The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	0	6363	5300308		Vibrio_phage(66.67%)	6	NA	NA
WP_000202798.1|307_652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213371.1|984_2175_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	1.7e-20
WP_001234850.1|2202_2898_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578079.1|3047_4808_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494186.1|4932_5217_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|5355_6363_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 2
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	18061	18679	5300308		Bacillus_virus(100.0%)	1	NA	NA
WP_000888559.1|18061_18679_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 3
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	27445	33223	5300308		Bacillus_phage(25.0%)	5	NA	NA
WP_000422210.1|27445_29089_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	25.0	5.5e-14
WP_000884977.1|29164_29815_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786381.1|29814_30879_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	5.4e-18
WP_000406060.1|30952_32008_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865559.1|32119_33223_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.9	1.6e-118
>prophage 4
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	37500	42343	5300308		Hokovirus(50.0%)	2	NA	NA
WP_000876052.1|37500_40350_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.3	2.2e-42
WP_000559134.1|40516_42343_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	4.4e-20
>prophage 5
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	57266	69136	5300308		Pseudomonas_phage(40.0%)	6	NA	NA
WP_001281251.1|57266_59894_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
WP_000990765.1|60040_60763_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001220060.1|60823_64537_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	27.6	3.0e-23
WP_001075170.1|65232_67518_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332037.1|67751_68882_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_000135039.1|68881_69136_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	74.6	1.5e-24
>prophage 6
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	73897	74974	5300308		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000779113.1|73897_74974_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.9e-08
>prophage 7
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	80866	85376	5300308	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_000140599.1|80866_81826_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.4	6.0e-69
WP_000150335.1|81838_82036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992992.1|82076_82880_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001240423.1|82896_84123_-	MFS transporter	NA	NA	NA	NA	NA
WP_001310055.1|84167_85376_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	1.1e-208
>prophage 8
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	88451	93455	5300308		Tupanvirus(50.0%)	4	NA	NA
WP_001306469.1|88451_89054_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
WP_019842024.1|89361_90501_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.8	1.1e-29
WP_000461642.1|90504_91473_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	4.0e-36
WP_000860278.1|91472_93455_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	3.1e-19
>prophage 9
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	128205	131433	5300308		Salmonella_phage(50.0%)	3	NA	NA
WP_000813860.1|128205_128805_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012889.1|128863_130696_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203403.1|130782_131433_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	2.8e-09
>prophage 10
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	141992	143852	5300308		Sodalis_phage(50.0%)	2	NA	NA
WP_000156111.1|141992_142883_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.5	1.4e-67
WP_001293612.1|143078_143852_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 11
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	148063	149581	5300308		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|148063_149581_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 12
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	156057	157194	5300308		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699155.1|156057_157194_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.0e-22
>prophage 13
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	165750	166836	5300308		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|165750_166836_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 14
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	184902	185835	5300308		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|184902_185835_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 15
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	188874	190308	5300308		Bacillus_phage(100.0%)	1	NA	NA
WP_000194531.1|188874_190308_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.2	9.1e-29
>prophage 16
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	196962	204537	5300308		Hokovirus(50.0%)	4	NA	NA
WP_001323380.1|196962_200556_+	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	31.8	6.6e-36
WP_000183682.1|200610_201756_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|201829_202774_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283461.1|202842_204537_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.8	8.0e-24
>prophage 17
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	208227	209148	5300308		Morganella_phage(100.0%)	1	NA	NA
WP_000484395.1|208227_209148_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	6.4e-76
>prophage 18
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	212966	213701	5300308		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|212966_213701_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 19
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	235245	250627	5300308		Streptococcus_phage(33.33%)	15	NA	NA
WP_000443716.1|235245_237261_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	7.7e-151
WP_001306251.1|237331_238330_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|238559_239321_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|239505_240477_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|240860_241118_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|241162_242890_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|242930_243440_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096669.1|243481_244333_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719960.1|244437_244806_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001309637.1|244808_245720_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.6	2.9e-57
WP_000021036.1|245853_246951_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000141290.1|246940_247816_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458406.1|247815_248649_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290240.1|248648_249665_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000517444.1|249835_250627_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 20
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	254105	259040	5300308		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001322655.1|254105_255407_+	penicillin binding protein PBP4B	NA	A0A2K9VHZ2	Mycobacterium_phage	23.2	1.9e-09
WP_001309638.1|255464_256364_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838958.1|256459_257035_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001296281.1|257095_257545_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|257531_257957_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102892.1|258170_259040_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
>prophage 21
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	277993	278944	5300308		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|277993_278944_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 22
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	296211	296925	5300308		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|296211_296925_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 23
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	318192	322194	5300308		Enterobacteria_phage(33.33%)	4	NA	NA
WP_001309646.1|318192_319482_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	6.6e-63
WP_001295473.1|319567_320194_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|320518_321556_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028614.1|321555_322194_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 24
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	328441	335641	5300308	transposase	Escherichia_phage(57.14%)	8	NA	NA
WP_000017552.1|328441_328594_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|328611_328803_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_012602838.1|329113_329632_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	6.5e-62
WP_000755164.1|329647_330187_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	95.0	2.2e-44
WP_000526135.1|330334_330793_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_000138279.1|330990_332568_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001296289.1|332636_334103_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000937919.1|334264_335641_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	3.1e-42
>prophage 25
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	356109	356541	5300308		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|356109_356541_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 26
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	366693	373217	5300308		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133560.1|366693_367977_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	4.9e-34
WP_000523616.1|368221_368422_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124471.1|368433_368769_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196624.1|368770_370621_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.7	1.9e-103
WP_000384413.1|370637_371153_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|371248_371572_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|371588_371975_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|372002_373217_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 27
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	388351	389863	5300308		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493485.1|388351_389863_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 28
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	395755	407064	5300308		Bacillus_phage(50.0%)	7	NA	NA
WP_000919149.1|395755_397009_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	1.0e-100
WP_000883136.1|397337_398528_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|398572_398911_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|398971_400306_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215900.1|400295_401009_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001309666.1|401173_402601_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	2.3e-16
WP_000970165.1|403176_407064_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	1.7e-130
>prophage 29
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	411183	411444	5300308		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196285.1|411183_411444_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
>prophage 30
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	414903	418646	5300308		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|414903_415584_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|415856_416831_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|416846_418646_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 31
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	424417	432110	5300308	transposase,tRNA	Cafeteria_roenbergensis_virus(20.0%)	8	NA	NA
WP_000219193.1|424417_425752_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_100222095.1|425939_427287_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_001309673.1|427396_428278_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189223.1|428380_428968_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|429021_429405_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262720.1|429709_430399_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	3.5e-55
WP_000997418.1|430446_431484_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098717.1|431690_432110_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	37.5	8.3e-15
>prophage 32
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	437403	438702	5300308		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841107.1|437403_438702_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	1.6e-45
>prophage 33
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	444506	447080	5300308		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|444506_447080_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 34
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	452986	454057	5300308		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168043.1|452986_454057_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.4	5.3e-90
>prophage 35
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	467798	478346	5300308	integrase	Staphylococcus_phage(20.0%)	9	464638:464652	477937:477951
464638:464652	attL	ATAAAACCAGTTTAT	NA	NA	NA	NA
WP_000162574.1|467798_468281_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001125947.1|469024_470272_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.0	5.0e-140
WP_000203580.1|470273_470918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000362947.1|471267_472440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001287065.1|472891_473431_+	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	43.2	2.8e-31
WP_001305742.1|473639_474032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000857967.1|474366_474582_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001305743.1|474617_476687_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	1.7e-73
WP_000238828.1|477359_478346_+	MBL fold metallo-hydrolase	NA	Q332C0	Clostridium_botulinum_C_phage	23.1	3.4e-11
477937:477951	attR	ATAAAACCAGTTTAT	NA	NA	NA	NA
>prophage 36
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	497182	497785	5300308	integrase	Clostridioides_phage(100.0%)	1	487116:487130	506381:506395
487116:487130	attL	TATTCAAGAAAAAAC	NA	NA	NA	NA
WP_001305755.1|497182_497785_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	32.1	3.7e-08
WP_001305755.1|497182_497785_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	32.1	3.7e-08
506381:506395	attR	GTTTTTTCTTGAATA	NA	NA	NA	NA
>prophage 37
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	507515	508532	5300308	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001322394.1|507515_508532_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	1.1e-185
>prophage 38
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	512622	516747	5300308		Klosneuvirus(50.0%)	4	NA	NA
WP_113621708.1|512622_513903_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	1.2e-32
WP_001309688.1|514213_515614_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|515634_516297_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522413.1|516297_516747_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	38.2	7.5e-06
>prophage 39
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	522553	527851	5300308		Oenococcus_phage(25.0%)	4	NA	NA
WP_001223224.1|522553_522799_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.4e-06
WP_000080954.1|522795_523197_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.6e-18
WP_000246634.1|523178_525323_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	4.9e-196
WP_000985490.1|526648_527851_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 40
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	541195	546581	5300308	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|541195_541381_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047199.1|541615_544246_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140506.1|544373_544874_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|544942_546004_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|546083_546581_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 41
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	552048	553014	5300308		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|552048_553014_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 42
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	560427	561438	5300308		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001309690.1|560427_561438_-	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.3	1.7e-26
>prophage 43
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	579731	590641	5300308		uncultured_Mediterranean_phage(33.33%)	11	NA	NA
WP_001272891.1|579731_582293_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	2.7e-31
WP_001223109.1|582397_583261_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_001139307.1|583285_583942_+	protein-serine/threonine phosphatase	NA	Q71TJ1	Escherichia_phage	48.6	3.5e-52
WP_000562983.1|583983_584220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000863184.1|584230_585658_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_001237176.1|585657_586251_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_001208065.1|586397_586805_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000081550.1|586925_587918_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|587980_589120_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|589259_589886_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001305779.1|589879_590641_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 44
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	593753	595786	5300308		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|593753_594359_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090392.1|594358_595786_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	1.6e-30
>prophage 45
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	620309	621095	5300308		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021318.1|620309_621095_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	8.5e-21
>prophage 46
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	625751	626423	5300308		Vibrio_phage(100.0%)	1	NA	NA
WP_001199973.1|625751_626423_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 47
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	630238	633261	5300308		Streptococcus_phage(50.0%)	2	NA	NA
WP_000036723.1|630238_631537_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|631623_633261_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 48
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	636657	640772	5300308		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046780.1|636657_637959_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	5.7e-38
WP_000186450.1|638015_640772_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 49
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	648365	649214	5300308		Vibrio_phage(100.0%)	1	NA	NA
WP_000100441.1|648365_649214_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.7e-41
>prophage 50
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	654071	654827	5300308		Bacillus_phage(100.0%)	1	NA	NA
WP_001309702.1|654071_654827_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	3.8e-10
>prophage 51
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	666404	681952	5300308	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_001309703.1|666404_667610_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	6.6e-73
WP_000184262.1|667609_668053_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117726.1|668103_668910_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.9	1.7e-16
WP_000678646.1|669148_670246_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|670824_672078_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|672309_673641_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775991.1|673702_675529_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	5.9e-25
WP_001322794.1|675528_679071_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
WP_001141227.1|679063_681952_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	4.0e-68
>prophage 52
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	687429	694202	5300308		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|687429_688224_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|688230_689106_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957927.1|689256_691503_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|691515_692046_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082197.1|692730_693420_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|693488_694202_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 53
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	703833	706328	5300308		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|703833_705252_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603526.1|705566_706328_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.5e-19
>prophage 54
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	738141	738894	5300308		Clostridium_phage(100.0%)	1	NA	NA
WP_001309712.1|738141_738894_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 55
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	763354	778746	5300308	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|763354_764755_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001377034.1|764772_766089_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|766124_767492_+	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838435.1|767527_768016_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001377035.1|768015_769935_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|770370_771819_+	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001050745.1|771820_771946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|771942_772014_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192806.1|772068_772617_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003071.1|772659_774177_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|774186_775285_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813190.1|775375_777109_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.4e-60
WP_000715210.1|777114_777825_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806652.1|777849_778746_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	3.9e-30
>prophage 56
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	782551	787024	5300308		Pandoravirus(50.0%)	2	NA	NA
WP_001513393.1|782551_783985_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.3	4.4e-31
WP_000195045.1|784150_787024_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.8e-263
>prophage 57
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	795160	796393	5300308		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|795160_796393_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 58
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	818510	819188	5300308		Bacillus_virus(100.0%)	1	NA	NA
WP_000956877.1|818510_819188_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.2	1.3e-09
>prophage 59
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	824890	919260	5300308	transposase,integrase,tRNA,protease	Stx2-converting_phage(26.09%)	92	908094:908109	918661:918676
WP_000646927.1|824890_825799_+	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	56.1	2.0e-53
WP_000098614.1|826192_828184_-	transketolase	NA	NA	NA	NA	NA
WP_001309720.1|828461_829220_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000442530.1|829305_830868_-	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
WP_000105566.1|831017_831938_-	agmatinase	NA	NA	NA	NA	NA
WP_113621710.1|832073_832826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|832949_834926_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|834934_835066_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|835201_835417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|835720_836875_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_000526135.1|837067_837526_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001112301.1|838022_839417_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|839493_839991_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|840085_840793_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|840872_841604_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|841616_842567_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|842675_843239_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|843238_843655_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001309723.1|843769_844750_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997806.1|844767_845472_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|845489_846056_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|846052_846343_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174736.1|846350_846944_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239946.1|846936_848073_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000784004.1|848385_849372_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577030.1|849416_849920_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378953.1|849919_851221_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745254.1|851276_852284_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394103.1|852400_853447_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984795.1|853622_854342_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|854525_854852_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|854851_855571_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001309725.1|855731_856784_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|856811_857087_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298916.1|857151_858231_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|858432_859689_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839789.1|859737_861873_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234514.1|862265_862973_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218749.1|863330_864509_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	52.8	1.7e-121
