderia_phage	52.2	5.0e-18
WP_096903806.1|2302373_2302511_+|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	57.9	1.7e-06
WP_000774268.1|2302524_2304975_+|tail	phage tail tape measure protein	tail	A0A193GYN8	Enterobacter_phage	44.4	3.0e-104
WP_000979757.1|2304980_2305421_+|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	54.8	1.7e-39
WP_072292267.1|2305421_2306735_+	DNA primase	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	42.9	9.3e-97
WP_000113725.1|2306864_2307104_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000130085.1|2307100_2307301_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_000713873.1|2307616_2307898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000417952.1|2307897_2308776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000696053.1|2309085_2309280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001094886.1|2309387_2310203_+	Rha family transcriptional regulator	NA	A0A0K2CXT4	Paenibacillus_phage	52.1	5.9e-25
WP_000556351.1|2310327_2310543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786719.1|2310587_2310929_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001043481.1|2311021_2311213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002014340.1|2311306_2314045_+	toprim domain-containing protein	NA	A0A2H4JDT6	uncultured_Caudovirales_phage	62.2	0.0e+00
WP_000632296.1|2314041_2314374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001178668.1|2314439_2314991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001015076.1|2314980_2315151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049658.1|2315143_2315461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002014678.1|2315448_2315802_+	single-stranded DNA-binding protein	NA	M4SRQ0	Psychrobacter_phage	60.9	3.7e-32
WP_000125747.1|2315811_2316549_+	3'-5' exonuclease	NA	A0A0S0NDC6	Pseudomonas_phage	30.4	2.7e-21
WP_000424605.1|2316558_2316780_+	hypothetical protein	NA	A0A2H4J8L3	uncultured_Caudovirales_phage	38.2	2.0e-07
WP_000218943.1|2316776_2317073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000107854.1|2317100_2318168_-|integrase	site-specific integrase	integrase	A0A0A0YR56	Pseudomonas_phage	37.9	1.5e-44
WP_001177136.1|2318613_2319651_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001121110.1|2319804_2320833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000147160.1|2320919_2321489_+	LemA family protein	NA	NA	NA	NA	NA
WP_000667229.1|2321664_2322798_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.5	1.3e-94
2322040:2322055	attR	ATTTCAATGGAAATTC	NA	NA	NA	NA
WP_000051669.1|2322896_2323226_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_001270222.1|2323277_2325179_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_001985897.1|2325187_2326153_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.1	1.7e-31
WP_000006958.1|2326218_2327472_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.0	3.8e-39
WP_085920667.1|2327572_2328292_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000637023.1|2328353_2329265_+	bestrophin	NA	NA	NA	NA	NA
WP_001161539.1|2329272_2330124_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_000645707.1|2330168_2330783_+	septation protein IspZ	NA	NA	NA	NA	NA
WP_001115787.1|2330817_2331120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001175201.1|2331124_2331604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043524.1|2331627_2333499_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP030106	Acinetobacter baumannii strain DA33382 chromosome, complete genome	3947407	3100146	3153103	3947407	tRNA,integrase,transposase	Escherichia_phage(18.75%)	56	3103053:3103112	3155356:3156175
WP_000736404.1|3100146_3100857_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	9.1e-06
WP_000573062.1|3100858_3102769_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
3103053:3103112	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067858.1|3103115_3103820_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000143915.1|3104370_3105183_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_001262524.1|3105393_3105930_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000216752.1|3105932_3106865_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000907680.1|3106915_3108112_-	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_000908240.1|3108136_3109483_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_000942501.1|3109643_3109895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001278226.1|3109915_3111769_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_001991212.1|3111765_3112029_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_000608735.1|3112172_3113093_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	2.3e-33
