The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030783	Escherichia albertii strain 2012EL-1823B chromosome, complete genome	4809747	21824	145967	4809747	tail,terminase,lysis,transposase,protease,tRNA,integrase	Enterobacteria_phage(40.32%)	119	53653:53678	103599:103624
WP_077870790.1|21824_22289_+|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	48.9	2.4e-15
WP_113649424.1|24786_26166_-	DUF3578 domain-containing protein	NA	NA	NA	NA	NA
WP_113649425.1|26327_26669_-	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_113649426.1|26896_28246_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	34.1	2.1e-19
WP_113649427.1|28242_29832_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_113649428.1|30033_33546_-	type I restriction-modification system endonuclease	NA	NA	NA	NA	NA
WP_059221697.1|33733_34648_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_113649429.1|34693_35650_-	GTPase	NA	NA	NA	NA	NA
WP_000467859.1|35660_35864_-	DUF466 domain-containing protein	NA	NA	NA	NA	NA
WP_059221695.1|35983_38134_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_059221693.1|39159_40521_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091581.1|40738_41653_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_113649430.1|41791_42814_+	galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	24.9	2.3e-10
WP_059221689.1|42993_45285_-	phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase	NA	NA	NA	NA	NA
WP_072243621.1|45538_46033_-	DUF2501 domain-containing protein	NA	NA	NA	NA	NA
WP_059221687.1|46089_46827_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.4	2.9e-63
WP_059267525.1|46829_47369_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	1.7e-28
WP_059221683.1|47474_47948_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_059221681.1|47938_48709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059221677.1|51269_51947_+	DNA-binding transcriptional activator BglJ	NA	NA	NA	NA	NA
WP_059278757.1|51986_52775_-	hydroxamate siderophore iron reductase FhuF	NA	NA	NA	NA	NA
WP_113650733.1|52876_53152_+	DUF1435 domain-containing protein	NA	NA	NA	NA	NA
53653:53678	attL	CGGATAAGGCGTTCACGCCGCATCCG	NA	NA	NA	NA
WP_113649431.1|53809_54841_-	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_044714832.1|54943_55357_+	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_113649432.1|55325_55772_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000870691.1|55786_56464_+	dUMP phosphatase	NA	NA	NA	NA	NA
WP_001218290.1|56849_58088_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	97.8	8.5e-233
WP_113649433.1|58240_59836_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_001100636.1|59846_60032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001061365.1|60376_60571_-	DNA-binding protein	NA	A5LH59	Enterobacteria_phage	96.9	1.7e-31
WP_001084860.1|60570_60966_-	hypothetical protein	NA	U5P0J0	Shigella_phage	77.6	4.7e-20
WP_113649434.1|60967_61330_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.8	1.6e-35
WP_113649435.1|61326_61677_-	Eae protein	NA	A0A0P0ZBF8	Stx2-converting_phage	92.2	1.8e-55
WP_113649436.1|61667_62204_-	HD family hydrolase	NA	A5LH62	Enterobacteria_phage	98.9	8.2e-100
WP_113649437.1|62331_63156_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	3.9e-149
WP_000135682.1|63221_63584_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_072243620.1|63873_64095_+	hypothetical protein	NA	U5P0J5	Shigella_phage	86.4	5.1e-16
WP_059221658.1|64055_64571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848748.1|64771_65446_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|65536_65737_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_112046956.1|65780_66332_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	98.4	2.2e-100
WP_001250269.1|66507_66687_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_059221654.1|66676_67618_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	92.7	2.7e-138
WP_001332382.1|67614_68109_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_000066917.1|68108_68762_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000767111.1|68837_69227_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	3.5e-68
WP_113649438.1|69246_70056_+	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	99.3	6.9e-151
WP_113649439.1|70063_71053_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.3e-195
WP_015967852.1|71066_71819_+	antitermination protein	NA	Q8SBE4	Shigella_phage	100.0	2.8e-138
WP_000066486.1|72187_72403_+	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	75.0	5.9e-25
WP_024241858.1|73076_73292_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	95.8	5.0e-32
WP_059221646.1|73291_73789_+	lysozyme	NA	A5LH83	Enterobacteria_phage	98.8	1.9e-90
WP_059279625.1|73785_74223_+|lysis	lysis protein	lysis	K7P7F7	Enterobacteria_phage	98.6	1.3e-71
WP_113649440.1|74426_74981_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	94.9	2.0e-93
WP_113650734.1|74948_75089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421824.1|75486_76026_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	99.4	3.0e-94
WP_113649441.1|76034_78134_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.7	0.0e+00
WP_001072975.1|78130_78343_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_113649442.1|79648_80767_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.3	5.2e-165
WP_113649443.1|80777_81824_+	peptidase	NA	A5LH30	Enterobacteria_phage	99.1	2.1e-192
WP_012601989.1|81865_82234_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	9.7e-52
