The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030778	Escherichia albertii strain 05-3106 chromosome, complete genome	4719667	6503	13944	4719667		Escherichia_phage(50.0%)	7	NA	NA
WP_000824786.1|6503_7049_-	cytolethal distending toxin subunit C	NA	M1SNM4	Escherichia_phage	91.7	5.2e-94
WP_000759937.1|7063_7873_-	cytolethal distending toxin type III/V subunit CdtB	NA	G1BEM4	Escherichia_phage	95.9	9.7e-145
WP_071825281.1|7869_8646_-	cytolethal distending toxin type II subunit CdtA	NA	G1BEM3	Escherichia_phage	93.0	2.8e-125
WP_000476034.1|9792_11154_-	U32 family peptidase	NA	Q6DW11	Phage_TP	98.4	2.3e-215
WP_025238759.1|11301_11634_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_000137865.1|11821_12544_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	8.3e-31
WP_044708245.1|12540_13944_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	5.4e-34
>prophage 2
NZ_CP030778	Escherichia albertii strain 05-3106 chromosome, complete genome	4719667	269258	331135	4719667	tRNA,tail,terminase,holin	Enterobacteria_phage(47.37%)	71	NA	NA
WP_044708796.1|269258_269954_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_025238886.1|269991_270573_+	membrane protein	NA	NA	NA	NA	NA
WP_077871786.1|270777_272463_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	7.6e-35
WP_001109148.1|272532_273660_+	ribonuclease D	NA	NA	NA	NA	NA
WP_113622703.1|273717_274683_-	oxidoreductase	NA	NA	NA	NA	NA
WP_000067842.1|274738_275863_-	ring-hydroxylating oxygenase subunit alpha	NA	NA	NA	NA	NA
WP_077871079.1|275894_277502_-	BCCT family transporter	NA	NA	NA	NA	NA
WP_025238891.1|277760_278846_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_044711167.1|278948_279872_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000457182.1|279998_280637_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000939315.1|280809_281169_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_002462282.1|281174_281357_+	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001386836.1|281408_281483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025238893.1|281485_281584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010337366.1|281616_282642_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_001399020.1|282878_284174_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	6.7e-156
WP_000005552.1|284193_284445_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048321.1|284517_286989_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.8	1.3e-59
WP_001083270.1|287082_287274_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854560.1|287270_287459_-	division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000159335.1|287961_288162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113623286.1|288130_288496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001580454.1|288507_288660_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	2.5e-06
WP_000233320.1|288957_289377_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072337.1|289456_289711_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000693853.1|289707_290133_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262357.1|290204_291275_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_001151199.1|291315_291738_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	84.9	2.0e-61
WP_001242074.1|293478_294348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077249008.1|294604_294748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887491.1|294906_295119_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_001325325.1|295577_295856_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	7.4e-12
WP_001265274.1|295857_296907_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.2	3.0e-114
WP_001204787.1|296924_297302_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_000780584.1|297457_297982_-	membrane protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_000592549.1|298174_299134_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_001268857.1|299138_299327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077636141.1|299531_300254_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000839587.1|300444_300660_+|holin	holin	holin	A5LH82	Enterobacteria_phage	94.4	2.9e-32
WP_000189918.1|300664_300976_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
WP_001071776.1|301502_302000_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|302363_302576_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071526745.1|302586_302775_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|302922_303078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|303250_303424_+	protein GnsB	NA	NA	NA	NA	NA
WP_000548593.1|303719_303926_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001365825.1|304971_307074_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.7	0.0e+00
WP_001072975.1|307070_307283_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001322266.1|310803_311172_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	9.7e-52
WP_001283153.1|311164_311440_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001365827.1|311451_312030_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	3.6e-101
WP_001079398.1|312026_312428_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211109.1|312439_313183_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001297778.1|313243_313630_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
WP_021526333.1|313638_313968_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	8.4e-55
WP_113622704.1|313939_317005_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.0	0.0e+00
WP_000447253.1|317004_317334_+|tail	tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_020219025.1|317343_318042_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.4	6.8e-131
WP_032200033.1|318047_318791_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	1.0e-148
WP_023277304.1|318688_319336_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	4.7e-110
WP_113622705.1|319396_322795_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	88.1	0.0e+00
WP_001746823.1|322861_323461_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	4.8e-109