WP_000422741.1|864746_865172_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_136952279.1|865381_866595_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	100.0	2.2e-169
WP_000080195.1|866862_868476_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_102384962.1|869047_870275_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_001565116.1|870541_872200_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001565117.1|872359_872710_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023144100.1|873527_874577_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.6	2.5e-28
WP_001565120.1|874718_875474_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.4	3.1e-44
WP_001565122.1|876886_878488_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	36.2	4.8e-79
WP_001565124.1|878494_878875_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001539570.1|878861_879197_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_097330452.1|879983_880466_-	Dr family adhesin structural subunit	NA	NA	NA	NA	NA
WP_023144262.1|880662_880836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023144260.1|881218_881662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001565128.1|881677_884260_-	Dr fimbrial usher DraC	NA	NA	NA	NA	NA
WP_001565129.1|884299_885097_-	Dr fimbrial biogenesis chaperone DraB	NA	NA	NA	NA	NA
WP_001545784.1|885387_885693_-	adhesin biosynthesis transcription regulatory family protein	NA	NA	NA	NA	NA
WP_000700580.1|886612_886840_+	F1845 fimbrial adhesin operon transcriptional regulator DaaF	NA	NA	NA	NA	NA
WP_061307622.1|887101_888055_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	46.9	2.0e-56
WP_001565131.1|888186_888711_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	41.8	1.1e-08
WP_001167440.1|888821_889355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032144604.1|889632_889866_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_085949836.1|890112_891325_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_001013304.1|891577_891988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271012.1|891984_892368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221478.1|892535_893105_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001565135.1|893300_893495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077626136.1|894778_895039_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001170560.1|895124_895697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001330680.1|897190_898210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001069724.1|898319_899192_+	GTPase family protein	NA	NA	NA	NA	NA
WP_113621711.1|899514_902634_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001341130.1|902754_905271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581493.1|905347_905803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000099193.1|905922_907461_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.6	3.4e-292
WP_024173998.1|907509_907857_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	98.3	4.8e-61
WP_000839179.1|907853_908258_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
908094:908109	attL	GCGCCAGTACTGGCGC	NA	NA	NA	NA
WP_024173997.1|908343_908577_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_047938428.1|908676_909495_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	5.2e-45
WP_000849596.1|909549_910035_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001747787.1|910050_910527_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692347.1|910613_910835_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	2.5e-10
WP_001285612.1|910914_911283_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854720.1|911372_911750_+	toxin	NA	NA	NA	NA	NA
WP_000777672.1|911746_912235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839238.1|912246_912444_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001290180.1|912536_913403_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001143297.1|913474_913738_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000779482.1|913734_914061_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001218868.1|914524_915790_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.8	1.0e-76
WP_000147018.1|916045_917089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839179.1|918511_918916_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
918661:918676	attR	GCGCCAGTACTGGCGC	NA	NA	NA	NA
WP_000612626.1|918912_919260_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
>prophage 60
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	938754	940845	5300308		Acinetobacter_phage(100.0%)	1	NA	NA
WP_001223352.1|938754_940845_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
>prophage 61
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	946041	951676	5300308	protease	Stx2-converting_phage(33.33%)	4	NA	NA
WP_000624688.1|946041_946392_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_001309734.1|946388_946823_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000291745.1|947160_947742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034089.1|947788_951676_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	8.8e-228
>prophage 62
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	962056	963043	5300308		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000274668.1|962056_963043_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
>prophage 63
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	967608	975056	5300308	transposase	Stx2-converting_phage(50.0%)	6	NA	NA
WP_000376546.1|967608_969081_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.9e-06
WP_000629094.1|969129_970005_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_001149834.1|970038_970956_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000435657.1|971617_972043_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	5.2e-33
WP_000624647.1|972039_972390_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	61.2	2.7e-35
WP_000998107.1|973517_975056_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.8	3.6e-281
>prophage 64
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	989927	992925	5300308		Pseudomonas_phage(50.0%)	5	NA	NA
WP_001234555.1|989927_990749_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.9	1.6e-46
WP_001538139.1|991012_991486_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_001186761.1|991501_991978_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692315.1|992040_992262_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_000086757.1|992280_992925_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.6	6.1e-25
>prophage 65
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	998225	999209	5300308		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001296394.1|998225_999209_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	6.2e-37
>prophage 66
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1007742	1013842	5300308		Synechococcus_phage(40.0%)	5	NA	NA
WP_000600936.1|1007742_1009320_-	hypothetical protein	NA	B2ZYD9	Ralstonia_phage	28.7	1.8e-41
WP_001309753.1|1009316_1009688_-	capsular polysaccharide biosynthesis protein	NA	M4QRS4	Synechococcus_phage	44.7	7.1e-18
WP_000497656.1|1009668_1010415_-	hypothetical protein	NA	E3SJ89	Synechococcus_phage	29.3	5.1e-15
WP_000940928.1|1010452_1012942_-	acyltransferase	NA	E3T542	Cafeteria_roenbergensis_virus	25.9	2.0e-07
WP_000628300.1|1013161_1013842_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.4	1.1e-05
>prophage 67
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1051540	1052713	5300308		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524929.1|1051540_1052713_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	5.5e-40
>prophage 68
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1075035	1076488	5300308	transposase	Diadromus_pulchellus_ascovirus(50.0%)	2	NA	NA
WP_000018760.1|1075035_1075920_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
WP_000526135.1|1076029_1076488_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
>prophage 69
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1082707	1092058	5300308		Staphylococcus_phage(33.33%)	7	NA	NA
WP_000013149.1|1082707_1083535_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691628.1|1083734_1084661_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|1084711_1084969_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|1085011_1087231_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059388.1|1087341_1088754_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965722.1|1088828_1089566_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|1089799_1092058_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
>prophage 70
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1095368	1095761	5300308		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|1095368_1095761_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 71
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1099597	1107675	5300308		Bacillus_virus(25.0%)	8	NA	NA
WP_000195296.1|1099597_1101490_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|1101518_1102100_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|1102099_1102927_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|1102951_1103374_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|1103374_1104004_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735289.1|1104208_1105690_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|1105837_1106509_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|1106514_1107675_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
>prophage 72
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1113567	1114221	5300308		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001076993.1|1113567_1114221_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 73
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1118510	1119944	5300308		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869187.1|1118510_1119944_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	5.1e-40
>prophage 74
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1125081	1126320	5300308	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708487.1|1125081_1126320_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 75
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1132632	1148768	5300308	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264352.1|1132632_1133646_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|1133883_1134099_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|1134209_1135955_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|1136149_1137991_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|1138069_1138576_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001065878.1|1138829_1139594_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018005.1|1139870_1140494_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_000094732.1|1140598_1142119_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_001309772.1|1142536_1143916_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.2e-32
WP_000450587.1|1143957_1144290_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212457.1|1144508_1145492_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082832.1|1145675_1148768_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.3	6.9e-159
>prophage 76
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1161359	1162325	5300308		Escherichia_phage(100.0%)	1	NA	NA
WP_001098823.1|1161359_1162325_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	4.0e-36
>prophage 77
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1183119	1185414	5300308		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861703.1|1183119_1185414_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	40.8	3.7e-157
>prophage 78
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1193114	1194260	5300308		Streptococcus_phage(100.0%)	1	NA	NA
WP_001309778.1|1193114_1194260_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	42.0	4.0e-51
>prophage 79
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1211880	1219685	5300308		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809258.1|1211880_1212744_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
WP_000249133.1|1212808_1214845_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246847.1|1214802_1215198_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|1215217_1215808_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646049.1|1215817_1216393_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147607.1|1216514_1217555_-	permease	NA	NA	NA	NA	NA
WP_001309782.1|1217627_1218263_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|1218390_1218909_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449453.1|1218888_1219332_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189316.1|1219382_1219685_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 80
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1226715	1228617	5300308		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001306022.1|1226715_1228617_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 81
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1234093	1240732	5300308		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|1234093_1236766_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031055.1|1236790_1238278_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|1238305_1238758_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|1239388_1240732_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 82
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1245591	1248464	5300308	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|1245591_1246440_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|1246529_1248464_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 83
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1255092	1256569	5300308		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|1255092_1256064_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445406.1|1256290_1256569_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	3.4e-17
>prophage 84
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1260636	1275430	5300308		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|1260636_1261446_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922881.1|1261655_1262633_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001309787.1|1262646_1263633_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030006.1|1263653_1264220_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.5	6.5e-55
WP_000030537.1|1264216_1264792_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|1264760_1265318_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|1265324_1266050_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|1266097_1267531_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|1267553_1267841_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|1267958_1268450_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|1268495_1269350_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|1269346_1269619_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620398.1|1269831_1270464_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047073.1|1270460_1271189_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001300411.1|1271185_1271839_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|1272068_1274405_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299745.1|1274500_1275430_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 85
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1282180	1286928	5300308		Salmonella_phage(50.0%)	5	NA	NA
WP_000445164.1|1282180_1283308_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	8.1e-73
WP_000979886.1|1283367_1283832_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209040.1|1283828_1284704_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|1284700_1285390_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108458.1|1285437_1286928_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 86
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1290634	1291132	5300308	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366126.1|1290634_1291132_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 87
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1295098	1297623	5300308	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|1295098_1296466_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|1296555_1297623_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 88
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1314032	1315076	5300308		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|1314032_1315076_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 89
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1326396	1327281	5300308		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258950.1|1326396_1327281_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	9.2e-24
>prophage 90
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1333785	1337939	5300308		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738579.1|1333785_1334811_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
WP_000019643.1|1334878_1336060_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001309793.1|1336069_1337173_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078348.1|1337180_1337939_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	6.9e-20
>prophage 91
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1348275	1349747	5300308	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|1348275_1348785_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004443.1|1348799_1349747_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	30.1	1.4e-06
>prophage 92
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1369624	1375198	5300308		Tupanvirus(33.33%)	7	NA	NA
WP_000031783.1|1369624_1370809_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124703.1|1370879_1372994_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.7	1.1e-57
WP_001138043.1|1373090_1373561_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|1373657_1374032_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903377.1|1374157_1374445_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820718.1|1374452_1374812_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_001209690.1|1374811_1375198_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.1	3.3e-18
>prophage 93
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1380768	1390309	5300308		Tupanvirus(25.0%)	9	NA	NA
WP_000634840.1|1380768_1382682_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.7	4.3e-74
WP_000057395.1|1382681_1383704_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|1383697_1383916_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|1383969_1384839_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|1384893_1385298_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|1385599_1386232_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001309799.1|1386282_1388373_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	99.3	2.9e-76
WP_000190012.1|1388439_1389660_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601862.1|1389745_1390309_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	2.3e-60
>prophage 94
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1409218	1410055	5300308		Vibrio_phage(100.0%)	1	NA	NA
WP_000742137.1|1409218_1410055_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	3.7e-67
>prophage 95
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1413606	1414845	5300308		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000815963.1|1413606_1414845_-	DNA uptake porin HofQ	NA	A7BJY1	Enterobacteria_phage	24.4	1.2e-16
>prophage 96
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1426961	1430728	5300308		Bacillus_phage(66.67%)	3	NA	NA
WP_001309803.1|1426961_1428584_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	1.5e-141
WP_001253709.1|1428659_1430012_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|1430008_1430728_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 97
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1437309	1438203	5300308		Sodalis_phage(100.0%)	1	NA	NA
WP_000039101.1|1437309_1438203_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.4	5.6e-69
>prophage 98
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1444363	1446757	5300308		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081886.1|1444363_1446757_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 99
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1451147	1452374	5300308		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105467.1|1451147_1452374_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	59.8	3.4e-133
>prophage 100
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1465998	1468446	5300308		Dickeya_phage(100.0%)	1	NA	NA
WP_000993442.1|1465998_1468446_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 101
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1488457	1490268	5300308		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073586.1|1488457_1489201_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.9	9.9e-11
WP_000907805.1|1489197_1490268_-	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.3e-19
>prophage 102
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1493810	1495293	5300308		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|1493810_1494524_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|1494525_1495293_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 103
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1501028	1503847	5300308		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|1501028_1501883_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|1502127_1503186_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|1503178_1503847_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 104
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1506853	1511439	5300308		Dickeya_phage(50.0%)	5	NA	NA
WP_000964718.1|1506853_1507480_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106497.1|1507553_1509752_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.7	2.2e-119
WP_000385056.1|1509784_1510093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130620.1|1510307_1510553_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|1510773_1511439_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 105
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1534687	1535494	5300308		Bacillus_virus(100.0%)	1	NA	NA
WP_000173693.1|1534687_1535494_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	1.5e-17
>prophage 106
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1542912	1545648	5300308		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149141.1|1542912_1545648_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 107
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1559058	1561101	5300308		Indivirus(100.0%)	1	NA	NA
WP_001309824.1|1559058_1561101_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	4.0e-46
>prophage 108
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1564446	1568749	5300308		uncultured_Caudovirales_phage(100.0%)	5	NA	NA
WP_000008949.1|1564446_1564800_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.8e-23
WP_000855180.1|1564847_1565210_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_000670584.1|1565227_1566979_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_000922631.1|1567021_1568311_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_113621714.1|1568323_1568749_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.3	3.1e-49
>prophage 109
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1581828	1583298	5300308		Pithovirus(50.0%)	2	NA	NA
WP_000622315.1|1581828_1582599_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.0	1.7e-18
WP_001315061.1|1582650_1583298_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 110
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1608041	1609058	5300308	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001322394.1|1608041_1609058_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	1.1e-185
>prophage 111
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1633994	1635979	5300308		Bacillus_virus(50.0%)	2	NA	NA
WP_000103574.1|1633994_1634999_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196486.1|1634995_1635979_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 112
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1640347	1641696	5300308	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_100222095.1|1640347_1641696_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
>prophage 113
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1647304	1649638	5300308		Escherichia_phage(100.0%)	1	NA	NA
WP_000013999.1|1647304_1649638_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	3.5e-70
>prophage 114
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1653292	1653505	5300308		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|1653292_1653505_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 115
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1657734	1658730	5300308		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182662.1|1657734_1658730_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.8	1.6e-11
>prophage 116
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1664047	1665589	5300308		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146493.1|1664047_1665589_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.5e-16
>prophage 117
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1686947	1687560	5300308		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000499744.1|1686947_1687358_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	39.0	6.4e-20
WP_000833473.1|1687374_1687560_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	54.2	4.4e-13
>prophage 118
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1690917	1692762	5300308		Tupanvirus(100.0%)	1	NA	NA
WP_000582424.1|1690917_1692762_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
>prophage 119