WP_001283147.1|82226_82502_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
WP_000677106.1|82513_83092_+|tail	tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001079419.1|83088_83490_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000211129.1|83500_84244_+|tail	tail protein	tail	A5LH35	Enterobacteria_phage	99.6	1.0e-132
WP_001300035.1|84303_84690_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|84698_85028_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_113649444.1|84999_88074_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	92.2	0.0e+00
WP_024241848.1|88070_88400_+|tail	tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	3.4e-56
WP_113649445.1|88399_89086_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	95.2	4.7e-124
WP_113649446.1|89090_89834_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.7e-148
WP_077827186.1|89731_90403_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.2	4.4e-103
WP_113649447.1|93945_94545_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	96.5	5.3e-108
WP_113649448.1|94604_97409_+	hypothetical protein	NA	Q6H9S9	Enterobacteria_phage	92.2	3.2e-54
WP_059222141.1|97546_97876_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_113649449.1|97984_98152_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	89.4	3.0e-16
WP_001217539.1|98267_98516_-	DNA-damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_059222140.1|98735_100322_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	4.1e-30
WP_059267519.1|100713_101319_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|101445_101607_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_000531524.1|101729_102803_+	patatin family protein	NA	NA	NA	NA	NA
WP_113649450.1|102799_103582_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_113649451.1|103629_104493_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
103599:103624	attR	CGGATAAGGCGTTCACGCCGCATCCG	NA	NA	NA	NA
WP_002430325.1|106271_107051_+	2-deoxyribose-5-phosphate aldolase	NA	NA	NA	NA	NA
WP_000477805.1|107177_108500_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.0	8.0e-80
WP_000816471.1|108551_109775_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224873.1|109831_110551_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_095576258.1|110627_111644_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000124621.1|111671_112316_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_113649452.1|112421_113390_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_001029698.1|113438_114821_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000093813.1|114841_116074_+	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_000046763.1|116194_117862_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	3.7e-42
WP_113649453.1|118068_120006_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_059222134.1|120095_120422_+	trp operon repressor	NA	NA	NA	NA	NA
WP_059222133.1|120567_121080_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_113649454.1|121129_121777_+	phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_000371660.1|121773_122643_-	right origin-binding protein	NA	NA	NA	NA	NA
WP_000875490.1|122854_123328_+	protein CreA	NA	NA	NA	NA	NA
WP_113649455.1|123340_124030_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	34.4	5.2e-30
WP_113649456.1|124029_125454_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	22.1	5.9e-12
WP_113649457.1|125511_126864_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|127059_127776_-	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_001303782.1|127871_128012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059267511.1|128411_129098_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001386572.1|129311_129377_+	thr operon leader peptide	NA	NA	NA	NA	NA
WP_113649458.1|129457_131920_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_059222126.1|131921_132854_+	homoserine kinase	NA	NA	NA	NA	NA
WP_113649459.1|132854_134141_+	threonine synthase	NA	NA	NA	NA	NA
WP_000738743.1|134353_134650_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000906164.1|134802_135579_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_059276064.1|135648_137079_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000130184.1|137359_138313_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	2.2e-10
WP_001094685.1|138427_139015_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528545.1|139223_139790_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_000833521.1|140677_141082_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|141456_143373_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118445.1|143461_144592_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	3.6e-28
WP_113649460.1|144854_145967_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP030783	Escherichia albertii strain 2012EL-1823B chromosome, complete genome	4809747	392825	444920	4809747	tail,terminase,head,lysis,holin,integrase,capsid,portal	Enterobacteria_phage(52.31%)	68	396681:396719	445353:445391
WP_000749853.1|392825_393881_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.5	4.2e-116
WP_025237534.1|394168_395272_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.1	1.1e-61
396681:396719	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATC	NA	NA	NA	NA
WP_000023575.1|396740_397901_-|integrase	site-specific integrase	integrase	K7P7R5	Enterobacteria_phage	100.0	1.2e-228
WP_059257052.1|398224_398569_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	1.3e-58