WP_113623287.1|323525_326600_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_000885611.1|326599_327175_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000078177.1|327272_327863_-	Qin prophage; site-specific recombinase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|328179_328413_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_113622706.1|329196_329445_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_002462278.1|329466_329814_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000460712.1|329911_330358_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_044708574.1|330526_330631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000138035.1|330631_331135_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP030778	Escherichia albertii strain 05-3106 chromosome, complete genome	4719667	836226	937311	4719667	tRNA,tail,integrase,terminase,capsid,holin,lysis,portal,protease,head,transposase	Escherichia_phage(39.29%)	115	873129:873143	937423:937437
WP_000152937.1|836226_836811_+|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505869.1|836927_838019_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_113622778.1|838179_840099_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_113622779.1|840326_841397_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_025237128.1|841407_842040_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_025237129.1|842050_843469_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_071586015.1|843424_843613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044708815.1|843603_845295_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_076738663.1|845369_846527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044708816.1|846852_847875_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001258316.1|847874_848861_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173907.1|848857_849616_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.1	2.3e-15
WP_044708818.1|849625_850438_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000576811.1|850434_851289_+	ModD protein	NA	NA	NA	NA	NA
WP_000511318.1|853333_853588_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_113622780.1|853788_854523_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_002462038.1|854524_855136_-	murein transglycosylase	NA	NA	NA	NA	NA
WP_000051544.1|855235_856150_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000338383.1|856245_857982_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_044712576.1|858040_859111_-	alanine racemase	NA	NA	NA	NA	NA
WP_113622781.1|859120_860419_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_044707922.1|860747_862280_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|862430_863150_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406418.1|863371_864913_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_059214767.1|865058_865589_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_001019911.1|865811_866426_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_025237136.1|867016_867418_+	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
WP_000738417.1|867638_867932_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	88.7	6.5e-43
WP_032275004.1|868312_868513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113622782.1|868812_869910_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.8	1.3e-155
WP_000807619.1|870392_870854_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_044717099.1|870930_871590_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_024164782.1|871661_871955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002462028.1|872080_872770_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101044.1|872793_873606_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
873129:873143	attL	GGATTTTGAATTTAT	NA	NA	NA	NA
WP_001185665.1|873609_873876_+	cell division topological specificity factor	NA	NA	NA	NA	NA
WP_113622783.1|874261_875599_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_113622784.1|875516_878594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000455704.1|878650_878755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068152.1|879059_879188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000725791.1|879189_879534_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_002462020.1|879543_879873_+	YmgD family protein	NA	NA	NA	NA	NA
WP_001065864.1|880086_880305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059228805.1|880919_881867_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_024164781.1|883129_883846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044716634.1|885059_885311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072243824.1|885774_886263_+|integrase	integrase	integrase	Q77Z04	Phage_21	96.9	7.2e-87
WP_000444487.1|886376_887627_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_044716173.1|887798_888452_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476091.1|888461_888923_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_001516209.1|888976_890083_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_024164967.1|890118_890760_+	lysogenization regulator HflD	NA	NA	NA	NA	NA
WP_000423734.1|890763_892134_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	2.1e-107
WP_001265484.1|892301_892973_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_113622785.1|893626_897100_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.6	0.0e+00
WP_113622786.1|897443_898124_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.4	1.4e-112
WP_113622787.1|898021_898765_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	1.5e-144
WP_001335877.1|898775_899474_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000847298.1|899473_899803_-|tail	tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_113622788.1|899799_902373_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.2	0.0e+00
WP_000533402.1|902353_902767_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001542190.1|902793_903225_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	4.8e-42
WP_000235110.1|903238_903991_-|tail	tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683079.1|903998_904394_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000975010.1|904390_904966_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	6.4e-50
WP_000752997.1|904981_905335_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	4.9e-61
WP_113622789.1|905346_905733_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	90.9	7.0e-53
WP_000063261.1|905774_906800_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	98.5	2.5e-190
WP_001299443.1|906856_907189_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_016248240.1|907198_908518_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	2.8e-234
WP_016248239.1|908498_910100_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	7.2e-309