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1712860	1727472	5300308	transposase	Bacillus_phage(14.29%)	14	NA	NA
WP_100190663.1|1712860_1714209_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	5.1e-74
WP_001277561.1|1714291_1715113_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001076190.1|1715192_1716212_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000003377.1|1716211_1716679_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_000024389.1|1716741_1716993_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.6e-16
WP_001156181.1|1717135_1717567_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|1717811_1719356_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214156.1|1719365_1720649_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483832.1|1720652_1721612_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982100.1|1721598_1722633_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646019.1|1722871_1723897_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213834.1|1723906_1725103_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000842829.1|1725378_1726236_-	protein YibB	NA	NA	NA	NA	NA
WP_000587750.1|1726539_1727472_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 120
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1739405	1743968	5300308		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171873.1|1739405_1739885_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
WP_001114533.1|1739923_1740733_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|1740830_1740998_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|1741018_1741255_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_110844059.1|1741471_1742140_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000050153.1|1742311_1743532_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	5.0e-44
WP_000976070.1|1743509_1743968_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
>prophage 121
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1747342	1754092	5300308		Morganella_phage(25.0%)	6	NA	NA
WP_001377125.1|1747342_1748167_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	78.1	6.5e-96
WP_000924289.1|1748457_1749075_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001309848.1|1749071_1750754_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.5	2.7e-24
WP_001295237.1|1751011_1751635_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|1751689_1751965_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|1751983_1754092_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 122
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1758392	1759784	5300308		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|1758392_1759784_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 123
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1790128	1793974	5300308	transposase	Moraxella_phage(50.0%)	3	NA	NA
WP_001513042.1|1790128_1791463_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
WP_001065715.1|1791637_1793404_+	adenine deaminase	NA	NA	NA	NA	NA
WP_000526135.1|1793515_1793974_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
>prophage 124
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1802872	1811893	5300308		Ostreococcus_lucimarinus_virus(25.0%)	10	NA	NA
WP_113621718.1|1802872_1804561_-	acetolactate synthase large subunit	NA	G9E4W7	Ostreococcus_lucimarinus_virus	28.4	4.5e-19
WP_001312198.1|1804666_1804765_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|1805329_1805419_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001306726.1|1805698_1806883_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	6.8e-14
WP_000148046.1|1806890_1807388_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|1807384_1807747_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|1807736_1808084_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511289.1|1808191_1808641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828500.1|1808687_1810181_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	26.2	2.7e-31
WP_001087144.1|1810177_1811893_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 125
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1818753	1819707	5300308		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|1818753_1819182_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|1819293_1819707_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 126
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1824134	1825283	5300308		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|1824134_1825283_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 127
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1829987	1837356	5300308		Bacillus_virus(33.33%)	8	NA	NA
WP_000072065.1|1829987_1832402_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|1832430_1833504_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|1833503_1834604_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|1834608_1836012_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_122134670.1|1836308_1836389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|1836618_1836759_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|1836775_1837135_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|1837098_1837356_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 128
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1847554	1848892	5300308		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|1847554_1848892_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 129
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1857888	1861730	5300308		Bacillus_phage(50.0%)	4	NA	NA
WP_000063125.1|1857888_1858662_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|1858752_1859643_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|1859642_1860602_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867161.1|1860689_1861730_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
>prophage 130
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1867264	1870626	5300308		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334086.1|1867264_1869094_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_000933736.1|1869255_1870626_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 131
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1882578	1883571	5300308		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845128.1|1882578_1883571_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	5.8e-51
>prophage 132
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1886739	1892592	5300308		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|1886739_1888608_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_000715936.1|1888774_1889194_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387761.1|1889201_1890707_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|1890711_1891677_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|1891701_1892592_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 133
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1905982	1907629	5300308		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012610.1|1905982_1907629_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	1.1e-65
>prophage 134
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1915225	1920639	5300308		Bacillus_phage(33.33%)	4	NA	NA
WP_001238867.1|1915225_1917247_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
WP_113621721.1|1917293_1918778_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047500.1|1918913_1920179_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|1920309_1920639_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 135
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1924681	1930825	5300308		Enterobacteria_phage(40.0%)	6	NA	NA
WP_001306792.1|1924681_1925812_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.9e-27
WP_000006621.1|1925808_1927071_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226594.1|1927070_1928138_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	5.1e-101
WP_000676063.1|1928156_1929038_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.0	1.5e-106
WP_001145170.1|1929015_1929690_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612044.1|1929694_1930825_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 136
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1938843	1940499	5300308		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395844.1|1938843_1940499_-	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.0e-44
>prophage 137
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1950847	1954706	5300308		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|1950847_1951744_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|1951743_1952460_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383420.1|1952543_1954706_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	1.3e-116
>prophage 138
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1961307	1963137	5300308		Catovirus(100.0%)	1	NA	NA
WP_001377144.1|1961307_1963137_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 139
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1975667	1978954	5300308		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187543.1|1975667_1977308_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
WP_001295260.1|1977386_1977656_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|1977659_1978175_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109944.1|1978177_1978954_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	6.6e-26
>prophage 140
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	1987743	1988358	5300308		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|1987743_1988358_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 141
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2002042	2004829	5300308		uncultured_virus(100.0%)	1	NA	NA
WP_000250024.1|2002042_2004829_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.2	3.4e-72
>prophage 142
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2008907	2011378	5300308		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001309874.1|2008907_2010317_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|2010328_2011378_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 143
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2016456	2017670	5300308	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085949589.1|2016456_2017670_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
>prophage 144
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2028795	2031575	5300308		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718901.1|2028795_2029692_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_000621642.1|2029859_2030756_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|2030789_2031575_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 145
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2040818	2043869	5300308		Escherichia_phage(100.0%)	1	NA	NA
WP_012602895.1|2040818_2043869_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 146
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2054781	2059641	5300308		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001297064.1|2054781_2055402_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001309889.1|2055679_2056645_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270252.1|2056793_2057468_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580422.1|2057572_2058946_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|2058942_2059641_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 147
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2071215	2072061	5300308		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000084268.1|2071215_2072061_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 148
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2075823	2077155	5300308		Erwinia_phage(100.0%)	1	NA	NA
WP_001293344.1|2075823_2077155_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 149
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2097198	2104445	5300308		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424838.1|2097198_2097861_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_001174088.1|2097872_2100374_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004446.1|2100682_2101762_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|2101776_2102097_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184828.1|2102147_2104445_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 150
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2121618	2123463	5300308		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591367.1|2121618_2123463_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 151
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2131805	2134858	5300308		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023085.1|2131805_2132756_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	1.1e-27
WP_000031784.1|2133673_2134858_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 152
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2138853	2147182	5300308		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|2138853_2142882_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|2142958_2147182_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 153
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2156399	2158163	5300308		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|2156399_2157071_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000941119.1|2157113_2157704_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|2157890_2158163_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 154
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2163525	2165115	5300308		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187551.1|2163525_2165115_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 155
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2181042	2184726	5300308		Dickeya_phage(100.0%)	1	NA	NA
WP_000096036.1|2181042_2184726_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	88.5	2.9e-26
>prophage 156
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2208211	2209327	5300308		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|2208211_2209327_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 157
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2218449	2219058	5300308		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|2218449_2219058_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 158
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2225625	2228173	5300308		Escherichia_phage(50.0%)	2	NA	NA
WP_000918364.1|2225625_2227041_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	1.1e-199
WP_001147321.1|2227093_2228173_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 159
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2232379	2235993	5300308		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|2232379_2235202_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|2235456_2235993_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 160
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2239987	2241337	5300308		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|2239987_2241337_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 161
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2247193	2249152	5300308		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078200.1|2247193_2249152_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.8	3.0e-91
>prophage 162
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2258661	2260809	5300308		Escherichia_phage(100.0%)	1	NA	NA
WP_012602899.1|2258661_2260809_-	formate dehydrogenase N subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 163
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2266054	2268040	5300308		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001309140.1|2266054_2268040_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	4.2e-149
>prophage 164
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2271913	2273463	5300308		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611434.1|2271913_2272594_-	phosphonate C-P lyase system protein PhnL	NA	F2Y302	Organic_Lake_phycodnavirus	29.1	6.0e-07
WP_001075518.1|2272704_2273463_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	4.7e-16
>prophage 165
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2279022	2279811	5300308		Pithovirus(100.0%)	1	NA	NA
WP_001193403.1|2279022_2279811_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	3.2e-12
>prophage 166
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2284650	2286153	5300308		Burkholderia_virus(100.0%)	1	NA	NA
WP_001298520.1|2284650_2286153_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 167
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2307361	2310573	5300308	tRNA	Catovirus(50.0%)	2	NA	NA
WP_000003806.1|2307361_2308879_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856848.1|2309115_2310573_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.1	2.6e-47
>prophage 168
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2324839	2326823	5300308		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|2324839_2325133_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|2325176_2326823_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 169
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2331026	2331560	5300308		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|2331026_2331560_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 170
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2336480	2337458	5300308		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|2336480_2337458_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 171
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2344886	2345432	5300308		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|2344886_2345432_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 172
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2349468	2418978	5300308	transposase,tRNA,protease	Vibrio_phage(23.08%)	67	NA	NA
WP_000990302.1|2349468_2350806_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122459.1|2350815_2352663_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_001280339.1|2352655_2353606_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051886.1|2353691_2354000_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|2354076_2355357_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|2355442_2356702_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|2356704_2357709_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|2357790_2357988_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|2358091_2359390_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|2359594_2360020_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076319.1|2360058_2362500_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
WP_001293282.1|2362590_2363322_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220120.1|2363448_2363850_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|2363868_2364567_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012564.1|2364617_2365277_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|2365294_2365693_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101676.1|2365702_2366341_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943963.1|2366343_2367507_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	8.3e-81
WP_001309151.1|2367590_2369216_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|2369332_2369608_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254644.1|2369756_2370086_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569688.1|2370267_2371017_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|2371013_2371769_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|2371876_2372941_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001323091.1|2373295_2374693_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218360.1|2374708_2375014_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776521.1|2375023_2375488_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056771.1|2375501_2376152_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949501.1|2376161_2377016_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170835.1|2377015_2377702_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492918.1|2377831_2378107_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216677.1|2378433_2378829_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|2378835_2379150_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|2379154_2379382_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|2379423_2379873_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001305664.1|2379943_2380738_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001526538.1|2381180_2381795_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	8.9e-42
WP_001309930.1|2381802_2382999_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.7	1.3e-206
WP_001119478.1|2383145_2383784_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|2384001_2384622_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228342.1|2384930_2386334_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000240846.1|2386467_2387631_+	DKNYY domain-containing protein	NA	NA	NA	NA	NA
WP_000936773.1|2387664_2389149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000331457.1|2389193_2389856_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000560581.1|2391037_2391898_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084623.1|2391985_2392366_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589436.1|2392494_2394438_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886909.1|2394627_2395368_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000175289.1|2395357_2395915_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|2396239_2396446_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|2396506_2397850_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001305659.1|2398172_2398811_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269337.1|2399016_2400750_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060914.1|2400746_2404526_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|2404528_2404870_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000055072.1|2405249_2405780_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|2406089_2407046_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205796.1|2407355_2408858_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	2.4e-11
WP_001296689.1|2408871_2409894_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|2409880_2410876_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|2410908_2411907_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219793.1|2412082_2413456_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|2413606_2414158_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|2414251_2415604_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232240.1|2415786_2416173_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106222.1|2416217_2416682_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	1.1e-52
WP_000187778.1|2416839_2418978_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 173
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2422616	2428713	5300308		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|2422616_2423564_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|2423748_2423802_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|2423942_2426639_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|2426844_2427231_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|2427303_2427765_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|2427777_2428713_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 174
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2436990	2446168	5300308	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_000416382.1|2436990_2439846_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|2439845_2440289_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|2440544_2442056_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|2442322_2443423_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|2443422_2444505_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294573.1|2444665_2446168_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.2	4.6e-84
>prophage 175
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2451294	2452314	5300308		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001309160.1|2451294_2452314_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.1e-44
>prophage 176
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2456871	2523608	5300308	transposase,holin	Stx2-converting_phage(30.77%)	58	NA	NA
WP_000483767.1|2456871_2458218_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000179691.1|2458826_2460044_+	MFS transporter	NA	NA	NA	NA	NA
WP_000611568.1|2460055_2461174_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000594405.1|2461216_2461342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000254999.1|2461394_2461652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948656.1|2461965_2463132_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
WP_000625671.1|2463067_2463481_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293436.1|2463543_2465541_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_001254932.1|2466597_2467749_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000177057.1|2469007_2469265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|2469821_2470589_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684852.1|2470589_2471546_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	8.2e-18
WP_000125187.1|2471542_2472541_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879155.1|2472537_2473440_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188283.1|2473484_2475809_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_001068910.1|2475895_2476849_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|2476845_2477367_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555337.1|2479117_2479375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823243.1|2480107_2481466_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000998017.1|2481704_2483090_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.5	6.9e-260