WP_000545733.1|398597_398765_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000002107.1|398837_399122_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_075329314.1|399114_399474_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	80.7	6.6e-37
WP_054250224.1|399470_400088_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	81.5	1.6e-46
WP_000763363.1|400084_400306_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_001386642.1|400404_400686_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548536.1|400696_400888_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|400860_401043_-	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|401039_401720_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000100847.1|401716_402502_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_077627909.1|402507_402924_-	Host-nuclease inhibitor protein gam	NA	C6ZCV5	Enterobacteria_phage	97.8	1.9e-72
WP_001130916.1|402878_403148_-	host cell division inhibitory peptide Kil	NA	M1FN78	Enterobacteria_phage	98.9	3.0e-42
WP_000065374.1|403227_403596_-	lambda prophage-derived protein ea10	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_113649517.1|403784_404666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000332935.1|404662_405118_-	Antitermination protein N	NA	J3JZZ6	Escherichia_phage	92.2	6.3e-61
WP_000618038.1|405337_405742_-	hypothetical protein	NA	Q716D7	Shigella_phage	98.5	7.3e-69
WP_000028394.1|405738_406371_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.0	4.6e-118
WP_001194218.1|406474_406690_+	XRE family transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000251073.1|406809_407103_+	hypothetical protein	NA	K7P6Y2	Enterobacteria_phage	100.0	2.8e-46
WP_000185509.1|407135_408035_+	Replication protein O	NA	A0A0K2FJ31	Enterobacteria_phage	98.7	2.5e-170
WP_113649518.1|408031_408733_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	97.9	7.1e-128
WP_000145931.1|408729_409020_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000810176.1|409307_409754_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_113649519.1|409750_410278_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	98.9	1.8e-99
WP_001254221.1|410274_410457_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
WP_113649520.1|410961_412734_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.5	0.0e+00
WP_001108084.1|413272_413839_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001223933.1|413813_414416_+	hypothetical protein	NA	A0A1U9AJF8	Stx1_converting_phage	95.1	1.2e-91
WP_113649521.1|414412_415078_+	serine/threonine protein phosphatase	NA	K7P721	Enterobacteria_phage	97.3	1.4e-128
WP_113649522.1|415074_415698_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	1.8e-111
WP_059276415.1|416325_416505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113649523.1|416511_416730_-	hypothetical protein	NA	A0A088CPS7	Enterobacteria_phage	78.3	2.4e-18
WP_113649524.1|416829_417153_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	99.1	3.8e-52
WP_000229392.1|417136_417613_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_059279625.1|417609_418047_+|lysis	lysis protein	lysis	K7P7F7	Enterobacteria_phage	98.6	1.3e-71
WP_113649440.1|418250_418805_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	94.9	2.0e-93
WP_113649525.1|418772_418955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113649526.1|419298_419844_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	97.2	1.3e-92
WP_052939138.1|419818_421744_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198149.1|421740_421947_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_113649527.1|421943_423545_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	97.7	1.3e-305
WP_113649528.1|423525_424845_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	95.2	2.6e-224
WP_032285278.1|424854_425187_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	2.9e-55
WP_113649529.1|425242_426268_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	2.2e-186
WP_072249383.1|426309_426705_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	9.1e-56
WP_059217889.1|426716_427070_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	9.9e-62
WP_113649530.1|427081_427660_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	84.4	2.2e-74
WP_059217891.1|427656_428052_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	96.9	2.5e-69
WP_113650737.1|428059_428800_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	96.7	1.5e-128
WP_113649531.1|428815_429238_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	5.3e-70
WP_024228736.1|429219_429645_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	9.8e-64
WP_113649532.1|429637_432199_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	88.0	0.0e+00
WP_113649533.1|432195_432525_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_113649534.1|432524_433223_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
WP_113649535.1|433227_433965_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	6.1e-146
WP_113649536.1|433862_434504_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.2	3.0e-93
WP_113649537.1|434564_437978_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	95.9	0.0e+00
WP_113649538.1|438038_439253_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	87.9	3.9e-73
WP_095575662.1|439254_439524_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	1.6e-43
WP_113649539.1|439631_440513_+	T3SS effector protein NleH	NA	A5LH48	Enterobacteria_phage	98.0	1.5e-162