WP_000198149.1|910096_910303_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_016248238.1|910299_912225_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.4	0.0e+00
WP_000867489.1|912199_912745_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	1.2e-79
WP_001082562.1|913186_913654_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	77.9	7.0e-55
WP_024239084.1|913952_914486_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	7.4e-101
WP_000731267.1|914536_914881_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.4	7.2e-57
WP_000284510.1|914885_915101_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_042020311.1|915251_917108_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	89.6	0.0e+00
WP_000871291.1|917368_917704_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_032304845.1|918294_919344_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	1.2e-198
WP_000917767.1|919494_919692_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_020233847.1|919918_920740_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.8	7.6e-81
WP_001356201.1|920736_921111_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.8	5.4e-34
WP_032304852.1|921123_922170_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.1e-108
WP_032156820.1|922171_922444_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	2.7e-11
WP_001112736.1|922390_922570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013627.1|922611_922824_-	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	3.4e-25
WP_032148181.1|922908_923091_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	82.1	6.5e-17
WP_000207977.1|923058_923961_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	57.6	1.8e-78
WP_000224221.1|923971_924235_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	2.0e-30
WP_001167293.1|924236_924728_-	hypothetical protein	NA	G9L661	Escherichia_phage	93.3	2.0e-84
WP_001289987.1|924730_925090_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	76.5	9.2e-39
WP_001224665.1|925255_925438_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_113622790.1|925566_925878_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	96.1	1.8e-59
WP_000004324.1|925870_926125_-	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	92.9	5.3e-41
WP_001151132.1|926121_926544_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	75.5	2.6e-53
WP_000095671.1|926584_927547_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693845.1|927569_927995_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048458.1|927978_928254_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_000824162.1|928361_928862_+	XRE family transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	54.5	1.4e-16
WP_000100896.1|928879_929071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014966210.1|929070_929361_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_021538048.1|929630_929783_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_001339605.1|929794_930196_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	81.6	1.0e-09
WP_000358771.1|930155_930434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032140715.1|930476_930671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113622791.1|930848_930968_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_000255946.1|930981_932004_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_001317493.1|932000_932783_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_000449172.1|932952_933141_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|933137_933326_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_113622792.1|933421_935893_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_000003742.1|935954_936224_+	excisionase	NA	NA	NA	NA	NA
WP_000074983.1|936192_937311_+|integrase	integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
937423:937437	attR	ATAAATTCAAAATCC	NA	NA	NA	NA
>prophage 4
NZ_CP030778	Escherichia albertii strain 05-3106 chromosome, complete genome	4719667	1162025	1249060	4719667	tRNA,tail,plate,integrase,capsid,lysis,portal,protease,head	Salmonella_phage(58.33%)	92	1215003:1215027	1249135:1249159
WP_000886690.1|1162025_1163318_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.5	3.9e-95
WP_113622815.1|1163408_1164752_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.1	3.1e-79
WP_002462419.1|1164762_1165374_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_113622816.1|1165532_1169432_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.4	1.5e-86
WP_000228473.1|1169566_1170061_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
WP_113622817.1|1170605_1171571_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	7.2e-62
WP_113623294.1|1171691_1173458_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	3.2e-23
WP_044708610.1|1173458_1175180_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.3	4.9e-21
WP_001241660.1|1175224_1175929_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1176213_1176432_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_044709667.1|1177465_1179742_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.8	3.3e-166
WP_000520793.1|1179772_1180093_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.6	5.3e-14
WP_000410785.1|1180415_1180640_+	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_113622818.1|1180711_1182658_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.1	7.7e-39
WP_059238408.1|1182654_1183770_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_024164828.1|1183884_1184877_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599780.1|1184873_1186532_-	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
WP_002462422.1|1186956_1187652_+	aquaporin Z	NA	NA	NA	NA	NA
WP_002462423.1|1188146_1189046_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_044708080.1|1189189_1190842_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178653.1|1190853_1191822_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815389.1|1191954_1193673_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.7	1.5e-33
WP_025237294.1|1193710_1194712_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_044710234.1|1194722_1196153_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044710240.1|1196251_1197265_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000832594.1|1197261_1198092_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	29.4	9.6e-07
WP_001160731.1|1198088_1198412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001270732.1|1198537_1199053_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027211.1|1199270_1199999_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	4.6e-29