WP_000612591.1|2483139_2483487_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001282144.1|2483483_2483873_-	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	98.4	3.9e-67
WP_001221615.1|2484218_2484653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000270962.1|2484640_2485042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221515.1|2485301_2485871_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001322501.1|2487322_2487601_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000813451.1|2487695_2488298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297234.1|2488619_2490104_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001069674.1|2491334_2492207_+	GTPase family protein	NA	NA	NA	NA	NA
WP_113621722.1|2492576_2495696_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001323397.1|2495766_2495925_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234653.1|2496079_2496898_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	6.1e-46
WP_000855064.1|2497239_2497713_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	29.6	3.3e-12
WP_001186775.1|2497728_2498205_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|2498267_2498489_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001295723.1|2498651_2499020_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000132327.1|2499947_2501207_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_001022014.1|2501216_2502332_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_000439687.1|2502362_2503004_+	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000471147.1|2503107_2504112_+	multidrug DMT transporter permease	NA	NA	NA	NA	NA
WP_000373366.1|2504152_2505139_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001128363.1|2505485_2506835_-	GntP family permease	NA	NA	NA	NA	NA
WP_000116326.1|2506941_2508909_-	xylonate dehydratase YjhG	NA	NA	NA	NA	NA
WP_000714563.1|2508919_2509825_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_000251798.1|2509829_2510618_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000082780.1|2510920_2511703_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000600622.1|2511719_2512352_-	ribulose-phosphate 3 epimerase family protein	NA	NA	NA	NA	NA
WP_000606406.1|2512363_2512795_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000118626.1|2512925_2513732_-	BtpA family protein SgcQ	NA	NA	NA	NA	NA
WP_000460843.1|2513744_2515058_-	PTS system EIIC permease component	NA	NA	NA	NA	NA
WP_000722973.1|2515069_2515348_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000010829.1|2515344_2516466_-	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_000354251.1|2517251_2517998_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001309181.1|2518053_2518599_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001054376.1|2518610_2518868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001323209.1|2519859_2520846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322394.1|2520996_2522013_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	1.1e-185
WP_000991438.1|2522627_2523608_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.6	4.7e-101
>prophage 177
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2526970	2528647	5300308		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|2526970_2527573_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|2528050_2528647_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 178
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2538914	2540375	5300308		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208205.1|2538914_2540375_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	4.7e-49
>prophage 179
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2546943	2547498	5300308		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151855.1|2546943_2547498_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 180
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2555011	2555932	5300308	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181202.1|2555011_2555932_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	2.6e-61
>prophage 181
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2561730	2568075	5300308		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000213431.1|2561730_2568075_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.4	7.1e-49
>prophage 182
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2594187	2599552	5300308		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_000919543.1|2594187_2595852_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000091572.1|2597476_2598391_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106030.1|2598529_2599552_+	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 183
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2602779	2604059	5300308		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|2602779_2603517_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098815.1|2603519_2604059_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 184
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2612066	2614942	5300308		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175940.1|2612066_2613656_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|2614048_2614654_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|2614780_2614942_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 185
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2621079	2622402	5300308		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|2621079_2622402_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 186
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2629109	2630342	5300308		Enterococcus_phage(100.0%)	1	NA	NA
WP_000093813.1|2629109_2630342_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
>prophage 187
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2634618	2638434	5300308		Klosneuvirus(50.0%)	2	NA	NA
WP_000046749.1|2634618_2636286_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409419.1|2636496_2638434_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 188
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2641620	2643734	5300308		Bacillus_phage(50.0%)	2	NA	NA
WP_001188679.1|2641620_2642310_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219570.1|2642309_2643734_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.3	4.2e-10
>prophage 189
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2655502	2664570	5300308		Cyanophage(20.0%)	9	NA	NA
WP_000130187.1|2655502_2656456_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001094685.1|2656570_2657158_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|2657192_2657759_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102367.1|2657907_2658621_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843584.1|2658646_2659051_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|2659426_2661343_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|2661431_2662562_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000935262.1|2662665_2662875_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_000681360.1|2663403_2664570_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
>prophage 190
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2674055	2676872	5300308	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286869.1|2674055_2676872_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	4.6e-77
>prophage 191
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2681277	2682426	5300308		Halovirus(100.0%)	1	NA	NA
WP_001309937.1|2681277_2682426_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.8	1.7e-49
>prophage 192
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2688013	2693674	5300308		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001309938.1|2688013_2689567_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	1.2e-34
WP_000349928.1|2689640_2690858_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|2690986_2692129_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|2692159_2693674_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 193
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2701568	2702968	5300308		Bacillus_phage(50.0%)	2	NA	NA
WP_000624375.1|2701568_2702048_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000257178.1|2702125_2702968_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 194
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2712029	2717451	5300308		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|2712029_2714936_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035619.1|2715099_2717451_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.6	1.8e-37
>prophage 195
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2723899	2724598	5300308		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916278.1|2723899_2724598_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.1e-23
>prophage 196
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2737621	2739346	5300308		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425632.1|2737621_2739346_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	2.4e-36
>prophage 197
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2765316	2766360	5300308		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217337.1|2765316_2766360_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 198
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2770605	2771157	5300308		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923726.1|2770605_2771157_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 199
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2779667	2781092	5300308		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|2779667_2781092_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 200
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2788859	2795327	5300308		Mamastrovirus(33.33%)	5	NA	NA
WP_001189657.1|2788859_2790410_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001309217.1|2790456_2792847_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|2793052_2793589_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|2793629_2794292_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|2794400_2795327_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 201
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2798589	2799534	5300308	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000339900.1|2798589_2799534_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.8	1.3e-60
>prophage 202
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2809020	2815826	5300308	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174648.1|2809020_2810439_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_001309223.1|2810477_2811374_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|2811440_2811896_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396050.1|2812073_2812778_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294685.1|2812792_2813323_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001309224.1|2813396_2815826_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	31.4	2.7e-41
>prophage 203
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2820982	2821780	5300308		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|2820982_2821780_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 204
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2827691	2828036	5300308		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|2827691_2828036_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 205
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2831965	2833390	5300308	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|2831965_2833390_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 207
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2925564	2930923	5300308	transposase	Caulobacter_phage(33.33%)	6	NA	NA
WP_000284050.1|2925564_2926143_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|2926348_2927116_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|2927086_2927827_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000093873.1|2928127_2928877_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000006263.1|2929053_2929551_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_085949589.1|2929709_2930923_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
>prophage 208
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2944325	2947345	5300308		Hokovirus(50.0%)	2	NA	NA
WP_000859527.1|2944325_2944730_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	49.3	2.0e-29
WP_001143100.1|2944873_2947345_-	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	43.8	2.5e-34
>prophage 209
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2972374	2973514	5300308		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000521550.1|2972374_2973514_+	RNA ligase RtcB family protein	NA	A0A222ZKP1	Mycobacterium_phage	30.7	1.9e-29
>prophage 210
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2979012	2982724	5300308		Streptococcus_phage(66.67%)	3	NA	NA
WP_000749881.1|2979012_2980068_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|2980355_2981459_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893268.1|2981470_2982724_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	4.4e-96
>prophage 211
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	2988455	2993344	5300308	transposase	Acinetobacter_phage(50.0%)	3	NA	NA
WP_000667052.1|2988455_2990654_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	6.2e-37
WP_000643334.1|2990650_2991607_-	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_085949589.1|2992131_2993344_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
>prophage 212
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3010242	3011094	5300308		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001174448.1|3010242_3011094_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.5e-47
>prophage 213
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3017138	3020443	5300308		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001309281.1|3017138_3018008_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	1.2e-52
WP_001306921.1|3018167_3018761_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474078.1|3018772_3019009_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046306.1|3019117_3020443_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
>prophage 214
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3026018	3031938	5300308	holin	Catovirus(50.0%)	4	NA	NA
WP_001159140.1|3026018_3027689_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	3.1e-60
WP_000089106.1|3027702_3029175_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001376735.1|3029188_3029776_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|3029904_3031938_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 215
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3044615	3049153	5300308		Bacillus_virus(50.0%)	4	NA	NA
WP_000447328.1|3044615_3046100_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
WP_000818889.1|3046092_3047064_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750344.1|3047060_3048017_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000692764.1|3048103_3049153_+	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.0	3.2e-71
>prophage 216
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3058021	3059908	5300308		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010251.1|3058021_3059908_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	3.1e-53
>prophage 217
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3063473	3064373	5300308		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952477.1|3063473_3064373_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.2	2.1e-15
>prophage 218
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3068899	3073179	5300308		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_000177868.1|3068899_3071974_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.0	0.0e+00
WP_000805899.1|3072096_3073179_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.6	2.7e-190
>prophage 219
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3078589	3080550	5300308		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044321.1|3078589_3079540_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	1.9e-35
WP_001013499.1|3079536_3080550_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 220
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3083626	3084736	5300308		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|3083626_3084736_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 221
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3090028	3090796	5300308		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939335.1|3090028_3090796_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	4.3e-25
>prophage 222
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3097623	3098781	5300308		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830757.1|3097623_3098781_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 223
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3106372	3107488	5300308		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|3106372_3107488_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 224
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3111777	3121749	5300308		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|3111777_3112689_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219315.1|3112813_3113722_+	fructokinase	NA	NA	NA	NA	NA
WP_001323243.1|3113864_3115049_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698903.1|3115174_3118318_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221327.1|3118314_3119517_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|3119706_3120396_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893631.1|3120453_3121749_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
>prophage 225
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3130501	3139343	5300308	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|3130501_3131629_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|3131651_3131984_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|3132011_3133859_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|3133869_3134841_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|3134969_3135317_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|3135354_3136239_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001309302.1|3136537_3137077_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|3137227_3137677_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150417.1|3137680_3138784_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	1.3e-54
WP_001021161.1|3138872_3139343_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 226
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3162699	3167746	5300308	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|3162699_3163323_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|3163448_3164723_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|3164910_3167265_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|3167473_3167746_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 227
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3170874	3171570	5300308		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|3170874_3171570_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 228
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3174893	3178440	5300308		Bacillus_phage(100.0%)	2	NA	NA
WP_001235623.1|3174893_3176666_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-49
WP_001256201.1|3176658_3178440_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	2.3e-42
>prophage 229
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3187276	3190426	5300308		Leptospira_phage(100.0%)	1	NA	NA
WP_001132480.1|3187276_3190426_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 230
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3197264	3205722	5300308		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|3197264_3197816_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000121995.1|3197944_3199876_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|3199928_3200258_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195026.1|3200257_3200863_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|3200972_3202847_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|3203027_3203672_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250117.1|3203803_3204766_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801694.1|3204762_3205722_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.0	2.5e-14
>prophage 231
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3213997	3216502	5300308		uncultured_virus(100.0%)	1	NA	NA
WP_000083993.1|3213997_3216502_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.5	1.7e-115
>prophage 232
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3241574	3243737	5300308		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000739071.1|3241574_3243737_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.9	4.1e-17
>prophage 233
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3250208	3250886	5300308		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|3250208_3250886_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 234
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3254022	3254709	5300308		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|3254022_3254709_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 235
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3261508	3263290	5300308		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001309310.1|3261508_3263290_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
>prophage 236
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3266788	3271826	5300308	transposase	Escherichia_phage(50.0%)	4	NA	NA
WP_001322394.1|3266788_3267805_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	1.1e-185
WP_113621730.1|3267954_3269301_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|3269357_3270659_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001309311.1|3270680_3271826_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.4e-48
>prophage 237
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3283237	3352982	5300308	integrase,head,transposase,protease,terminase,portal,capsid,lysis,tail,tRNA	Enterobacteria_phage(50.0%)	81	3293389:3293435	3342064:3342110
WP_000912355.1|3283237_3284623_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	5.1e-45
WP_001143546.1|3284658_3285180_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|3285287_3285500_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729161.1|3285501_3286368_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|3286838_3287381_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988368.1|3287600_3288293_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001309312.1|3288323_3290933_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691065.1|3290945_3291953_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001309313.1|3291963_3292479_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805422.1|3292481_3293114_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
3293389:3293435	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001299447.1|3293448_3294612_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
WP_000488407.1|3294810_3295089_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|3295136_3295355_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_077252933.1|3295447_3295735_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.6e-47
WP_000548530.1|3295745_3295937_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149534.1|3295909_3296092_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	95.0	9.1e-27
WP_000952372.1|3296500_3297673_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	3.5e-228
WP_000544830.1|3297672_3298470_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
WP_174221462.1|3298463_3298904_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.2	4.7e-69
WP_000100847.1|3298900_3299686_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|3299691_3299988_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_162782380.1|3300063_3300354_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	83.8	5.0e-27
WP_001288169.1|3300752_3301685_-	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	54.4	2.8e-87
WP_000414677.1|3301681_3302155_-	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	61.6	1.3e-53
WP_000858975.1|3302236_3302926_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|3303030_3303261_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182772.1|3303330_3303870_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.5e-61
WP_000147900.1|3303866_3304886_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	8.8e-111
WP_000788915.1|3304882_3305584_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	97.9	9.3e-128
WP_000145913.1|3305580_3305883_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	96.8	2.7e-44
WP_000195116.1|3306131_3307634_-	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	53.7	3.8e-62
WP_000211451.1|3308446_3309055_+	hypothetical protein	NA	Q7Y5X0	Haemophilus_phage	42.1	6.3e-32
WP_001309958.1|3309548_3309800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309322.1|3309896_3309998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053016.1|3309994_3310450_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	68.2	2.2e-61
WP_000224914.1|3310449_3310620_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774491.1|3310612_3310903_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.7e-46
WP_001099522.1|3310899_3311262_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	5.6e-60
WP_000971055.1|3311258_3311399_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204780.1|3311484_3311868_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_113621731.1|3312057_3313140_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	79.8	7.8e-166
WP_000839596.1|3313713_3313929_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135256.1|3313928_3314426_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	95.2	5.6e-87
WP_000092273.1|3314422_3314890_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
WP_001139678.1|3314877_3315030_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000079510.1|3315381_3315792_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	9.8e-53