WP_032329892.1|440736_441585_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	100.0	4.4e-156
WP_000358619.1|442819_443533_+	cytolethal distending toxin type I subunit CdtA	NA	A5LH52	Enterobacteria_phage	100.0	2.9e-137
WP_097308716.1|443529_444351_+	cytolethal distending toxin type I subunit CdtB	NA	A5LH53	Enterobacteria_phage	99.3	9.8e-153
WP_113649540.1|444347_444920_+	toxin	NA	A5LH54	Enterobacteria_phage	92.1	2.1e-98
445353:445391	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATC	NA	NA	NA	NA
>prophage 3
NZ_CP030783	Escherichia albertii strain 2012EL-1823B chromosome, complete genome	4809747	671288	687349	4809747	integrase	Enterobacteria_phage(54.17%)	28	671229:671275	697084:697130
671229:671275	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001299447.1|671288_672452_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
WP_000446905.1|672307_672679_-	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|672650_672929_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763390.1|672976_673195_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_001386642.1|673293_673575_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000129285.1|673585_674143_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_000682294.1|674135_674297_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
WP_000186833.1|674293_674974_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_001550842.1|674970_675756_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	2.4e-148
WP_000995433.1|675761_676058_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000233576.1|676133_676340_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000259990.1|676935_677691_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_113649607.1|677729_677960_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	66.7	3.2e-21
WP_001182903.1|678029_678569_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_113649608.1|679582_680284_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	6.4e-129
WP_000145915.1|680280_680583_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070442.1|680650_680983_+	multidrug SMR transporter	NA	NA	NA	NA	NA
WP_113649609.1|681237_682764_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	28.0	1.2e-31
WP_001445652.1|683228_683780_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_000881075.1|683789_684587_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_072254492.1|684703_684805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054342.1|684801_685257_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
WP_000224916.1|685256_685427_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_113649610.1|685419_685710_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.1e-46
WP_113649611.1|685706_686069_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.8	1.8e-58
WP_053884679.1|686065_686206_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	9.4e-08
WP_113649612.1|686291_686669_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.3	3.6e-54
WP_000780581.1|686824_687349_-	membrane protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
697084:697130	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 4
NZ_CP030783	Escherichia albertii strain 2012EL-1823B chromosome, complete genome	4809747	1001294	1072499	4809747	plate,tail,integrase,head,lysis,protease,portal,capsid	Salmonella_phage(67.92%)	82	1001201:1001220	1034988:1035007
1001201:1001220	attL	TCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000290950.1|1001294_1002347_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_000900883.1|1002535_1002727_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001047327.1|1002742_1003312_-	hypothetical protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
WP_001247707.1|1003437_1003659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460891.1|1003691_1004201_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956188.1|1004208_1004505_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	92.3	1.3e-22
WP_000934004.1|1004590_1004839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047086312.1|1004920_1005262_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	95.6	9.6e-54
WP_001244216.1|1005329_1005563_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	9.2e-32
WP_000752613.1|1005562_1005790_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_047086311.1|1005786_1006644_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.9	7.1e-162
WP_113649710.1|1006640_1009055_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.1	0.0e+00
WP_001154434.1|1009207_1009396_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001316229.1|1009334_1009640_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_033552781.1|1010101_1011862_+	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	28.8	1.2e-11
WP_024240750.1|1011903_1012929_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.6	4.9e-170
WP_001098431.1|1012928_1014695_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_113649711.1|1014837_1015671_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	3.2e-119
WP_000742511.1|1015687_1016746_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000059191.1|1016749_1017400_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673523.1|1017495_1017960_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000868175.1|1017959_1018163_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|1018166_1018382_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_096907980.1|1018401_1018875_+	lysozyme	NA	E5G6N1	Salmonella_phage	90.4	4.9e-80