WP_000756580.1|1200016_1200748_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_044710236.1|1200754_1201471_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000895403.1|1201470_1202139_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_113622819.1|1202434_1203166_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059238413.1|1203307_1204459_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	2.8e-28
WP_000389264.1|1204499_1204988_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_044710222.1|1205047_1205893_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_025237300.1|1205889_1206843_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_044710221.1|1206852_1207986_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_044710228.1|1208080_1209193_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_032275043.1|1209176_1209347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002430164.1|1209543_1210020_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684342.1|1210107_1211010_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	3.9e-38
WP_059227769.1|1211069_1211792_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_044716548.1|1211775_1212063_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195235.1|1212238_1212496_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	3.0e-23
WP_000681105.1|1212527_1212905_-	membrane protein	NA	NA	NA	NA	NA
WP_001024864.1|1213173_1214859_+	transporter	NA	NA	NA	NA	NA
1215003:1215027	attL	ATGGGTTTTTTGTTGCCTGAAATTT	NA	NA	NA	NA
WP_000972391.1|1215093_1215312_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_113622820.1|1215402_1216503_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	1.1e-175
WP_042051079.1|1216499_1216985_-|tail	tail assembly protein	tail	E5G6Q2	Salmonella_phage	80.6	3.7e-67
WP_042051077.1|1216981_1220059_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_000763311.1|1220051_1220171_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_007866361.1|1220185_1220488_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	2.7e-39
WP_001207660.1|1220542_1221058_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_032182339.1|1221067_1222240_-|tail	tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	7.8e-204
WP_032181904.1|1222382_1222949_-	DNA-invertase	NA	A0A1S6L009	Salmonella_phage	84.8	1.9e-86
WP_072169361.1|1222979_1223372_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	37.5	2.1e-12
WP_033547106.1|1223373_1223817_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	61.9	9.6e-46
WP_033547104.1|1223788_1224391_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	93.5	2.2e-101
WP_113622821.1|1224390_1225890_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	88.2	1.9e-250
WP_113622822.1|1225886_1226492_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	5.8e-110
WP_113622823.1|1226484_1227393_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	2.0e-143
WP_000177591.1|1227379_1227739_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	8.0e-51
WP_113622824.1|1227735_1228314_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	88.0	5.0e-95
WP_042050682.1|1228412_1229933_+	phage protein	NA	A0A1S5SA14	Streptococcus_phage	28.8	6.5e-09
WP_042050681.1|1229936_1230389_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	76.4	4.7e-56
WP_001039944.1|1230381_1230813_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	4.4e-72
WP_001177677.1|1230775_1230979_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	6.1e-24
WP_113622825.1|1230908_1231337_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.6	1.1e-46
WP_042050675.1|1231333_1231711_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.8	1.8e-16
WP_033548140.1|1231712_1232225_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	6.9e-88
WP_000171568.1|1232205_1232421_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_044068280.1|1232424_1232631_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.6	9.0e-31
WP_000673520.1|1232630_1233095_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_033548139.1|1233190_1233841_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	95.8	1.9e-111
WP_000742526.1|1233844_1234903_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.7	7.6e-182
WP_044068282.1|1234919_1235732_-|capsid	phage capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	84.1	2.2e-120
WP_033548138.1|1235874_1237641_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_113622826.1|1237640_1238675_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	4.5e-171
WP_001059831.1|1240484_1240820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001154431.1|1241256_1241445_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_113622827.1|1241597_1244012_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.0	0.0e+00
WP_113622828.1|1244008_1244866_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.5	6.6e-160
WP_000752613.1|1244862_1245090_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244216.1|1245089_1245323_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	9.2e-32
WP_000996717.1|1245390_1245732_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956176.1|1245849_1246146_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000460893.1|1246153_1246663_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_001247707.1|1246695_1246917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047327.1|1247042_1247612_+	hypothetical protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
WP_000900883.1|1247627_1247819_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_000290950.1|1248007_1249060_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
1249135:1249159	attR	ATGGGTTTTTTGTTGCCTGAAATTT	NA	NA	NA	NA
>prophage 5
NZ_CP030778	Escherichia albertii strain 05-3106 chromosome, complete genome	4719667	1784021	1840694	4719667	tail,integrase,terminase,capsid,lysis,portal,head,transposase	Enterobacteria_phage(33.9%)	63	1786374:1786388	1836824:1836838
WP_000255946.1|1784021_1785044_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_113622913.1|1785057_1785195_-	chemotaxis protein	NA	NA	NA	NA	NA
1786374:1786388	attL	CTTCGCATTACGAAT	NA	NA	NA	NA
WP_113622914.1|1786416_1786617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059253771.1|1786759_1787416_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001247715.1|1791251_1791707_+	hypothetical protein	NA	Q9MBM1	Phage_Gifsy-1	46.9	4.7e-32
WP_000950786.1|1792122_1793103_-	NleB family type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	50.5	5.9e-88