WP_001309326.1|3315849_3316083_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000453611.1|3316471_3317017_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001027256.1|3316991_3318917_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|3318913_3319120_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001309906.1|3319116_3320718_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.4e-309
WP_000123266.1|3320698_3322030_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.3	8.0e-229
WP_000201478.1|3322039_3322372_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_000118196.1|3322427_3323453_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	95.3	1.2e-184
WP_000160184.1|3323494_3323890_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	1.8e-56
WP_000752994.1|3323901_3324255_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975078.1|3324266_3324845_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
WP_000683122.1|3324841_3325237_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	3.2e-69
WP_001309909.1|3325244_3325985_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.8	2.5e-131
WP_000479145.1|3326000_3326423_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	9.1e-70
WP_000459479.1|3326404_3326839_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	2.2e-63
WP_000840287.1|3326831_3329387_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.0	0.0e+00
WP_000847366.1|3329383_3329713_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.6	2.6e-56
WP_001152511.1|3329712_3330411_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	1.2e-130
WP_000194783.1|3330416_3331160_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_000090891.1|3331096_3331729_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000515681.1|3331788_3335286_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	98.5	0.0e+00
WP_000290535.1|3335346_3337716_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	43.7	9.3e-87
WP_000654147.1|3337712_3337994_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	1.2e-17
WP_000235985.1|3338003_3338708_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.1	6.6e-57
WP_000355607.1|3338718_3339012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000386784.1|3339687_3340437_+	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_001201810.1|3340686_3341640_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177464.1|3342153_3342915_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3342064:3342110	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224568.1|3343097_3343988_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001322695.1|3343988_3346961_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383920.1|3346947_3349185_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000829608.1|3349732_3349903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000169380.1|3350122_3350551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001057457.1|3350578_3351025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000420757.1|3351845_3352982_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 238
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3361510	3362194	5300308		Bacillus_phage(100.0%)	1	NA	NA
WP_000770953.1|3361510_3362194_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 239
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3365339	3368483	5300308		Leptospira_phage(100.0%)	1	NA	NA
WP_000573896.1|3365339_3368483_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.3	2.2e-59
>prophage 240
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3379923	3385966	5300308		Tupanvirus(50.0%)	3	NA	NA
WP_000077747.1|3379923_3383805_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.2	4.9e-61
WP_000096759.1|3384020_3385139_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|3385150_3385966_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 241
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3400297	3402120	5300308		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502941.1|3400297_3400927_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029780.1|3400899_3402120_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.3	7.9e-58
>prophage 242
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3405228	3407343	5300308		Bacillus_virus(50.0%)	2	NA	NA
WP_001314555.1|3405228_3406794_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	1.3e-44
WP_000278505.1|3406914_3407343_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 243
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3421433	3422080	5300308		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|3421433_3421643_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939743.1|3421696_3422080_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	54.6	2.3e-24
>prophage 244
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3426895	3429335	5300308		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|3426895_3428107_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231428.1|3428246_3429335_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 245
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3436345	3438928	5300308	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001309340.1|3436345_3438928_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.1	1.3e-182
>prophage 246
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3445868	3449401	5300308		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367863.1|3445868_3447539_-	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.7	3.0e-76
WP_001207525.1|3447622_3448558_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|3448675_3449401_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 247
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3455284	3456325	5300308		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|3455284_3456325_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 248
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3460893	3462558	5300308		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|3460893_3462558_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 249
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3467324	3471138	5300308	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023116.1|3467324_3469271_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	9.2e-08
WP_001287164.1|3469473_3471138_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.9	0.0e+00
>prophage 250
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3475290	3476055	5300308		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773283.1|3475290_3476055_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 251
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3479261	3485242	5300308		Bacillus_phage(33.33%)	4	NA	NA
WP_000186111.1|3479261_3479939_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	7.6e-26
WP_001309343.1|3479935_3482620_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_001309344.1|3482612_3483185_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087926.1|3483193_3485242_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.7	2.7e-26
>prophage 252
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3489801	3492743	5300308		Hokovirus(50.0%)	2	NA	NA
WP_000207154.1|3489801_3491220_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	33.3	6.2e-62
WP_001032698.1|3491261_3492743_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 253
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3496121	3496913	5300308		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114002.1|3496121_3496913_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.9	4.4e-09
>prophage 254
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3541408	3544928	5300308		Vibrio_phage(33.33%)	4	NA	NA
WP_000345388.1|3541408_3542128_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.2	1.3e-20
WP_000951276.1|3542124_3543066_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	2.9e-23
WP_000784342.1|3543179_3543560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109183.1|3543875_3544928_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 255
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3549290	3555866	5300308		Tupanvirus(33.33%)	7	NA	NA
WP_001265443.1|3549290_3550307_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
WP_000096900.1|3550569_3552042_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	4.2e-13
WP_001147439.1|3552109_3552898_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|3553026_3553176_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000101994.1|3553342_3554116_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|3554115_3554805_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891696.1|3554807_3555866_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	2.0e-20
>prophage 256
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3566128	3567418	5300308		Klosneuvirus(100.0%)	1	NA	NA
WP_001309367.1|3566128_3567418_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 257
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3573854	3574763	5300308		Streptococcus_phage(100.0%)	1	NA	NA
WP_001305602.1|3573854_3574763_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	8.3e-28
>prophage 258
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3585036	3602001	5300308	transposase	Anomala_cuprea_entomopoxvirus(12.5%)	15	NA	NA
WP_001309369.1|3585036_3586773_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_000743444.1|3586765_3587761_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|3587763_3588435_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007147.1|3588663_3590028_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.6	3.3e-52
WP_001145139.1|3590263_3590746_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	53.1	7.5e-36
WP_001309370.1|3590865_3593016_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.0	6.3e-42
WP_000386513.1|3593043_3594006_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443544.1|3594146_3595232_+	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000849302.1|3595460_3595721_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146357.1|3595985_3596252_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000990140.1|3596325_3597003_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000526135.1|3599261_3599720_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_000547191.1|3599829_3601158_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_001467839.1|3601146_3601476_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_000710619.1|3601740_3602001_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 259
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3605685	3610910	5300308		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|3605685_3606408_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|3606404_3607064_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|3607202_3607949_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|3608352_3608856_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001446792.1|3609154_3610042_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|3610276_3610342_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|3610394_3610910_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 260
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3615906	3617502	5300308		Tupanvirus(100.0%)	1	NA	NA
WP_000961457.1|3615906_3617502_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	5.3e-62
>prophage 261
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3625103	3629234	5300308		Citrobacter_phage(50.0%)	3	NA	NA
WP_000209345.1|3625103_3627536_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001305949.1|3627541_3628441_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001305948.1|3628571_3629234_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	7.4e-26
>prophage 262
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3632449	3634321	5300308		Planktothrix_phage(100.0%)	1	NA	NA
WP_001309378.1|3632449_3634321_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 263
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3646610	3647813	5300308		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|3646610_3647813_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 264
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3656378	3665519	5300308		Vibrio_phage(25.0%)	11	NA	NA
WP_001195231.1|3656378_3656636_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201580.1|3656795_3657083_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189140.1|3657066_3657789_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|3657849_3658752_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|3658839_3659316_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126075.1|3659666_3660779_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|3660873_3662007_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105416.1|3662016_3662961_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061643.1|3662957_3663803_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|3663862_3664351_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149722.1|3664391_3665519_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.9	5.5e-29
>prophage 265
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3672126	3672855	5300308		Planktothrix_phage(100.0%)	1	NA	NA
WP_000027205.1|3672126_3672855_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 266
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3676535	3677366	5300308		Roseobacter_phage(100.0%)	1	NA	NA
WP_001255163.1|3676535_3677366_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	3.3e-07
>prophage 267
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3680953	3682672	5300308		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815359.1|3680953_3682672_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	3.1e-31
>prophage 268
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3691958	3716236	5300308	tRNA,protease	uncultured_Mediterranean_phage(16.67%)	17	NA	NA
WP_000188187.1|3691958_3693905_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|3693976_3694201_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|3694523_3694844_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|3694874_3697151_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_012602745.1|3697268_3697667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001040187.1|3698311_3698530_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|3698814_3699519_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202195.1|3699560_3701282_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	3.8e-21
WP_001043583.1|3701282_3703049_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_000537432.1|3703171_3704137_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|3704682_3705177_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077077.1|3705311_3709418_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|3709576_3710188_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|3710198_3711542_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|3711632_3712925_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850300.1|3713163_3715608_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|3715618_3716236_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 269
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3721075	3724290	5300308		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|3721075_3721816_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292809.1|3722007_3724290_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
>prophage 270
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3728388	3729477	5300308		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057148.1|3728388_3729477_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	4.5e-81
>prophage 271
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3734564	3739105	5300308		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|3734564_3734849_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705724.1|3735055_3737320_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551266.1|3737356_3739105_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
>prophage 272
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3753810	3766208	5300308	transposase,tRNA	Rhodobacter_phage(16.67%)	9	NA	NA
WP_001295932.1|3753810_3754359_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109449.1|3754385_3755033_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|3755083_3756274_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977917.1|3756458_3757547_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|3758149_3759550_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001305916.1|3759718_3760921_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193813.1|3761186_3763799_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	9.1e-19
WP_100222095.1|3763886_3765234_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_001090481.1|3765440_3766208_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	4.4e-30
>prophage 273
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3775109	3777017	5300308		Tupanvirus(100.0%)	1	NA	NA
WP_000053090.1|3775109_3777017_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 274
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3789615	3791670	5300308		Bacillus_phage(100.0%)	1	NA	NA
WP_001305911.1|3789615_3791670_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 275
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3795903	3796563	5300308	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|3795903_3796563_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 276
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3807557	3819812	5300308		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|3807557_3807770_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|3807780_3807969_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|3807943_3808174_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|3808163_3808337_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818458.1|3808385_3809459_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001054748.1|3809541_3812274_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	3.2e-38
WP_001264958.1|3812356_3813385_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120117.1|3813357_3814050_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001225229.1|3814179_3815352_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001063172.1|3815351_3817898_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	1.2e-71
WP_000209890.1|3817894_3818494_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|3818586_3818892_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420641.1|3818891_3819812_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
>prophage 277
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3824116	3826216	5300308		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|3824116_3824290_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001240634.1|3824378_3825701_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	1.8e-233
WP_001028095.1|3825721_3826216_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 278
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3843273	3844062	5300308		Cronobacter_phage(100.0%)	1	NA	NA
WP_000533533.1|3843273_3844062_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.0e-90
>prophage 279
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3848714	3849548	5300308		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|3848714_3849548_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 280
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3853683	3854217	5300308		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857411.1|3853683_3854217_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	39.7	6.6e-25
>prophage 281
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3863525	3870553	5300308	transposase	Morganella_phage(33.33%)	9	NA	NA
WP_000183364.1|3863525_3864446_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
WP_001305889.1|3864670_3865723_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_000749258.1|3865764_3866340_-	YceI family protein	NA	NA	NA	NA	NA
WP_000011118.1|3866343_3866910_-	cytochrome b	NA	NA	NA	NA	NA
WP_001322394.1|3867084_3868101_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	1.1e-185
WP_001253418.1|3868369_3868483_-	DUF2770 family protein	NA	NA	NA	NA	NA
WP_000872828.1|3868530_3869649_-	N-methyl-L-tryptophan oxidase	NA	NA	NA	NA	NA
WP_000414436.1|3869763_3870018_-	biofilm formation regulator BssS	NA	NA	NA	NA	NA
WP_001217754.1|3870307_3870553_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 282
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3886398	3887340	5300308		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001309406.1|3886398_3887340_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.5	1.1e-09
>prophage 283
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3900513	3907322	5300308	transposase	Trichoplusia_ni_ascovirus(20.0%)	8	NA	NA
WP_001008535.1|3900513_3901248_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|3901458_3901695_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_000044679.1|3901782_3903024_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_000526135.1|3903217_3903676_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_000478684.1|3903855_3904665_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_000756838.1|3904667_3905690_+	cell division protein YceG	NA	NA	NA	NA	NA
WP_001257002.1|3905679_3906321_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267922.1|3906317_3907322_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 284
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3919645	3919903	5300308		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|3919645_3919903_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 285
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3927192	3930915	5300308		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033695.1|3927192_3927894_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251363.1|3927893_3929138_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|3929166_3930078_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952755.1|3930093_3930915_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 286
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	3934357	4055699	5300308	integrase,holin,head,protease,terminase,portal,capsid,lysis,tail,tRNA	Enterobacteria_phage(40.34%)	165	3996780:3996819	4025923:4025962
WP_000074983.1|3934357_3935476_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|3935444_3935714_-	excisionase	NA	NA	NA	NA	NA
WP_000102155.1|3935775_3938232_-	exonuclease	NA	V5UQJ3	Shigella_phage	42.6	3.3e-103
WP_001093951.1|3938309_3938513_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450218.1|3938509_3938698_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000935596.1|3938708_3939563_-	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_000394557.1|3940093_3940468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379564.1|3940479_3940632_-	DUF1391 family protein	NA	NA	NA	NA	NA
WP_000787428.1|3940838_3941246_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912294.1|3941322_3941550_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705383.1|3941533_3942085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020541.1|3942056_3943097_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_001309414.1|3943008_3943551_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450706.1|3943584_3944355_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	1.1e-86
WP_001141099.1|3944370_3944763_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001266130.1|3944759_3945056_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209475.1|3945052_3945514_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_000403791.1|3945491_3945848_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
WP_000137947.1|3945943_3946351_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	60.4	6.1e-23
WP_001229301.1|3946352_3946718_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.9e-68
WP_000208092.1|3946714_3947701_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	41.5	1.8e-44
WP_000813254.1|3948259_3948415_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001309416.1|3948631_3948883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309417.1|3948949_3949228_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
WP_001265256.1|3949229_3950288_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.8e-90
WP_000140038.1|3950288_3950657_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.4e-34
WP_001064909.1|3950649_3951339_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	7.1e-56
WP_001309418.1|3951551_3951749_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	93.8	1.7e-26
WP_157835956.1|3951724_3951838_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000871291.1|3952118_3952454_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001309419.1|3952699_3952903_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	2.7e-27
WP_001309421.1|3952899_3953061_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	1.6e-14
WP_000284506.1|3953210_3953426_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001037013.1|3953430_3954321_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.9	1.2e-108
WP_001092866.1|3954357_3954891_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_001446668.1|3955047_3955230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280932.1|3955244_3955376_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_032142285.1|3955378_3955846_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
WP_000830178.1|3956156_3956483_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001322427.1|3956605_3956959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235436.1|3957441_3957951_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001309424.1|3957922_3959851_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.4e-261
WP_000258993.1|3959834_3960041_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001322425.1|3960037_3961630_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
WP_001253887.1|3961619_3963068_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	9.9e-100