WP_001513114.1|1018876_1019254_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.0e-16
WP_016232552.1|1019250_1019679_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.6	6.4e-47
WP_085949149.1|1019608_1019812_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	1.0e-23
WP_024240753.1|1019774_1020206_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	4.9e-71
WP_029796948.1|1020198_1020648_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	90.6	5.8e-67
WP_024240755.1|1020662_1021598_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	93.6	5.1e-174
WP_024240756.1|1021683_1022262_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.2e-93
WP_024240757.1|1022258_1022618_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	6.1e-51
WP_001583364.1|1022604_1023513_+	hypothetical protein	NA	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_024240758.1|1023505_1024111_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	91.5	1.7e-109
WP_024235286.1|1026237_1026687_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	68.5	1.3e-50
WP_016232560.1|1027126_1027693_+	DNA-invertase lambdoid prophage e14	NA	A0A0F7LA37	Escherichia_phage	86.3	6.4e-87
WP_024240761.1|1027835_1029008_+|tail	tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	1.0e-203
WP_001207660.1|1029017_1029533_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_016232562.1|1029587_1029890_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	1.4e-40
WP_000763311.1|1029904_1030024_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_113649712.1|1030016_1033028_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	72.0	0.0e+00
WP_024240763.1|1033024_1033510_+|tail	tail assembly protein	tail	E5G6Q2	Salmonella_phage	81.2	1.3e-67
WP_024240764.1|1033506_1034607_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	7.6e-177
WP_000972391.1|1034697_1034916_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_071825206.1|1035022_1035205_+	hypothetical protein	NA	NA	NA	NA	NA
1034988:1035007	attR	TCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_001024864.1|1035151_1036837_-	transporter	NA	NA	NA	NA	NA
WP_113649713.1|1037104_1037482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195235.1|1037513_1037771_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	3.0e-23
WP_044716548.1|1037946_1038234_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189180.1|1038217_1038940_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_059219873.1|1038999_1039902_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	33.6	1.1e-35
WP_002430164.1|1039989_1040466_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_113649714.1|1040662_1040833_+	putrescine/spermidine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059219872.1|1040816_1041929_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_059215684.1|1042023_1043157_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_025237300.1|1043166_1044120_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_059219870.1|1044116_1044962_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389264.1|1045021_1045510_+	DUF2593 family protein	NA	NA	NA	NA	NA
WP_059275779.1|1045550_1046702_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	1.6e-28
WP_002462427.1|1046843_1047575_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059219868.1|1047870_1048539_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_059219867.1|1048538_1049255_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_059219866.1|1049261_1049993_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027193.1|1050010_1050739_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.6	2.1e-29
WP_059219865.1|1050956_1051472_-	lipoprotein	NA	NA	NA	NA	NA
WP_113649715.1|1051597_1051921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059219864.1|1051917_1052748_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	2.5e-07
WP_024164829.1|1052744_1053758_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_113649716.1|1053856_1055287_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_113649717.1|1055297_1056299_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_113649718.1|1056336_1058055_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.6	3.3e-33
WP_000178653.1|1058187_1059156_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_059219862.1|1059167_1060820_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002462423.1|1060963_1061863_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_113649719.1|1062312_1063008_-	aquaporin Z	NA	NA	NA	NA	NA
WP_113649720.1|1063432_1065091_+	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
WP_059219860.1|1065087_1066080_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_113649721.1|1066194_1067310_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_113649722.1|1067306_1069253_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.1	5.9e-39
WP_000410785.1|1069324_1069549_-	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520793.1|1069871_1070192_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.6	5.3e-14
WP_025237287.1|1070222_1072499_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.8	3.3e-166
>prophage 5
NZ_CP030783	Escherichia albertii strain 2012EL-1823B chromosome, complete genome	4809747	1444450	1535491	4809747	tail,terminase,lysis,protease,holin,integrase	Enterobacteria_phage(43.14%)	92	1533617:1533633	1541925:1541941
WP_113649814.1|1444450_1445581_-|integrase	integrase	integrase	O21940	Phage_21	50.9	2.4e-101