WP_001144082.1|1794874_1795501_+	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.7e-25
WP_113623300.1|1796244_1796751_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	62.5	3.5e-52
WP_064755547.1|1796933_1797203_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	97.8	1.1e-44
WP_113622915.1|1797204_1798521_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	95.9	7.0e-68
WP_113622916.1|1798580_1799180_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	95.5	7.7e-107
WP_113622917.1|1802703_1803345_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	7.3e-95
WP_000194782.1|1803242_1803986_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	4.4e-144
WP_001152612.1|1803991_1804690_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847332.1|1804689_1805019_-|tail	tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	5.6e-59
WP_113622918.1|1805015_1807577_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.1	0.0e+00
WP_000459457.1|1807569_1808004_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479193.1|1807985_1808408_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_048237193.1|1808423_1809164_-|tail	tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	1.2e-128
WP_000683129.1|1809171_1809567_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_000975081.1|1809563_1810142_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000785282.1|1810153_1810507_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_032082989.1|1810518_1810914_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	7.4e-58
WP_000063280.1|1810955_1811981_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_001299443.1|1812036_1812369_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123248.1|1812378_1813698_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.8e-233
WP_001324962.1|1813678_1815280_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.9e-309
WP_000198149.1|1815276_1815483_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_113622919.1|1815479_1817405_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453576.1|1817379_1817925_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001383880.1|1818337_1819405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000654792.1|1819346_1819967_-	hypothetical protein	NA	A0A0U2RXY7	Escherichia_phage	53.2	1.9e-52
WP_000092252.1|1820383_1820842_-|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	73.0	7.3e-49
WP_000075170.1|1820838_1821336_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	1.6e-89
WP_000839596.1|1821335_1821551_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799667.1|1821618_1822671_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.9	2.6e-206
WP_001355891.1|1822820_1823015_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	100.0	1.8e-28
WP_000887614.1|1823286_1824618_+	NTPase	NA	R9TRQ8	Vibrio_phage	29.4	3.2e-20
WP_077943988.1|1824646_1825015_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	86.7	2.7e-54
WP_001542657.1|1825029_1826019_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	1.5e-192
WP_001061378.1|1826026_1826836_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.5	8.2e-152
WP_000767127.1|1826855_1827245_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_000210164.1|1827241_1827568_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_001369966.1|1827564_1828218_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.5e-127
WP_074167262.1|1828217_1828712_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.0	2.1e-86
WP_021527492.1|1828708_1829527_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	3.1e-122
WP_024167702.1|1829523_1829748_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	95.9	8.5e-35
WP_063084591.1|1829752_1830589_-	ash family protein	NA	Q8SBF3	Shigella_phage	98.9	6.0e-150
WP_000521508.1|1830585_1831137_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_000649477.1|1831180_1831381_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848749.1|1831471_1832146_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	99.6	6.0e-132
WP_048236847.1|1832242_1832446_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	94.9	1.9e-12
WP_113622920.1|1832498_1832714_-	hypothetical protein	NA	A5LH65	Enterobacteria_phage	96.3	1.4e-23
WP_000135680.1|1832813_1833176_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|1833241_1834066_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_113622921.1|1834193_1834730_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	99.4	1.6e-100
WP_001242749.1|1834720_1835083_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_113622922.1|1835082_1835388_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	2.0e-50
WP_000433939.1|1835387_1835738_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_064734231.1|1835839_1836778_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	4.7e-183
WP_044711688.1|1836982_1838236_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.5e-96
1836824:1836838	attR	CTTCGCATTACGAAT	NA	NA	NA	NA
WP_044711691.1|1838247_1839351_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.1	1.4e-61
WP_000749853.1|1839638_1840694_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.5	4.2e-116
>prophage 6
NZ_CP030778	Escherichia albertii strain 05-3106 chromosome, complete genome	4719667	1911168	1970512	4719667	tRNA,plate,transposase,protease	Escherichia_phage(22.22%)	49	NA	NA
WP_032278988.1|1911168_1911582_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_044714119.1|1911585_1913436_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348769.1|1913399_1914482_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_059219331.1|1914506_1915787_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001034128.1|1915783_1916308_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246452.1|1916310_1917642_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_044712016.1|1917646_1918408_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_059254475.1|1918416_1921176_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.3	1.5e-80
WP_044710921.1|1921172_1921916_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_113622936.1|1921920_1923330_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_044712774.1|1928248_1928731_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_113622937.1|1928764_1929679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113622938.1|1929688_1930156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025237593.1|1930316_1931093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102204143.1|1931506_1931737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002430287.1|1931625_1932357_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.1	4.9e-39