WP_000256814.1|3963104_3963452_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
WP_000522603.1|3963509_3964538_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.4e-116
WP_000201530.1|3964589_3964964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204533.1|3964956_3965310_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000974996.1|3965325_3965859_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.6	2.5e-56
WP_000683079.1|3965855_3966251_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235048.1|3966258_3967008_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.8	2.7e-125
WP_001309426.1|3967026_3967458_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	7.4e-43
WP_000533401.1|3967484_3967898_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	4.6e-42
WP_000082417.1|3967878_3970440_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
WP_000847291.1|3970436_3970766_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001309428.1|3970765_3971464_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.6	3.2e-128
WP_000194723.1|3971474_3972218_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_122991350.1|3972163_3972796_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.7	1.2e-102
WP_000514742.1|3973139_3976832_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.7	0.0e+00
WP_001233148.1|3976899_3977499_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000216486.1|3977650_3980677_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
WP_000885577.1|3980676_3981261_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000240999.1|3981315_3981984_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937481.1|3982040_3982307_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
WP_000799406.1|3982538_3983402_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|3983385_3984522_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|3984771_3985998_+	peptidase T	NA	NA	NA	NA	NA
WP_001306875.1|3986046_3987168_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085269.1|3987416_3988646_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	1.1e-131
WP_000953274.1|3989011_3989200_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	1.5e-13
WP_072121152.1|3989252_3990677_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001403027.1|3990666_3990891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551751.1|3990883_3991249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|3991241_3991475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204964.1|3991467_3991701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|3991706_3992006_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833618.1|3992002_3993403_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	9.6e-116
WP_113621735.1|3993603_3993855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126681.1|3993851_3994274_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000796963.1|3994689_3994896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016240517.1|3994895_3995951_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.4	4.1e-71
WP_016240518.1|3995962_3996298_+|head	head decoration protein	head	NA	NA	NA	NA
WP_113621736.1|3996310_3996724_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
3996780:3996819	attL	GTTACGGGGCGGCGACCTCGCGGGTTTTCGCTATTTATGA	NA	NA	NA	NA
WP_016240520.1|3996886_3997327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133413.1|3997620_3997902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735421.1|3998455_3999916_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|3999915_4000587_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|4000755_4002126_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|4002129_4002771_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001295972.1|4002806_4003913_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476103.1|4003966_4004428_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248673.1|4004437_4005091_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|4005262_4006513_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741344.1|4006626_4007769_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	99.4	3.1e-205
WP_000088653.1|4007758_4007995_-	excisionase	NA	NA	NA	NA	NA
WP_000944300.1|4008134_4008374_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	92.4	9.7e-37
WP_000763387.1|4008421_4008640_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	1.7e-35
WP_001309430.1|4008738_4009020_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	8.7e-45
WP_000548521.1|4009030_4009222_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	95.2	1.2e-24
WP_000149538.1|4009194_4009377_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	3.7e-28
WP_000186715.1|4009373_4010054_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	4.6e-132
WP_000100848.1|4010050_4010836_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000995439.1|4010841_4011138_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372937.1|4011212_4011356_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|4011324_4011489_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065374.1|4011561_4011930_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001066174.1|4012190_4012772_+	super-infection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	99.5	3.4e-99
WP_000216183.1|4012788_4013097_-	hypothetical protein	NA	A0A075B8K6	Enterobacteria_phage	70.6	7.9e-31
WP_000971595.1|4013095_4013311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000076840.1|4013539_4014439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000250470.1|4014568_4015276_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	98.7	2.2e-132
WP_001180318.1|4015354_4015582_+	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438490.1|4015688_4015988_+	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	96.0	2.0e-47
WP_000185503.1|4016020_4016920_+	replication protein	NA	M1FN81	Enterobacteria_phage	100.0	1.7e-174
WP_000788877.1|4016916_4017618_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_000145931.1|4017614_4017905_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000736903.1|4017978_4018419_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000153280.1|4018415_4018943_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254223.1|4018939_4019116_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000386642.1|4019118_4019460_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	95.6	4.7e-61
WP_001099522.1|4019666_4020029_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	5.6e-60
WP_000971075.1|4020025_4020166_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204782.1|4020251_4020629_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	85.0	1.3e-54
WP_000780585.1|4020785_4021310_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	4.2e-48
WP_000592551.1|4021502_4022462_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_001112170.1|4022780_4023512_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000839583.1|4023679_4023895_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	94.4	4.5e-33
WP_000075162.1|4023894_4024392_+	lysozyme RrrD	NA	A5LH83	Enterobacteria_phage	98.8	4.9e-91
WP_001228695.1|4024608_4024791_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|4024881_4025175_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001322384.1|4025534_4025729_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	4.8e-26
WP_000453599.1|4026117_4026663_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	6.2e-95
4025923:4025962	attR	GTTACGGGGCGGCGACCTCGCGGGTTTTCGCTATTTATGA	NA	NA	NA	NA
WP_001027292.1|4026637_4028563_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
WP_000198149.1|4028559_4028766_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001309906.1|4028762_4030364_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.4e-309
WP_000123267.1|4030344_4031664_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_001513196.1|4031673_4032006_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063217.1|4032061_4033087_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	5.2e-188
WP_000158868.1|4033128_4033524_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752986.1|4033535_4033889_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	2.6e-62
WP_000985123.1|4033900_4034479_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	1.7e-79
WP_000683112.1|4034475_4034871_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.2e-70
WP_001309910.1|4034878_4035619_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	96.7	1.2e-128
WP_000479141.1|4035634_4036057_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	2.0e-69
WP_000459451.1|4036038_4036473_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.0e-63
WP_000840200.1|4036465_4039045_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	92.7	0.0e+00
WP_000847364.1|4039041_4039371_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.6	1.2e-56
WP_001152512.1|4039370_4040069_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	6.8e-131
WP_001309445.1|4040074_4040818_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	1.6e-149
WP_071592626.1|4040754_4041387_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.6	6.5e-96
WP_113621737.1|4041447_4044930_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
WP_000290537.1|4044988_4047010_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.5	3.8e-182
WP_000654172.1|4047006_4047285_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
WP_000355360.1|4047297_4047591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968127.1|4047682_4048540_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101732.1|4048536_4049394_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983716.1|4049390_4050218_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	29.0	7.6e-12
WP_000555630.1|4050217_4051132_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_001304451.1|4051831_4052590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000539892.1|4053061_4053214_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_001309448.1|4053316_4053640_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	63.6	1.3e-39
WP_032140204.1|4054179_4054290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|4054342_4054747_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332298.1|4054967_4055699_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
>prophage 287
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4062257	4063907	5300308		Escherichia_phage(100.0%)	1	NA	NA
WP_001322580.1|4062257_4063907_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.2	4.6e-85
>prophage 288
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4072416	4074104	5300308		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|4072416_4072836_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457634.1|4072835_4074104_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	82.9	2.5e-208
>prophage 289
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4092217	4092976	5300308		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000173317.1|4092217_4092976_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.8	5.2e-15
>prophage 290
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4108823	4111575	5300308		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033363.1|4108823_4110503_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	7.9e-24
WP_001298109.1|4110627_4111575_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 291
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4114710	4121514	5300308		Pseudomonas_phage(33.33%)	9	NA	NA
WP_000804726.1|4114710_4115793_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456458.1|4115792_4116626_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000151883.1|4116622_4117015_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|4117018_4117828_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|4117863_4118718_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_000170965.1|4118865_4118973_-	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_000170955.1|4119400_4119508_-	small toxic polypeptide LdrA/LdrC	NA	NA	NA	NA	NA
WP_001309461.1|4119913_4121014_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146444.1|4121283_4121514_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 292
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4132648	4231616	5300308	integrase,holin,head,transposase,protease,terminase,portal,capsid,lysis,tail	Escherichia_phage(31.67%)	107	4128573:4128589	4239717:4239733
4128573:4128589	attL	TTTAGTTACAACATACT	NA	NA	NA	NA
WP_000702660.1|4132648_4134187_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571707.1|4134183_4134894_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|4134893_4135571_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|4136653_4137496_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001310025.1|4137545_4138004_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|4138116_4139022_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|4139113_4140127_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|4140328_4141237_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000526135.1|4141435_4141894_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001287378.1|4142093_4142507_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|4143110_4143728_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
WP_000483767.1|4144014_4145361_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000301651.1|4145468_4148144_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000616773.1|4148620_4149268_+	NAAT family transporter YchE	NA	NA	NA	NA	NA
WP_001211514.1|4149425_4149722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000182039.1|4150005_4151637_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_000911112.1|4151722_4152643_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_000979661.1|4152657_4153566_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_000110945.1|4153577_4154591_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|4154587_4155592_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000366959.1|4155644_4155974_-	YciU family protein	NA	NA	NA	NA	NA
WP_000214516.1|4156008_4157469_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_001309467.1|4157611_4157785_+	YciY family protein	NA	NA	NA	NA	NA
WP_001306570.1|4157839_4159093_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_000967595.1|4159393_4159690_-	YciI family protein	NA	NA	NA	NA	NA
WP_000171276.1|4159913_4160633_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|4160672_4161071_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808667.1|4161175_4161715_-	septation protein A	NA	NA	NA	NA	NA
WP_000028546.1|4161744_4162488_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000737244.1|4162844_4163483_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000113674.1|4163528_4164659_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|4164636_4164885_-	excisionase	NA	NA	NA	NA	NA
WP_000048527.1|4164949_4167421_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	3.0e-56
WP_001090200.1|4167513_4167705_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449163.1|4167701_4167890_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001351093.1|4168289_4168727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001435739.1|4168704_4169025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021538048.1|4169036_4169189_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_000948451.1|4169507_4169984_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|4170108_4170432_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693916.1|4170415_4170841_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001348751.1|4170863_4171796_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	50.6	1.1e-70
WP_000788950.1|4171802_4172549_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_113621738.1|4172570_4173341_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	3.6e-80
WP_001151165.1|4173356_4173782_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.3	4.8e-63
WP_000150294.1|4173956_4174622_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|4174802_4175015_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|4175182_4175455_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265092.1|4175456_4176512_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_000140035.1|4176512_4176878_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	4.6e-38
WP_001064916.1|4176874_4177564_+	antiterminator	NA	I6PDF8	Cronobacter_phage	46.4	2.3e-54
WP_000917768.1|4177778_4177976_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_000935536.1|4178126_4179176_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
WP_000874512.1|4180449_4182303_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000284510.1|4182453_4182669_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|4182673_4183018_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|4182983_4183256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992072.1|4183361_4183895_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.4	2.4e-99
WP_001082539.1|4184193_4184661_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	90.3	9.1e-71
WP_000347013.1|4185011_4185152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|4185284_4185470_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_001102145.1|4186271_4186820_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.7	6.1e-58
WP_001348272.1|4186791_4188720_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	1.6e-262
WP_000259002.1|4188703_4188910_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001348271.1|4188906_4190499_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	6.5e-185
WP_001253935.1|4190488_4191994_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.6e-100
WP_000256835.1|4192030_4192378_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
WP_000522592.1|4192435_4193464_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
WP_001565314.1|4193515_4193899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204533.1|4193891_4194245_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000974994.1|4194260_4194836_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	3.7e-50
WP_000683079.1|4194832_4195228_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235037.1|4195235_4195982_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.4	8.7e-124
WP_001299690.1|4196000_4196432_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000533402.1|4196458_4196872_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082391.1|4196852_4199426_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
WP_000847298.1|4199422_4199752_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001348269.1|4199751_4200450_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.6	1.1e-128
WP_000194709.1|4200460_4201204_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	8.6e-148
WP_032300536.1|4201149_4201782_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_000514725.1|4202125_4205599_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.0	0.0e+00
WP_001228316.1|4205666_4206266_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	2.0e-107
WP_000216507.1|4206417_4209444_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	84.7	2.2e-48
WP_000885577.1|4209443_4210028_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000240999.1|4210082_4210751_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|4210807_4211077_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|4211191_4211362_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001348267.1|4211488_4212046_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_001296031.1|4212042_4212318_-	ash family protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_001079489.1|4212688_4213195_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|4213240_4213741_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|4213826_4214006_-	general stress protein	NA	NA	NA	NA	NA
WP_000443081.1|4214386_4215193_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209502.1|4215192_4216386_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983887.1|4216397_4217759_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	8.6e-37
WP_000763518.1|4217759_4219355_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.3e-52
WP_001194627.1|4219354_4220917_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|4221008_4221053_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_113621739.1|4221190_4222072_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|4222068_4222689_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001309470.1|4222716_4224612_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|4224822_4225698_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278887.1|4225737_4226328_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559257.1|4226324_4227083_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	9.7e-06
WP_000422053.1|4227302_4228352_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	3.5e-22
WP_001031530.1|4228387_4228639_-	YciN family protein	NA	NA	NA	NA	NA
WP_001309471.1|4229018_4231616_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	9.2e-88
4239717:4239733	attR	TTTAGTTACAACATACT	NA	NA	NA	NA
>prophage 293
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4236540	4237131	5300308		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|4236540_4237131_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 294
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4244944	4250629	5300308		Lactococcus_phage(50.0%)	5	NA	NA
WP_000485008.1|4244944_4246879_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	28.1	3.7e-33
WP_001306554.1|4246946_4248074_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506485.1|4248217_4249006_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000968855.1|4249389_4249755_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|4249822_4250629_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 295
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4263419	4264685	5300308		Klosneuvirus(100.0%)	1	NA	NA
WP_000069243.1|4263419_4264685_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	2.7e-24
>prophage 296
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4283061	4338289	5300308	integrase,lysis,tail,head	Salmonella_phage(42.86%)	94	4276010:4276026	4296231:4296247
4276010:4276026	attL	AATTGCAGCATTGGCTG	NA	NA	NA	NA
WP_000945046.1|4283061_4283577_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_023156659.1|4283795_4285031_+|integrase	site-specific integrase	integrase	I6R9B6	Salmonella_phage	45.6	4.4e-96
WP_001530058.1|4284988_4285207_-	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	44.3	7.1e-10
WP_113621741.1|4285206_4285869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001532285.1|4285884_4286061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021518993.1|4286060_4286492_-	recombination protein NinB	NA	A0A2I6PIF6	Escherichia_phage	53.5	3.5e-37
WP_001703302.1|4286488_4286686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021523504.1|4286898_4287426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113621743.1|4287504_4288926_-	AAA family ATPase	NA	A0A192Y673	Salmonella_phage	57.7	1.1e-140
WP_000083089.1|4288944_4290063_-	hypothetical protein	NA	A0A0A0YQN0	Citrobacter_virus	67.9	7.6e-148
WP_001229015.1|4290096_4291020_-	zinc-ribbon domain-containing protein	NA	A0A0F6R9A3	Escherichia_coli_O157_typing_phage	44.0	1.2e-50
WP_113621744.1|4291394_4292447_-	DUF4373 domain-containing protein	NA	M4M9J3	Vibrio_phage	40.6	1.3e-43
WP_000062369.1|4292450_4292708_-	MarR family transcriptional regulator	NA	A0A0P0ZC04	Stx2-converting_phage	40.0	8.1e-05
WP_001329602.1|4293013_4293661_+	helix-turn-helix domain-containing protein	NA	A0A286S2B2	Klebsiella_phage	50.9	2.4e-53
WP_000117287.1|4294160_4294451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021527776.1|4294600_4295242_+	ERF family protein	NA	I6RSN3	Salmonella_phage	53.3	3.1e-53
WP_021527777.1|4295241_4295661_+	single-stranded DNA-binding protein	NA	H9C0R6	Aeromonas_phage	48.5	4.5e-21
WP_001530081.1|4295677_4295956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113621745.1|4295968_4296220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021524098.1|4296456_4296729_+	hypothetical protein	NA	NA	NA	NA	NA
4296231:4296247	attR	AATTGCAGCATTGGCTG	NA	NA	NA	NA
WP_113621746.1|4296719_4296911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113621747.1|4296900_4297233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021549651.1|4297244_4297865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021519010.1|4297964_4298183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113621748.1|4298281_4298476_+	hypothetical protein	NA	H6WCL8	Enterobacteria_phage	95.3	7.9e-29
WP_023156555.1|4298465_4298669_+	hypothetical protein	NA	H6WCL9	Enterobacteria_phage	80.6	3.1e-28
WP_021524102.1|4298670_4298907_+	hypothetical protein	NA	H6WCM0	Enterobacteria_phage	55.1	2.0e-18
WP_021524103.1|4298911_4299145_+	hypothetical protein	NA	H6WCM1	Enterobacteria_phage	94.8	3.1e-35
WP_021527780.1|4299154_4299694_+	phage N-6-adenine-methyltransferase	NA	H6WCM2	Enterobacteria_phage	93.9	2.3e-102
WP_021527781.1|4299686_4300007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021523514.1|4299987_4300491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021537930.1|4300487_4301252_+	hypothetical protein	NA	S4TQH6	Salmonella_virus	60.7	7.9e-80
WP_113621749.1|4301602_4302208_+	recombination protein NinG	NA	G0ZNC4	Cronobacter_phage	53.1	2.5e-44
WP_113621750.1|4302204_4302606_+	RusA family crossover junction endodeoxyribonuclease	NA	F1C5C9	Cronobacter_phage	54.7	4.5e-34
WP_021527786.1|4302608_4302791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097514994.1|4302790_4303513_+	antitermination protein	NA	A0A0M4RTW7	Salmonella_phage	35.8	8.3e-39
WP_024241903.1|4303701_4303971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001703268.1|4303960_4304260_+	hypothetical protein	NA	I6S5Y4	Salmonella_phage	62.4	1.2e-23
WP_023278303.1|4304273_4304489_+	hypothetical protein	NA	C0LP33	Escherichia_virus	53.3	2.0e-09
WP_000841536.1|4304478_4304694_+	hypothetical protein	NA	A0A1P8DTK9	Salmonella_phage	51.4	8.2e-11