WP_059219684.1|1445558_1445807_-	excisionase	NA	NA	NA	NA	NA
WP_113649815.1|1445871_1448331_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	1.0e-56
WP_001090221.1|1448423_1448615_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449200.1|1448611_1448800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113649816.1|1449302_1449503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001320327.1|1449471_1449837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032205458.1|1449848_1450001_-	DUF1391 domain-containing protein	NA	NA	NA	NA	NA
WP_059219935.1|1450263_1450683_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_059219678.1|1450784_1451066_+	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_113649817.1|1451049_1451475_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_072248488.1|1451498_1452461_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	58.3	5.1e-84
WP_113649818.1|1452467_1453214_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	80.5	6.2e-114
WP_113649819.1|1453185_1453998_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	86.6	2.5e-116
WP_113649820.1|1454005_1454422_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	69.8	4.8e-47
WP_113649821.1|1454580_1454988_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	52.2	8.0e-23
WP_113649822.1|1454984_1455332_+	DUF551 domain-containing protein	NA	Q08J61	Stx2-converting_phage	57.9	1.9e-28
WP_000813269.1|1456972_1457128_+	protein HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_072256172.1|1457295_1457574_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_113649823.1|1457575_1458631_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	2.9e-88
WP_113649824.1|1458631_1459012_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	2.6e-36
WP_059278988.1|1459008_1459830_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.4	5.9e-81
WP_000839572.1|1460570_1460786_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_113649825.1|1461871_1462405_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.6	2.8e-100
WP_113649826.1|1462401_1462869_+|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	89.7	2.7e-67
WP_000373425.1|1463485_1463980_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_113649827.1|1463979_1466082_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	98.4	0.0e+00
WP_001072975.1|1466078_1466291_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_113649442.1|1467596_1468715_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.3	5.2e-165
WP_113649443.1|1468725_1469772_+	peptidase	NA	A5LH30	Enterobacteria_phage	99.1	2.1e-192
WP_012601989.1|1469813_1470182_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	9.7e-52
WP_001283147.1|1470174_1470450_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
WP_000677106.1|1470461_1471040_+|tail	tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001079419.1|1471036_1471438_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000211129.1|1471448_1472192_+|tail	tail protein	tail	A5LH35	Enterobacteria_phage	99.6	1.0e-132
WP_001300035.1|1472252_1472639_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|1472647_1472977_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_113649444.1|1472948_1476023_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	92.2	0.0e+00
WP_024241848.1|1476019_1476349_+|tail	tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	3.4e-56
WP_113649446.1|1477038_1477782_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.7e-148
WP_077827186.1|1477679_1478351_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.2	4.4e-103
WP_113649828.1|1478411_1481825_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	95.2	0.0e+00
WP_113649829.1|1481894_1482494_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	95.5	3.5e-107
WP_113649830.1|1482553_1483867_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	2.2e-77
WP_001023431.1|1483868_1484138_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
WP_059260084.1|1484251_1484842_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	44.8	5.9e-35
WP_059268216.1|1484902_1485547_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	59.9	2.9e-67
WP_072248026.1|1485659_1486295_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	78.7	9.5e-63
WP_059258132.1|1486423_1487482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059221814.1|1487585_1488212_-	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	38.4	2.4e-26
WP_059217928.1|1488394_1488985_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_113650749.1|1488971_1489094_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_113649831.1|1489075_1489273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113649832.1|1489991_1490798_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_059221811.1|1490797_1491991_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_025237097.1|1493363_1494959_-	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	6.5e-52
WP_059221810.1|1494958_1496521_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1496612_1496657_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_113649833.1|1496794_1497676_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_010332801.1|1497672_1498293_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291224.1|1498393_1499269_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_059275761.1|1499438_1500461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059221807.1|1500470_1500779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288268.1|1500833_1501424_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_059221805.1|1501420_1502179_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.8	1.5e-06