WP_000917887.1|1932421_1932889_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	6.1e-51
WP_002430288.1|1932885_1933608_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_044713561.1|1933641_1934397_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644672.1|1934468_1935827_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001230977.1|1936013_1936814_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_044713613.1|1937053_1937968_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000255946.1|1938472_1939495_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_001317493.1|1939491_1940274_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_113622939.1|1946323_1946536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044714067.1|1946635_1947208_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_044714064.1|1947395_1948427_+	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
WP_059238039.1|1948419_1949073_+	D-methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874219.1|1949112_1949928_+	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_001202318.1|1950045_1950450_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_044710249.1|1950446_1951154_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_059250773.1|1951264_1952983_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_072243721.1|1953025_1953727_-	copper homeostasis/adhesion lipoprotein NlpE	NA	NA	NA	NA	NA
WP_044708440.1|1953743_1954166_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185304.1|1954162_1954708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000417058.1|1954873_1955074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077871090.1|1955066_1955321_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_113622940.1|1955373_1956669_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901084.1|1956733_1957123_-	VOC family protein	NA	NA	NA	NA	NA
WP_000055744.1|1957476_1958436_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294809.1|1958448_1961931_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	1.8e-208
WP_054409729.1|1961967_1962564_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.8	4.2e-28
WP_044709366.1|1962560_1963709_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_113622941.1|1963708_1964497_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|1964500_1964956_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_113622942.1|1965060_1966086_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758953.1|1966089_1966575_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240910.1|1966697_1969130_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_025237610.1|1969159_1970512_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 7
NZ_CP030778	Escherichia albertii strain 05-3106 chromosome, complete genome	4719667	4052642	4061499	4719667	integrase	Enterobacteria_phage(87.5%)	12	NA	NA
WP_001052632.1|4052642_4053323_+	site-specific DNA-methyltransferase	NA	A0A0C5AFG8	Paenibacillus_phage	36.9	2.9e-25
WP_072243763.1|4054315_4054453_-|integrase	attP region and P4int integrase	integrase	NA	NA	NA	NA
WP_113623180.1|4054684_4057018_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.3	0.0e+00
WP_000856729.1|4057032_4057353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059238559.1|4057488_4057944_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	1.0e-63
WP_001244665.1|4057936_4058224_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_113623181.1|4058216_4058807_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	97.0	4.1e-68
WP_044710654.1|4058803_4059070_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	1.8e-44
WP_071527787.1|4059082_4059274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044716597.1|4059621_4060356_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	97.5	2.2e-127
WP_000638634.1|4060352_4060853_+	transactivation protein	NA	NA	NA	NA	NA
WP_044716598.1|4060926_4061499_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
>prophage 8
NZ_CP030778	Escherichia albertii strain 05-3106 chromosome, complete genome	4719667	4331696	4367325	4719667	terminase,lysis,portal,head,transposase	Enterobacteria_phage(47.17%)	54	NA	NA
WP_001163428.1|4331696_4331897_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_059228344.1|4331954_4332122_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.7e-27
WP_113623218.1|4332193_4332478_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	96.8	5.9e-49
WP_059229491.1|4333485_4333704_-	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	76.4	1.5e-23
WP_059229492.1|4333705_4333927_-	hypothetical protein	NA	K7P6F8	Enterobacteria_phage	73.0	1.0e-19
WP_113623219.1|4333928_4334342_-	hypothetical protein	NA	A0A0F6TJ66	Escherichia_coli_O157_typing_phage	63.9	2.6e-29
WP_059229494.1|4334352_4334550_-	hypothetical protein	NA	A0A1I9SEY0	Klebsiella_phage	83.1	2.8e-29
WP_059229496.1|4334551_4335199_-	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	98.0	1.1e-74
WP_059229498.1|4335195_4335714_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	64.2	4.0e-51
WP_044714260.1|4335710_4335875_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	96.3	6.0e-22
WP_001111280.1|4335885_4336182_-	DUF2856 family protein	NA	A0A220NRR0	Escherichia_phage	100.0	2.3e-51
WP_000168277.1|4336195_4336702_-	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	99.4	6.8e-80
WP_000365291.1|4336702_4337410_-	recombinase	NA	Q716E7	Shigella_phage	100.0	7.6e-138
WP_094248853.1|4338354_4338651_-	hypothetical protein	NA	K7PH98	Enterobacteria_phage	98.0	1.6e-49
WP_000213975.1|4338690_4338891_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_113623220.1|4338969_4339269_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	92.9	1.9e-29
WP_113623221.1|4339637_4340006_-	hypothetical protein	NA	K7P6G1	Enterobacteria_phage	97.5	1.4e-55
WP_000428318.1|4340023_4340740_-	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
WP_000620665.1|4340846_4341041_+	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
WP_001177649.1|4341149_4341428_+	transcriptional regulator	NA	K7P7A2	Enterobacteria_phage	98.9	4.7e-43
WP_000539336.1|4341610_4342501_+	hypothetical protein	NA	G5DA89	Enterobacteria_phage	99.7	3.4e-159
WP_113623222.1|4342475_4343927_+	helicase DnaB	NA	Q7Y2K5	Escherichia_phage	99.4	1.5e-276
WP_012602761.1|4343985_4344444_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.3e-81