WP_023278305.1|4304698_4305064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023278306.1|4305054_4305285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024186754.1|4305295_4305529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042018428.1|4305525_4305753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021527795.1|4305757_4306006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042018426.1|4305968_4306220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021519023.1|4306219_4306444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113621751.1|4306665_4306923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113621752.1|4306934_4307174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113621753.1|4307176_4307392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113621754.1|4307494_4307773_+	hypothetical protein	NA	A0A023MHY3	Escherichia_phage	61.1	1.3e-24
WP_001703253.1|4307782_4307923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023278312.1|4307962_4308217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113621755.1|4308220_4308544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023278314.1|4308527_4308779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023278315.1|4308771_4308972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023278316.1|4308961_4309186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001703243.1|4309186_4309369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001703242.1|4309365_4309542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071834126.1|4309564_4309792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001530132.1|4309899_4310100_+	hypothetical protein	NA	A0A1V0E5H9	Salmonella_phage	49.0	3.3e-06
WP_170916099.1|4310103_4310592_+	glycoside hydrolase family protein	NA	A0A192Y6U3	Salmonella_phage	64.0	6.6e-56
WP_023278318.1|4310579_4311050_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_001532331.1|4311319_4311892_+	hypothetical protein	NA	C6ZR72	Salmonella_phage	45.7	3.3e-22
WP_021519037.1|4312733_4313249_+	hypothetical protein	NA	Q716H4	Shigella_phage	38.8	2.5e-21
WP_170925499.1|4313298_4314738_+	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	67.1	7.1e-191
WP_113621756.1|4314886_4316257_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	58.6	1.7e-146
WP_077881625.1|4316246_4317143_+|head	phage head morphogenesis protein	head	H6WRT1	Salmonella_phage	49.1	1.1e-72
WP_113621757.1|4317133_4318438_+	hypothetical protein	NA	A0A1V0E5Q9	Salmonella_phage	51.2	1.4e-108
WP_001530150.1|4318452_4318881_+	hypothetical protein	NA	I6S1Q2	Salmonella_phage	43.8	4.3e-19
WP_113621758.1|4318898_4319963_+	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	64.0	1.7e-133
WP_113621759.1|4320028_4320415_+	hypothetical protein	NA	Q5G8X8	Enterobacteria_phage	62.5	4.7e-41
WP_021519044.1|4320417_4320603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021519045.1|4320595_4320964_+	hypothetical protein	NA	Q5G8X6	Enterobacteria_phage	48.3	8.0e-30
WP_113621760.1|4320966_4321407_+	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	56.6	1.5e-38
WP_021519047.1|4321403_4321790_+	hypothetical protein	NA	Q5G8X4	Enterobacteria_phage	62.5	2.8e-41
WP_001532339.1|4321803_4322280_+	hypothetical protein	NA	H6WRU1	Salmonella_phage	64.2	1.0e-53
WP_001532340.1|4322335_4323034_+	hypothetical protein	NA	I6R0Q2	Salmonella_phage	41.5	4.6e-42
WP_000720275.1|4323026_4323401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824794.1|4323411_4324071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235992.1|4324198_4326541_+	tape measure protein	NA	A0A1V0E5N4	Salmonella_phage	31.0	8.1e-51
WP_000779577.1|4326627_4326882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001329613.1|4326899_4327055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001115389.1|4327226_4327580_+|tail	phage tail protein	tail	I6RSL7	Salmonella_phage	68.7	1.1e-39
WP_001532343.1|4327933_4328182_-	phage antirepressor KilAC domain-containing protein	NA	NA	NA	NA	NA
WP_113621761.1|4328191_4328539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001532347.1|4328519_4328708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001532349.1|4328837_4329542_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	71.7	5.9e-98
WP_001532350.1|4329544_4330276_+	C40 family peptidase	NA	Q5G8W2	Enterobacteria_phage	62.3	1.4e-89
WP_001532352.1|4330218_4330749_+|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	52.4	1.7e-36
WP_042068459.1|4330762_4335733_+	DUF1983 domain-containing protein	NA	I6R9B3	Salmonella_phage	41.3	2.0e-19
WP_000734009.1|4335772_4336018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113621762.1|4336215_4338012_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	57.2	2.8e-152
WP_000655968.1|4338022_4338289_+	hypothetical protein	NA	A0A023MI10	Escherichia_phage	56.8	1.0e-26
>prophage 297
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4344689	4351960	5300308	tRNA	Bacillus_phage(20.0%)	7	NA	NA
WP_001307164.1|4344689_4345922_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|4346176_4347160_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001296046.1|4347435_4347609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123708.1|4347638_4349012_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000081418.1|4349140_4350076_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_001295593.1|4350251_4350686_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837902.1|4350826_4351960_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	4.8e-118
>prophage 298
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4356915	4357905	5300308		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|4356915_4357905_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 299
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4370648	4371665	5300308	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001322394.1|4370648_4371665_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	1.1e-185
>prophage 300
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4377755	4383331	5300308		Klosneuvirus(50.0%)	3	NA	NA
WP_000139608.1|4377755_4381658_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_001060290.1|4381763_4382063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162782381.1|4383055_4383331_-	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	100.0	7.1e-07
>prophage 301
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4387388	4388337	5300308		Escherichia_phage(50.0%)	2	NA	NA
WP_001306523.1|4387388_4387919_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.0e-18
WP_000731856.1|4388163_4388337_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	5.8e-07
>prophage 302
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4401511	4408561	5300308		Phage_TP(25.0%)	7	NA	NA
WP_001309488.1|4401511_4403473_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	27.9	1.6e-23
WP_000494244.1|4403564_4403795_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813797.1|4404016_4404193_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	59.6	1.2e-12
WP_076611057.1|4404238_4404655_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.0	8.2e-31
WP_000760613.1|4404733_4406140_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047447.1|4406384_4407530_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220413.1|4407547_4408561_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 303
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4411955	4412765	5300308		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000867994.1|4411955_4412765_+	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.7	9.1e-18
>prophage 304
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4417030	4419133	5300308		Salmonella_phage(100.0%)	1	NA	NA
WP_000689374.1|4417030_4419133_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.2	2.1e-135
>prophage 305
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4423774	4426180	5300308		Ralstonia_phage(100.0%)	1	NA	NA
WP_000053614.1|4423774_4426180_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.5	2.5e-23
>prophage 306
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4432041	4437367	5300308	transposase	Bacillus_phage(50.0%)	5	NA	NA
WP_113621764.1|4432041_4433389_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_000804426.1|4433478_4434372_-	PhzF family isomerase	NA	NA	NA	NA	NA
WP_000617123.1|4434450_4435131_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_001166367.1|4435127_4435823_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702560.1|4435822_4437367_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 307
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4445645	4446746	5300308		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768393.1|4445645_4446746_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	65.4	5.3e-138
>prophage 308
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4452935	4454694	5300308		Escherichia_phage(66.67%)	3	NA	NA
WP_000781370.1|4452935_4453220_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000605676.1|4453219_4453498_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	60.9	3.7e-27
WP_000642407.1|4453683_4454694_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 309
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4457967	4459873	5300308		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285562.1|4457967_4458894_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	4.5e-13
WP_000193511.1|4458886_4459873_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.1e-17
>prophage 310
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4464189	4467996	5300308		Klosneuvirus(50.0%)	2	NA	NA
WP_001513298.1|4464189_4466589_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426278.1|4466613_4467996_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.0	2.0e-17
>prophage 311
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4473275	4480211	5300308		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_001376860.1|4473275_4476059_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	1.3e-18
WP_000832475.1|4476115_4478488_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_000628565.1|4478525_4480211_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.8	7.7e-11
>prophage 312
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4504600	4506001	5300308		Escherichia_phage(100.0%)	1	NA	NA
WP_001376867.1|4504600_4506001_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.0	2.0e-105
>prophage 313
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4513415	4514951	5300308		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194898.1|4513415_4514951_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	3.4e-21
>prophage 314
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4522822	4524241	5300308		Bacillus_phage(100.0%)	1	NA	NA
WP_000558436.1|4522822_4524241_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 315
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4531987	4532371	5300308		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091199.1|4531987_4532371_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 316
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4535373	4536264	5300308		Bacillus_phage(100.0%)	1	NA	NA
WP_000592808.1|4535373_4536264_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.0	1.1e-19
>prophage 317
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4541155	4602979	5300308	integrase,transposase,protease,terminase,portal,lysis,tail	Enterobacteria_phage(41.51%)	73	4559411:4559426	4598445:4598460
WP_000214712.1|4541155_4541359_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527819.1|4541394_4542855_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.9	5.1e-43
WP_000347485.1|4542944_4544228_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|4544831_4544945_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|4545013_4545247_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|4545563_4546154_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885596.1|4546251_4546827_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	2.9e-103
WP_000279113.1|4546826_4549742_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	2.5e-57
WP_001230343.1|4549806_4550406_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	99.0	6.7e-111
WP_000515574.1|4550472_4553871_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_001309913.1|4553931_4554579_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	2.5e-111
WP_000140729.1|4554476_4555220_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	7.0e-150
WP_001152385.1|4555225_4555924_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_000447253.1|4555933_4556263_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000372011.1|4556262_4559328_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
WP_001161009.1|4559299_4559629_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
4559411:4559426	attL	AAGGCTGAAATCAGCC	NA	NA	NA	NA
WP_001297778.1|4559637_4560024_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
WP_000211109.1|4560084_4560828_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001079398.1|4560839_4561241_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677108.1|4561237_4561816_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001283153.1|4561827_4562103_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|4562095_4562419_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136587.1|4562505_4564533_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_011478361.1|4564477_4566058_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_001072975.1|4565985_4566198_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934101.1|4566194_4568297_-|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.9	0.0e+00
WP_000373425.1|4568296_4568791_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_001031431.1|4569353_4569560_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000035574.1|4569860_4570271_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.0	2.1e-63
WP_001019606.1|4570422_4570596_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|4570767_4570923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122134696.1|4571002_4571068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|4571070_4571259_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|4571269_4571482_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|4571845_4572343_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|4572339_4572873_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_113621767.1|4572869_4573202_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	63.3	7.0e-25
WP_000839590.1|4573185_4573401_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|4574154_4574370_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|4574670_4574883_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|4574937_4575027_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047132.1|4575304_4576057_-	antitermination protein	NA	Q8SBE4	Shigella_phage	95.2	2.5e-131
WP_001513304.1|4576070_4577120_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	56.7	6.9e-111
WP_001309521.1|4577121_4577400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980991.1|4577466_4577718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887485.1|4577934_4578147_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.7e-24
WP_000340970.1|4578764_4580552_+	DUF4209 domain-containing protein	NA	Q2P9X5	Enterobacteria_phage	23.1	9.3e-15
WP_001151189.1|4580770_4581172_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
WP_000054487.1|4581212_4582178_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_000705349.1|4582158_4582680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|4582663_4582891_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|4582968_4583376_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379575.1|4583568_4583724_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000344958.1|4583725_4584301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322394.1|4584959_4585976_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	1.1e-185
WP_147698699.1|4585974_4586175_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083276.1|4586171_4586363_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048333.1|4586456_4588928_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	55.6	2.1e-57
WP_000005552.1|4589000_4589252_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876984.1|4589286_4590567_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	1.9e-155
WP_001513307.1|4590586_4590697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836037.1|4590754_4591774_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|4591785_4593000_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001306081.1|4593205_4593532_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_000705197.1|4593666_4594008_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|4594042_4594603_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001309527.1|4594605_4595316_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|4595423_4595729_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041650.1|4595927_4598354_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	2.3e-213
WP_012602795.1|4598414_4600838_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	1.4e-207
4598445:4598460	attR	AAGGCTGAAATCAGCC	NA	NA	NA	NA
WP_000213028.1|4600848_4601466_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526517.1|4601467_4602322_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148697.1|4602364_4602979_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.8	7.3e-28
>prophage 318
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4620739	4622041	5300308		Bacillus_phage(100.0%)	1	NA	NA
WP_000732505.1|4620739_4622041_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	4.2e-17
>prophage 319
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4633375	4635187	5300308		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945937.1|4633375_4635187_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 320
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4655065	4656340	5300308	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|4655065_4656340_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 321
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4663251	4664750	5300308		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|4663251_4663773_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250671.1|4663853_4664750_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 322
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4673554	4682358	5300308		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101181.1|4673554_4674382_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|4674509_4675091_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|4675236_4676406_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|4676571_4676661_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|4676959_4677985_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269493.1|4677981_4678914_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182362.1|4679026_4680238_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098886.1|4680528_4681677_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	7.2e-85
WP_000493947.1|4681716_4682358_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 323
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4687863	4690130	5300308		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587604.1|4687863_4688676_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	1.1e-07
WP_001069969.1|4688679_4689465_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001309532.1|4689461_4690130_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.8	4.5e-23
>prophage 324
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4698420	4703504	5300308		environmental_halophage(33.33%)	5	NA	NA
WP_000144587.1|4698420_4699641_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.2	9.9e-93
WP_000907971.1|4699637_4700909_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948865.1|4700883_4701630_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	3.8e-10
WP_001308677.1|4701639_4703127_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367171.1|4703135_4703504_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	5.6e-15
>prophage 325
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4722150	4741545	5300308	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001309534.1|4722150_4723797_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.6	1.3e-31
WP_000069361.1|4723853_4726232_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.5	2.1e-171
WP_000368041.1|4726564_4727398_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082226.1|4727554_4728601_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270810.1|4728732_4728924_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175719.1|4728927_4730364_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001309535.1|4730426_4731140_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209780.1|4731386_4731851_-	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_000029466.1|4731928_4732678_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154187.1|4732677_4733229_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956538.1|4733291_4734272_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|4734372_4734672_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672332.1|4734676_4737064_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|4737078_4738062_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_012602797.1|4738200_4738245_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|4738367_4738724_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|4738776_4738974_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|4739070_4739613_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|4739616_4741545_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 326
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4752834	4755096	5300308		Tupanvirus(100.0%)	1	NA	NA
WP_000077898.1|4752834_4755096_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.4	3.0e-143
>prophage 327
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4760725	4762753	5300308	transposase	Saccharomonospora_phage(50.0%)	3	NA	NA
WP_000526135.1|4760725_4761184_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001039044.1|4761385_4761724_-	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_000175035.1|4761925_4762753_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 328
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4770229	4771450	5300308		Klosneuvirus(100.0%)	1	NA	NA
WP_000082001.1|4770229_4771450_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	4.7e-26
>prophage 329
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4778214	4778865	5300308		Planktothrix_phage(100.0%)	1	NA	NA
WP_000882821.1|4778214_4778865_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.2	1.2e-12
>prophage 330
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4783258	4785214	5300308		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235804.1|4783258_4785214_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.1e-40
>prophage 331
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4790139	4794225	5300308		Tupanvirus(50.0%)	4	NA	NA
WP_001135079.1|4790139_4790781_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.4	3.8e-19
WP_000438819.1|4790873_4792232_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|4792349_4793108_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723698.1|4793244_4794225_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	1.0e-07
>prophage 332
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4802212	4804602	5300308	transposase	Saccharomonospora_phage(50.0%)	3	NA	NA
WP_000526135.1|4802212_4802671_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001309547.1|4802812_4803697_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_001186361.1|4803747_4804602_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	25.0	2.3e-11
>prophage 333
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4807920	4812496	5300308		Bacillus_phage(100.0%)	2	NA	NA
WP_000219686.1|4807920_4809204_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_001322965.1|4811005_4812496_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 334
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4827250	4835355	5300308	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|4827250_4828936_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|4829140_4829722_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220981.1|4829760_4830456_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128862.1|4830513_4832424_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.0	1.2e-92
WP_001295493.1|4832555_4832900_+	RidA family protein	NA	NA	NA	NA	NA
WP_001322969.1|4833261_4833621_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|4833740_4833920_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000855015.1|4833993_4835355_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	43.1	2.2e-40
>prophage 335
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4839217	4840774	5300308		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|4839217_4840774_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 336
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4846414	4846624	5300308		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|4846414_4846624_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 337
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4850945	4854716	5300308	transposase,protease	Saccharomonospora_phage(50.0%)	3	NA	NA
WP_000526135.1|4850945_4851404_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_000984517.1|4851594_4852476_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001055785.1|4852667_4854716_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 338
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4862212	4870547	5300308	transposase	Escherichia_phage(40.0%)	10	NA	NA
WP_000812712.1|4862212_4862869_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