WP_059221804.1|1502397_1503447_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	30.9	1.5e-20
WP_001031530.1|1503481_1503733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113649834.1|1504113_1506711_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	36.2	1.3e-89
WP_025237091.1|1506921_1507896_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_059221803.1|1508155_1510831_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_001176289.1|1510893_1511484_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.2	2.9e-42
WP_113649835.1|1511653_1512418_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_000876304.1|1512566_1512875_+	LapA family protein	NA	NA	NA	NA	NA
WP_000891362.1|1512881_1514051_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_113649836.1|1514241_1514979_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_010332626.1|1514978_1515305_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_000471009.1|1515429_1515648_-	osmotically-inducible lipoprotein B	NA	NA	NA	NA	NA
WP_001088632.1|1515915_1516665_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_113649837.1|1516753_1516927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113649838.1|1517073_1519059_-	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_102204214.1|1519113_1519185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113649839.1|1519294_1521229_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	28.3	2.8e-33
WP_113649840.1|1521296_1522424_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_059258494.1|1522567_1523356_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_113649841.1|1523879_1524446_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059268207.1|1524594_1525716_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_059221795.1|1528826_1530200_+	TolC family protein	NA	NA	NA	NA	NA
WP_059275753.1|1530208_1531381_+	MFS transporter	NA	S4TR35	Salmonella_phage	26.3	1.5e-26
WP_059218363.1|1531435_1532242_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.2	1.0e-13
WP_001128851.1|1532243_1533236_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146159.1|1533235_1534126_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
1533617:1533633	attL	CAGCAGCGCCAGCCAGA	NA	NA	NA	NA
WP_059268203.1|1534303_1535491_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.4	4.4e-114
WP_059268203.1|1534303_1535491_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.4	4.4e-114
1541925:1541941	attR	CAGCAGCGCCAGCCAGA	NA	NA	NA	NA
>prophage 6
NZ_CP030783	Escherichia albertii strain 2012EL-1823B chromosome, complete genome	4809747	1570628	1592348	4809747	tRNA	Escherichia_phage(66.67%)	30	NA	NA
WP_059221778.1|1570628_1571861_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	40.0	8.1e-18
WP_000387364.1|1572115_1573099_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_032275239.1|1573373_1573547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059268187.1|1573576_1574950_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	1.1e-50
WP_113649852.1|1575052_1575988_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	2.1e-143
WP_072249326.1|1576039_1577275_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	97.8	4.3e-237
WP_048969784.1|1577276_1577492_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	98.6	8.7e-37
WP_059278634.1|1577590_1577779_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	95.1	1.0e-25
WP_113650750.1|1577771_1578002_-	restriction alleviation protein, Lar family	NA	A0A0U2QQP4	Escherichia_phage	86.6	4.7e-28
WP_113649853.1|1577998_1578679_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	95.6	2.0e-127
WP_000100866.1|1578675_1579455_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	94.6	4.0e-140
WP_113649854.1|1579460_1579757_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	81.6	1.2e-39
WP_113649855.1|1581803_1582079_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	92.3	2.2e-40
WP_113649856.1|1582153_1582324_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	67.9	1.3e-14
WP_048969779.1|1582323_1582545_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	93.2	2.2e-35
WP_072248141.1|1582758_1582950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113649857.1|1583045_1583474_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_113649858.1|1583470_1583626_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	4.0e-07
WP_072248140.1|1583636_1583771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000753628.1|1584020_1584482_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	100.0	3.4e-78
WP_113650751.1|1584658_1584865_+	DNA-binding protein	NA	A0A0U2S629	Escherichia_phage	100.0	2.0e-22
WP_059259889.1|1584848_1585271_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	5.0e-68
WP_059259888.1|1585348_1586125_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.2	3.0e-42
WP_113649859.1|1586131_1586878_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	79.3	1.2e-112
WP_113649860.1|1586849_1587662_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.6	8.8e-114
WP_113649861.1|1587669_1588086_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	69.8	6.2e-47
WP_113650752.1|1588932_1589115_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	83.6	1.0e-17
WP_113649862.1|1589176_1589389_+	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	85.7	1.0e-21