WP_072728014.1|4344440_4344968_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	99.4	4.7e-100
WP_001254255.1|4344964_4345141_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_021571395.1|4345143_4345503_+	DUF2591 domain-containing protein	NA	G8EYI2	Enterobacteria_phage	94.1	1.0e-61
WP_000950962.1|4345502_4345679_+	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_001279421.1|4345671_4345941_+	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
WP_021571394.1|4345940_4346552_+	recombination protein NinG	NA	A0A088CQ20	Enterobacteria_phage	99.5	6.0e-99
WP_000144614.1|4346548_4346755_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_113623223.1|4346732_4347398_+	serine/threonine protein phosphatase	NA	A0A2D1GLI5	Escherichia_phage	98.6	1.1e-130
WP_023486198.1|4347394_4348018_+	antitermination protein	NA	A0A088CQ66	Enterobacteria_phage	99.5	1.2e-113
WP_000286100.1|4348696_4348900_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001504512.1|4348877_4349375_+	lysozyme	NA	I6R0P2	Salmonella_phage	99.4	2.9e-91
WP_032219523.1|4349463_4349901_+|lysis	lysis protein	lysis	I6RSJ6	Salmonella_phage	95.9	1.2e-69
WP_001139676.1|4349888_4350041_+	hypothetical protein	NA	A0A088CQ22	Enterobacteria_phage	100.0	1.2e-21
WP_057515753.1|4350203_4350446_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	98.8	3.7e-36
WP_000113732.1|4350448_4350889_+	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
WP_112864989.1|4350885_4352298_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	5.8e-278
WP_113623224.1|4352300_4354427_+|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.3	0.0e+00
WP_024008445.1|4354440_4355325_+	hypothetical protein	NA	Q716H1	Shigella_phage	99.3	1.8e-144
WP_113623225.1|4355336_4356608_+|head	head protein	head	Q9AYZ7	Salmonella_phage	95.3	1.5e-229
WP_000375637.1|4356650_4356836_+	hypothetical protein	NA	Q716G9	Shigella_phage	100.0	2.7e-26
WP_001535933.1|4356810_4357293_+	hypothetical protein	NA	Q9AYZ5	Salmonella_phage	98.8	1.2e-86
WP_113623226.1|4357301_4358720_+	hypothetical protein	NA	A5VW69	Enterobacteria_phage	99.2	2.3e-274
WP_113623227.1|4358719_4359568_+	hypothetical protein	NA	Q716G6	Shigella_phage	97.5	1.3e-102
WP_113623228.1|4359567_4360023_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.0	1.7e-85
WP_000964882.1|4360025_4360718_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_113623229.1|4360727_4362059_+	acyltransferase	NA	A0A2D1GLX5	Escherichia_phage	98.4	1.2e-213
WP_113623230.1|4362059_4364453_+	lytic transglycosylase domain-containing protein	NA	Q716G2	Shigella_phage	97.0	0.0e+00
WP_113623231.1|4364808_4364901_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000255946.1|4364914_4365937_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_001317493.1|4365933_4366716_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_113623232.1|4367058_4367325_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	90.5	1.2e-32
>prophage 9
NZ_CP030778	Escherichia albertii strain 05-3106 chromosome, complete genome	4719667	4609014	4680929	4719667	tRNA,tail,terminase,capsid,holin,lysis,head	Stx2-converting_phage(32.84%)	84	NA	NA
WP_001264857.1|4609014_4609965_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_044709393.1|4610261_4611701_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000020074.1|4612479_4613067_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_010342723.1|4613240_4614170_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_000097349.1|4614629_4616345_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_113623257.1|4616540_4618838_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_113623258.1|4619111_4620029_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059238903.1|4620035_4621193_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000569309.1|4621185_4622112_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_044709284.1|4622116_4622848_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001216963.1|4622828_4622936_-	membrane protein	NA	NA	NA	NA	NA
WP_113623259.1|4622995_4623697_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	95.6	2.0e-98
WP_000063648.1|4623717_4625004_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|4625037_4625292_-	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|4625310_4625445_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|4625448_4625691_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000206819.1|4625778_4626369_-	DUF551 domain-containing protein	NA	Q6H9Z7	Enterobacteria_phage	100.0	4.3e-118
WP_001014294.1|4626371_4626563_-	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_001242709.1|4626564_4627152_-	hypothetical protein	NA	Q9MCT8	Escherichia_phage	76.0	2.4e-97
WP_000008180.1|4627142_4627679_-	HD family hydrolase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.9	1.1e-99
WP_000081280.1|4627806_4628631_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_000135680.1|4628696_4629059_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_113623260.1|4629427_4629706_-	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	94.9	5.7e-12
WP_044716323.1|4629761_4630454_-	XRE family transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	3.7e-121
WP_113623312.1|4630427_4630580_+	amino acid permease	NA	NA	NA	NA	NA
WP_044716321.1|4630551_4630812_+	XRE family transcriptional regulator	NA	A0A0P0ZCZ7	Stx2-converting_phage	98.8	3.5e-40
WP_113623261.1|4631357_4632506_+	peptidase	NA	K7PLX4	Enterobacteria_phage	86.7	9.4e-178
WP_113623262.1|4632502_4632727_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	95.9	1.2e-36
WP_059214321.1|4632723_4633542_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_072249880.1|4633538_4634033_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	9.6e-87
WP_059214319.1|4634032_4634686_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	8.1e-126
WP_000210170.1|4634682_4635009_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767103.1|4635005_4635395_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_001061445.1|4635414_4636224_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	4.0e-151
WP_113623263.1|4636231_4637221_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	3.6e-194
WP_001205460.1|4637238_4637580_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131906.1|4637582_4638140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868396.1|4638126_4639053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917724.1|4639317_4639521_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_113623264.1|4639671_4640730_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	86.4	3.2e-180