WP_000976481.1|4863264_4863606_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879330.1|4863618_4864491_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204705.1|4864494_4864869_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|4865007_4865238_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011651.1|4865339_4865996_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|4866019_4866682_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000936971.1|4866678_4868739_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000064873.1|4868895_4869321_-|transposase	IS200/IS605-like element ISEc46 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	49.6	8.9e-25
WP_000942660.1|4869377_4870547_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	99.2	2.7e-204
>prophage 339
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4876500	4877976	5300308		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|4876500_4877976_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 340
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4881975	4974383	5300308	integrase,holin,head,terminase,portal,capsid,tail,tRNA	Enterobacterial_phage(19.67%)	107	4910164:4910178	4980260:4980274
WP_001184045.1|4881975_4883298_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001376899.1|4883313_4884246_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202988.1|4884324_4885080_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571478.1|4885076_4885862_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568522.1|4886013_4887024_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|4887032_4887644_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072123646.1|4887782_4887848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024936.1|4887918_4888521_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|4888522_4889044_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|4889078_4889819_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_076611058.1|4889847_4890300_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|4890292_4892065_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891630.1|4892374_4892941_+	hydrolase	NA	NA	NA	NA	NA
WP_000639263.1|4892937_4893756_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	1.1e-71
WP_000252980.1|4893808_4894204_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019598.1|4894244_4894988_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.4	1.2e-24
WP_000564725.1|4894984_4895956_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176790.1|4895990_4898420_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214346.1|4898444_4899545_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185724.1|4899930_4900677_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001304291.1|4900690_4901257_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025308.1|4901472_4903206_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	4.4e-86
WP_001259587.1|4903258_4903651_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066971.1|4903650_4905729_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278923.1|4905721_4906870_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|4907071_4907716_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|4907726_4908116_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|4908130_4909180_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204341.1|4909182_4910043_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483244.1|4910061_4911663_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	1.1e-14
4910164:4910178	attL	CTGATTCGCCAGTTG	NA	NA	NA	NA
WP_001306742.1|4911708_4913370_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147301.1|4913514_4914018_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001513320.1|4914038_4916003_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|4916007_4916934_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906334.1|4916930_4917818_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|4917944_4918523_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|4918525_4918876_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122407.1|4919656_4920085_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001309560.1|4920091_4921516_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001309561.1|4921490_4922291_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100205.1|4922457_4923444_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187822.1|4923458_4924973_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548675.1|4925042_4926032_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|4926828_4927332_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|4927411_4927663_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|4927777_4927864_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237866.1|4928126_4928450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|4928620_4929118_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377223.1|4929155_4929395_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797561.1|4929585_4930797_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|4930858_4931524_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_113621772.1|4931922_4932243_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.9	1.8e-25
WP_113621773.1|4932242_4932482_-	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	66.7	1.3e-25
WP_113621774.1|4932592_4932955_+	GtrA family protein	NA	U5P0S6	Shigella_phage	82.5	3.4e-49
WP_113621775.1|4932951_4933881_+	glycosyltransferase family 2 protein	NA	B9UDL7	Salmonella_phage	95.7	4.1e-163
WP_113621776.1|4933873_4935289_+	glucosyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_113621777.1|4937256_4939974_-	kinase	NA	A0A286S259	Klebsiella_phage	55.8	0.0e+00
WP_048216110.1|4939970_4940351_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	80.2	7.6e-60
WP_113621778.1|4940360_4940843_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	76.9	4.5e-65
WP_113621779.1|4940839_4941313_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.2	1.4e-58
WP_113621780.1|4941312_4943838_-|tail	phage tail tape measure protein	tail	K7PM62	Enterobacteria_phage	70.1	6.0e-217
WP_113621781.1|4944105_4944483_-|tail	phage tail assembly chaperone family protein, TAC	tail	K7PJU9	Enterobacteria_phage	79.7	1.0e-48
WP_113621782.1|4944533_4945031_-|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	74.5	1.8e-64
WP_113621783.1|4945083_4945452_-	DUF3168 domain-containing protein	NA	K7PHI9	Enterobacteria_phage	72.1	3.3e-44
WP_048231623.1|4945448_4945934_-	HK97 gp10 family phage protein	NA	A0A0U3TGT7	Pseudomonas_phage	57.5	8.0e-46
WP_113621784.1|4945926_4946259_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	61.8	1.5e-32
WP_113621785.1|4946261_4946456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048231618.1|4946526_4946853_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	59.3	6.2e-26
WP_113621786.1|4946849_4947734_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TNN1	Salmonella_phage	41.5	1.1e-64
WP_113621787.1|4947730_4949083_-|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	66.7	1.1e-172
WP_113621788.1|4949285_4951223_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	83.0	2.1e-302
WP_080202546.1|4951281_4952940_-|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	71.6	1.1e-238
WP_113621789.1|4952943_4953405_-|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	57.9	5.3e-39
WP_080221456.1|4953505_4953874_-	HNH endonuclease	NA	S4TTG9	Salmonella_phage	78.3	2.6e-49
WP_113621790.1|4953866_4954460_-	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	71.8	1.9e-81
WP_113621791.1|4954441_4955899_-	glycosyltransferase family 2 protein	NA	S4TSQ9	Salmonella_phage	70.5	2.8e-211
WP_113621792.1|4956419_4956710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008323305.1|4957260_4957533_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	67.9	2.9e-21
WP_113621794.1|4957749_4958367_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	73.5	1.2e-81
WP_113621795.1|4958366_4958648_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	87.1	1.2e-38
WP_008323296.1|4958634_4959030_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	81.7	2.6e-50
WP_113621796.1|4959524_4960103_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.3	3.6e-45
WP_113621797.1|4960117_4961107_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	71.1	2.1e-141
WP_113621821.1|4961103_4961820_-	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	53.1	1.3e-55
WP_008323290.1|4961938_4962307_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	65.6	5.9e-41
WP_094790200.1|4962303_4962624_-	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	58.7	1.3e-28
WP_003833987.1|4962625_4962844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113621798.1|4962830_4963499_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	79.6	6.8e-96
WP_113621799.1|4963498_4963942_-	hypothetical protein	NA	U5P0U0	Shigella_phage	31.7	2.8e-13
WP_113621800.1|4963944_4964865_-	conserved phage C-terminal domain-containing protein	NA	K7PLZ7	Enterobacterial_phage	84.4	5.2e-62
WP_061549227.1|4964821_4965034_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	66.7	6.6e-13
WP_032207800.1|4965274_4965739_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	90.1	5.8e-70
WP_113621801.1|4965758_4965989_-	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	56.1	2.5e-13
WP_075848517.1|4966096_4966756_+	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	61.6	4.9e-70
WP_162782382.1|4967064_4967619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094790214.1|4967979_4968393_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	73.5	6.2e-47
WP_113621803.1|4968392_4969433_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	87.8	3.5e-163
WP_113621804.1|4969964_4970246_+	hypothetical protein	NA	A0A2I7R567	Vibrio_phage	39.4	7.2e-07
WP_113621805.1|4970242_4970848_+	ead/Ea22-like family protein	NA	G9L662	Escherichia_phage	53.8	2.7e-22
WP_113621806.1|4970849_4971227_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	97.6	2.6e-68
WP_113621807.1|4971223_4971442_+	DUF4014 family protein	NA	Q5G8V0	Enterobacteria_phage	75.0	5.0e-24
WP_113621822.1|4971469_4971763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113621808.1|4971763_4972384_+	hypothetical protein	NA	A5LH60	Enterobacteria_phage	37.5	2.7e-22
WP_162782383.1|4972386_4972563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113621809.1|4972562_4972754_+	hypothetical protein	NA	A0A2P1MXE1	Escherichia_phage	64.6	1.2e-13
WP_113621811.1|4973145_4973373_+	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	85.3	1.0e-35
WP_113621812.1|4973372_4974383_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	87.2	2.8e-173
4980260:4980274	attR	CAACTGGCGAATCAG	NA	NA	NA	NA
>prophage 341
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4979755	4980508	5300308		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|4979755_4980508_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 342
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	4992341	4993597	5300308	transposase	uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_000334576.1|4992341_4992839_+	SOS response-associated peptidase family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	65.2	5.9e-52
WP_001336494.1|4992720_4993050_-	helix-turn-helix domain-containing protein	NA	A0A1B0VCD8	Salmonella_phage	86.6	8.1e-42
WP_015674555.1|4993072_4993597_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
>prophage 343
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	5013706	5021996	5300308		Burkholderia_phage(33.33%)	8	NA	NA
WP_000786004.1|5013706_5014177_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157246.1|5014157_5015576_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.6	1.4e-101
WP_000365586.1|5015642_5016338_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.4	1.1e-06
WP_023909399.1|5016377_5016743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824355.1|5017309_5018425_+	porin	NA	Q1MVN1	Enterobacteria_phage	47.7	1.0e-91
WP_000218212.1|5019017_5019869_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826790.1|5019966_5021325_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	2.3e-05
WP_001339045.1|5021324_5021996_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 344
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	5025540	5052614	5300308	integrase	Bacillus_phage(33.33%)	10	5020162:5020176	5031596:5031610
5020162:5020176	attL	GCTGGCGATATCAAT	NA	NA	NA	NA
WP_001079074.1|5025540_5026071_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_001327955.1|5026823_5027621_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_024193699.1|5027958_5029221_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.8	2.0e-72
WP_000703040.1|5029414_5030719_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_001286281.1|5030746_5032027_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
5031596:5031610	attR	GCTGGCGATATCAAT	NA	NA	NA	NA
WP_001563911.1|5032019_5033822_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	3.6e-22
WP_001327954.1|5033808_5035521_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.0	1.4e-31
WP_000140405.1|5035777_5036737_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000623026.1|5036927_5043035_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
WP_113621814.1|5043122_5052614_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.2e-49
>prophage 345
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	5096080	5103760	5300308	transposase	Stx2-converting_phage(40.0%)	14	NA	NA
WP_023910202.1|5096080_5096899_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.9	5.7e-44
WP_000214393.1|5096989_5097475_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.0e-12
WP_023910200.1|5097490_5097967_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|5098029_5098251_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001285585.1|5098324_5098693_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_001563930.1|5098781_5099156_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988600.1|5099152_5099347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|5099359_5099473_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_071592185.1|5099761_5099935_-|transposase	transposase domain-containing protein	transposase	A0A0P0ZBS5	Stx2-converting_phage	61.5	1.9e-10
WP_001016348.1|5099961_5100144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|5100244_5100574_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001200891.1|5100745_5101804_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001105415.1|5102001_5102475_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001563931.1|5102593_5103760_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	1.3e-227
>prophage 346
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	5111404	5112304	5300308		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|5111404_5112304_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 347
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	5119661	5122483	5300308		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_001563936.1|5119661_5120828_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.7e-110
WP_000043440.1|5121076_5122483_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	8.0e-38
>prophage 348
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	5131168	5134852	5300308		Bacillus_phage(33.33%)	3	NA	NA
WP_000183060.1|5131168_5132062_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000999466.1|5132304_5133300_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_001115987.1|5133457_5134852_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	1.7e-19
>prophage 349
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	5140660	5147454	5300308		Bacillus_phage(25.0%)	6	NA	NA
WP_001474417.1|5140660_5142031_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.2e-32
WP_001474418.1|5142223_5143660_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	9.7e-47
WP_000699707.1|5143662_5144886_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479836.1|5144882_5145362_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043606.1|5145364_5146330_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
WP_000048190.1|5146332_5147454_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 350
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	5151771	5164064	5300308	transposase	Catovirus(28.57%)	12	NA	NA
WP_000654487.1|5151771_5152611_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A1V0S9B9	Catovirus	28.3	4.1e-05
WP_000137112.1|5152739_5154902_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|5154904_5155348_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|5155353_5156493_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_162829205.1|5156801_5156951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000454701.1|5157151_5158735_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001227699.1|5158809_5159148_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000687871.1|5159137_5159428_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	37.2	2.1e-09
WP_001252295.1|5159480_5161334_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|5161355_5161937_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|5162028_5162670_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_033544230.1|5163083_5164064_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.2e-184
>prophage 351
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	5168592	5169945	5300308		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001571619.1|5168592_5169945_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.2e-06
>prophage 352
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	5183058	5189165	5300308	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_000675141.1|5183058_5184462_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	1.0e-32
WP_000137877.1|5184458_5185181_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|5185371_5185704_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|5185850_5187212_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001318299.1|5187542_5187860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807356.1|5188265_5189165_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
>prophage 353
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	5198305	5201862	5300308		Serratia_phage(50.0%)	4	NA	NA
WP_000846212.1|5198305_5199310_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	1.5e-14
WP_000011941.1|5199306_5200272_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|5200245_5200992_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001306379.1|5201043_5201862_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.9	1.7e-24
>prophage 354
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	5212513	5214547	5300308	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001306372.1|5212513_5214547_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	2.3e-54
>prophage 355
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	5230821	5240264	5300308		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292789.1|5230821_5231958_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.3e-163
WP_001309586.1|5231954_5233955_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001295429.1|5234079_5234541_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|5234582_5235053_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|5235099_5235819_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001309587.1|5235815_5237501_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_001240398.1|5237722_5238454_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|5238513_5238621_+	protein YohO	NA	NA	NA	NA	NA
WP_000783145.1|5238601_5239333_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569372.1|5239337_5240264_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.3	1.1e-22
>prophage 356
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	5260506	5262027	5300308		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255032.1|5260506_5262027_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 357
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	5265721	5269495	5300308		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|5265721_5266390_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425460.1|5266647_5267484_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489223.1|5267515_5269495_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	1.9e-13
>prophage 358
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	5273564	5274422	5300308		Catovirus(100.0%)	1	NA	NA
WP_000873880.1|5273564_5274422_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
>prophage 359
NZ_CP030768	Escherichia coli strain 2017C-4173W12 chromosome, complete genome	5300308	5288967	5293268	5300308		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001091919.1|5288967_5290434_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	1.5e-42
WP_000198816.1|5290551_5291538_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001297918.1|5291576_5292290_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|5292701_5293268_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 1
NZ_CP030770	Escherichia coli strain 2017C-4173W12 plasmid p2017C-4173W12, complete sequence	149680	61056	94443	149680	transposase,integrase	Thermus_phage(13.33%)	37	83739:83759	102406:102426
WP_024257664.1|61056_62061_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	30.4	8.3e-21
WP_001337416.1|62247_62484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302184.1|63099_63258_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001276230.1|63533_64253_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845910.1|64249_64684_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001145501.1|64738_66697_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	7.3e-21
WP_000006018.1|66755_66989_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000290833.1|67045_67573_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	6.0e-47
WP_024257664.1|67824_68829_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	30.4	8.3e-21
WP_024185774.1|69252_69705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298559.1|69790_70354_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	4.7e-21
WP_000170671.1|70400_71762_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000155844.1|71813_72044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027516.1|73006_73198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271708.1|73194_73617_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001666994.1|73663_73966_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000274508.1|75319_75754_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104873.1|75767_75989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086169.1|75989_76673_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	2.8e-28
WP_001310011.1|76748_77060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310012.1|77056_77959_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000343766.1|78377_79598_-|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
WP_000115885.1|79616_80135_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000619112.1|80269_80518_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.2e-13
WP_113621827.1|80514_80952_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.0	7.0e-25
WP_000952372.1|82074_83247_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	3.5e-228
WP_000544830.1|83246_84044_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
83739:83759	attL	GATGAAATAGGCTATCTGCCG	NA	NA	NA	NA
WP_000340835.1|84361_84754_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001103694.1|84758_85730_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
WP_000633911.1|85958_86603_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
WP_000239529.1|86596_86872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016979.1|87009_87819_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.5	7.8e-54
WP_001159871.1|87819_88125_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|88126_88345_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000990667.1|90666_91308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309253.1|92482_93460_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.5	6.1e-101
WP_001066952.1|93702_94443_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
102406:102426	attR	CGGCAGATAGCCTATTTCATC	NA	NA	NA	NA
>prophage 2
NZ_CP030770	Escherichia coli strain 2017C-4173W12 plasmid p2017C-4173W12, complete sequence	149680	136061	145047	149680	transposase,integrase	Salmonella_phage(33.33%)	9	133150:133209	147109:148251
133150:133209	attL	GGGCTCTGTTGCAAAGATTGGCGGCAGTCAGAGGTAGGCTGTCGCTCTGCGCCGATCAGG	NA	NA	NA	NA
WP_000259031.1|136061_136901_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|136894_137242_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|137447_138236_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|138366_138840_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000845046.1|138997_140011_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.4e-71
WP_000454193.1|140213_140564_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|140830_141535_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_113621828.1|141559_142078_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	3.7e-49
WP_001138064.1|142080_145047_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
147109:148251	attR	CCTGATCGGCGCAGAGCGACAGCCTACCTCTGACTGCCGCCAATCTTTGCAACAGAGCCCGCCGTGCTAGTCTGCTCGGTGATGGTGGAGTGAAGCCAACCCGCAATCGGGTTATGAATCTGCATCGCGATTCGCAATCAGCTGTCTCTTGAGCATGTCGAACTCCTGCGATGTTATCTCGCCGTGCTCGTGCTGCTACACCAACTTGTCCAACTCATCCGCCACACCGCTCCCCACCACCTGCGATGGCCAGGTTGTTTGCTGGGCGCATTGGCGGAGTATCGTCTCGACCCGGGACACCCACACCGGCACAACCTTACGGGAGTGATTCACTGTCAAAGAATCGGCCCGGTGCTCTGACGCAAGTATCGGGATGGTCACCATTTGTAAGCCGTAGACCTGAGTGGTGATCAAGACTTCGATACCACCGACCGTACCGGTACTAATCGACGACGGTCGTGTTCGTCGCCTGCCGCAGGGACTCTGCACACCTCCGTTTACGCATGTGCCTGGAGGAGTTGGAAATCGTCGTGTTCGGGAAACATTAAACACAGGATGGCAGCGATCTGAGCCAGCACATGATCAGCTAGCTCACCATCCGGATCGACGGCCCACTGCATCGTCGCGCCAGCGATGACCGAGTGCAGGAGCAACTCAGCTGCCGCAGGAGCACCTGGGGGCAGTCGCTTGCGGATCCCCTCCACCACCGCGCGGTTCCGCTGGATCGCAAGCGTGCGTAGCTCCGGCACCTGGAGCTCGTACCAGGAGATGAGATAGTTCACCGAGAAGTCGTTGCGAGTGTTCATGCTCCGAACGAGCACCTGCAAAAATTCCCAGAGCCCTTGCGGCCCTGCGCCTATCGGTATCGCATTCAGGTAATGCCGCACCTGCTCGACGCCGCGCTCCATCATCCTCACCAGCAGCGTATCGCGGTTGGTGAAGCGCTGGATTAACGCTGCGCGGGAGAGCCCCACCTCCTTTGCTACTCCGCTGAGCGTGAACTCTATGGGACCGCAACGCTTCAGCACTACGGTGGCGGCCTCGAGTACCTCGTCATCGGACTTGAGCTTGGGGCGGGGCATCAGTGTTCACCTTCTGTATGGGTTGGGGCGGAGGCTGTGGCTGCCGCCGCCATTGTAGCAA	NA	NA	NA	NA