WP_000011168.1|3113239_3114055_+	DsbC family protein	NA	NA	NA	NA	NA
WP_000805827.1|3114299_3115601_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_000063593.1|3115656_3116796_+	threonine synthase	NA	NA	NA	NA	NA
WP_001984577.1|3116904_3117951_-	D-alanyl-D-alanine endopeptidase PBP7/8	NA	NA	NA	NA	NA
WP_000633799.1|3118163_3118799_+	response regulator	NA	NA	NA	NA	NA
WP_001991214.1|3118854_3120378_+	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.5	4.7e-07
WP_000840548.1|3120402_3121824_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_000939109.1|3121827_3123012_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	23.0	8.3e-12
WP_000128749.1|3123027_3124575_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_000881094.1|3124700_3125771_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000586912.1|3125770_3126871_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000673449.1|3127014_3128463_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.4	5.5e-50
WP_001151590.1|3128455_3128863_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_001985629.1|3128901_3129540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354154.1|3129670_3129889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493866.1|3129947_3130607_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.6	1.5e-34
WP_001083669.1|3130649_3131942_-	DNA adenine methylase	NA	A0A0P0BWH0	Ostreococcus_mediterraneus_virus	32.6	2.5e-38
WP_001292523.1|3131938_3133024_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.3	3.3e-47
WP_000543541.1|3133039_3133498_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_000738515.1|3133656_3135054_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	7.0e-34
WP_000780326.1|3135111_3135450_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_000894500.1|3135729_3135957_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_000010453.1|3136022_3136880_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001144958.1|3136962_3138759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000492599.1|3139053_3140541_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	78.6	1.2e-217
WP_000137809.1|3140941_3142231_-|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	9.5e-86
WP_000021528.1|3142252_3142765_-	signal peptidase II	NA	NA	NA	NA	NA
WP_000041516.1|3142768_3143665_-	cation transporter	NA	NA	NA	NA	NA
WP_001219639.1|3143760_3144168_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000947164.1|3144289_3144553_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_000168107.1|3144609_3144993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001991400.1|3145055_3145205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170318974.1|3145198_3145648_-	recombinase family protein	NA	Q71TD8	Escherichia_phage	63.7	9.7e-38
WP_000862068.1|3145698_3146043_-	hypothetical protein	NA	A0A2I7S8K9	Vibrio_phage	41.4	2.0e-11
WP_000017328.1|3146039_3146327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|3146350_3146851_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|3146978_3147818_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3147811_3148159_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|3148322_3149114_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001102919.1|3149526_3150039_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002089484.1|3150157_3150622_-	aminoglycoside N-acetyltransferase AAC(3)-Ia	NA	NA	NA	NA	NA
WP_000845052.1|3150792_3151827_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	44.5	5.0e-69
WP_000454193.1|3151900_3152251_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|3152398_3153103_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
3155356:3156175	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCTACAGGAGTATATTCAGATTGATTAAATAGACGATGTCGAAGGCTGACTTTTTCAACTTGAATAAAACCACTGAACAGAGGTTCACGTGATGTTACTTCGACATCTTTAGATGTATAACTTGGACGCTCGACAATACTCATGATTCGATCAGGACGAAATCTATTTATTTCATCCTAACCGAGAATCATGGCTAGGCAAGTGTTTTTTTTGAATATTTACACTTTATGATACAGTTTCTGTCCTTGCTCTTGATAAACCTCTTTCATCGCTTTGAGGCCTTCTTCAACCTCTGAATCGCTATTGGTGAGATTGTTGGCATAGTCACGAACATTCTGGGTGATTTTCATCGAACAGAATTTTGGACCACACATTGAGCAAAAGTGAGCAGATTTATGCGCTTCTTTTGGTAAAGTCTCGTCATGCATGCTGCGTGCTGTATCTGGGTCTAGGCTTAGGTTGAACTGATCGTCCCAACGGAATTCGAAACGTGCTTTAGACAAGGCATTATCACGAACCTGTGCACCCGGATGACCTTTGGCAAGATCGGCTGCGTGTGCTGCAATCTTGTAGGTAATAATTCCGTCTTTTACATCTTTCTTGTTTGGCAAACCTAAATGTTCTTTAGGTGTCACATAGCAAAGCATTGCTGTGCCATACCAGCCGATCATGGCTGCACCAATAGCAGAAGTAATGTGGTCATAACCCGGAGCGATATCTGTGGTTAAAGGCCCAAGTGTATAGAATGGAGCTTCTTTACAC	NA	NA	NA	NA