WP_113623313.1|4641077_4641410_+	tellurite resistance protein TerB	NA	H6WZJ6	Escherichia_phage	98.2	1.6e-50
WP_000216636.1|4641406_4641574_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	74.5	1.1e-10
WP_113623265.1|4641888_4643739_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_000075198.1|4643862_4644024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113623266.1|4644022_4644238_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
WP_024239926.1|4644242_4644587_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	5.0e-58
WP_044711112.1|4644637_4645171_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	4.0e-99
WP_000661712.1|4645444_4646140_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_113623314.1|4646368_4646836_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	93.5	5.7e-73
WP_032163683.1|4647050_4647233_+	hypothetical protein	NA	H6WZK4	Escherichia_phage	100.0	4.5e-26
WP_000828070.1|4647168_4647495_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|4647626_4647827_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829192.1|4647868_4648234_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_016241041.1|4648522_4649086_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	94.9	3.3e-75
WP_021569243.1|4649082_4650744_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.7	0.0e+00
WP_044708943.1|4650807_4652745_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.4	0.0e+00
WP_001063096.1|4652789_4653011_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_024228536.1|4655375_4655702_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	99.1	3.5e-53
WP_001007905.1|4655711_4656062_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|4656058_4656505_+	hypothetical protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|4656501_4656846_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_044707997.1|4656912_4657629_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	1.6e-127
WP_001030043.1|4657634_4658009_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001234268.1|4658032_4658314_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	7.9e-46
WP_113623267.1|4658361_4661604_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	97.1	0.0e+00
WP_000807954.1|4661596_4661938_+|tail	tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_059214312.1|4661937_4662636_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	4.0e-131
WP_113623268.1|4662641_4663385_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	8.3e-151
WP_044712349.1|4663282_4663963_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.7	1.2e-111
WP_032146798.1|4663916_4664120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000649829.1|4664150_4664678_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_113623269.1|4664811_4668291_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	88.7	0.0e+00
WP_113623270.1|4668358_4668958_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	1.7e-109
WP_113623271.1|4669017_4670334_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	95.6	2.0e-70
WP_044710308.1|4670335_4670605_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	93.3	9.6e-41
WP_113623272.1|4670730_4671624_-	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_077882803.1|4672069_4673278_-	secretion protein EspV	NA	H6WZN3	Escherichia_phage	99.0	2.5e-229
WP_001261972.1|4673482_4673731_-	DNA-damage-inducible protein DinI	NA	H6WZN4	Escherichia_phage	97.6	4.5e-37
WP_002461809.1|4674245_4675931_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	97.7	2.7e-298
WP_002461811.1|4675927_4676647_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
WP_000950401.1|4676693_4677164_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	96.2	6.3e-80
WP_000643193.1|4677206_4677668_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	89.5	8.4e-69
WP_113623273.1|4677798_4679796_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	85.6	0.0e+00
WP_113623274.1|4679792_4680929_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	94.1	2.5e-159
>prophage 1
NZ_CP030779	Escherichia albertii strain 05-3106 plasmid unnamed1, complete sequence	56600	40307	47515	56600	transposase	Escherichia_phage(28.57%)	8	NA	NA
WP_000118342.1|40307_41321_-	hypothetical protein	NA	A0A2H4UUF0	Bodo_saltans_virus	37.4	1.5e-38
WP_113623322.1|41427_41694_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	44.6	7.1e-12
WP_001317493.1|41732_42515_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_000255946.1|42511_43534_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_000618110.1|44167_44416_+	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000457532.1|44849_46124_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.0	9.2e-142
WP_001278816.1|46125_46542_-	recombinase	NA	NA	NA	NA	NA
WP_113623323.1|46534_47515_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.7	2.7e-80
>prophage 1
NZ_CP030780	Escherichia albertii strain 05-3106 plasmid unnamed2, complete sequence	80627	44760	52930	80627	transposase	Escherichia_phage(16.67%)	17	NA	NA
WP_000255946.1|44760_45783_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_113623329.1|45796_45892_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_001337416.1|45968_46205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078164474.1|46135_46384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001393288.1|46380_46599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001332444.1|46821_46983_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_000872086.1|47190_47505_-	hypothetical protein	NA	I3UM57	Rhodobacter_phage	39.3	1.5e-13
WP_113623327.1|47501_48221_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845922.1|48217_48652_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000117113.1|48706_50674_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.3	1.1e-19
WP_077627212.1|50735_50996_-	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.2	2.5e-06
WP_077627213.1|51025_51592_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.1e-46
WP_001337416.1|51617_51854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001395724.1|51780_51975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024179982.1|51897_52281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071594459.1|52261_52456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297832.1|52366_52930_-	class I SAM-dependent methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	36.9	3.0e-20