WP_113649863.1|1590703_1590925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113649864.1|1590986_1592348_-	type III secretion protein GogB	NA	Q9MBM1	Phage_Gifsy-1	31.1	2.8e-56
>prophage 7
NZ_CP030783	Escherichia albertii strain 2012EL-1823B chromosome, complete genome	4809747	1855242	1944869	4809747	tail,terminase,integrase,head,transposase,lysis,protease,tRNA,portal,capsid	Escherichia_phage(24.19%)	111	1917028:1917043	1931812:1931827
WP_113649937.1|1855242_1857621_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.9	2.5e-172
WP_113649938.1|1857953_1858787_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_001082208.1|1858943_1859990_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	1.5e-84
WP_113649939.1|1860031_1861468_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	34.5	1.6e-54
WP_059220067.1|1861530_1862244_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001209772.1|1862488_1862953_-	endopeptidase	NA	S5MM68	Bacillus_phage	38.5	1.9e-12
WP_059220066.1|1863035_1863785_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A285PWH2	Cedratvirus	28.6	2.1e-08
WP_001154203.1|1863784_1864336_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_113649940.1|1864398_1865379_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.9	6.7e-15
WP_001229265.1|1865479_1865779_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_113649941.1|1865783_1868171_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_113649942.1|1868185_1869169_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|1869452_1869497_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124856.1|1869619_1869976_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|1870028_1870226_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_032274990.1|1870322_1870865_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.5	1.7e-15
WP_001144207.1|1870868_1872797_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	8.0e-129
WP_113649943.1|1873095_1873407_+	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_001142446.1|1873821_1873929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001402280.1|1873981_1874740_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_000251717.1|1875026_1875956_+	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_113649944.1|1876054_1876345_+	endoribonuclease GhoS	NA	NA	NA	NA	NA
WP_113649945.1|1876449_1877310_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_059267629.1|1877378_1878443_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_059218843.1|1878484_1879036_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_000222152.1|1879307_1879844_-	membrane protein	NA	NA	NA	NA	NA
WP_000106815.1|1879990_1880659_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_000123136.1|1880821_1881412_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_113649946.1|1881544_1882936_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_113649947.1|1882937_1883711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001241548.1|1883873_1884137_-	cell division activator CedA	NA	NA	NA	NA	NA
WP_113649948.1|1884381_1885146_-	chitin disaccharide deacetylase	NA	NA	NA	NA	NA
WP_113649949.1|1885158_1886511_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_000983635.1|1886614_1887457_-	transcriptional regulator ChbR	NA	NA	NA	NA	NA
WP_024164878.1|1887464_1887815_-	N,N'-diacetylchitobiose-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
WP_000073054.1|1887868_1889227_-	PTS N,N'-diacetylchitobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000412169.1|1889308_1889629_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_071825350.1|1889612_1889738_+	acetyltransferase	NA	NA	NA	NA	NA
WP_001039036.1|1889927_1890266_-	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_025238921.1|1890464_1891292_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	55.3	3.1e-74
WP_113649950.1|1891363_1891624_-	ves domain protein	NA	NA	NA	NA	NA
WP_113649951.1|1891838_1893112_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_113650756.1|1893158_1893251_+	ferredoxin	NA	NA	NA	NA	NA
WP_059274358.1|1893237_1893828_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_113649952.1|1894009_1894636_+	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	38.4	9.1e-26
WP_113649953.1|1894714_1895350_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	73.2	2.0e-60
WP_113649514.1|1895628_1896793_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	47.0	1.2e-74
WP_113649954.1|1896873_1897143_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	8.4e-45
WP_113649955.1|1897144_1898458_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.6	9.1e-76
WP_113649956.1|1898517_1899117_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	95.0	8.5e-106
WP_113649514.1|1901180_1902346_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	47.0	1.2e-74
WP_113649957.1|1902373_1903723_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.5	5.9e-256
WP_113649958.1|1903783_1904431_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	92.6	6.4e-107
WP_113649959.1|1904328_1905072_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.9	4.4e-144
WP_059217866.1|1905076_1905775_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.1	1.9e-128
WP_001115181.1|1905774_1906116_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.4	7.1e-41
WP_113650757.1|1909393_1909654_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	2.7e-40
WP_001312914.1|1909695_1910082_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.8e-64
WP_113649960.1|1910081_1910786_-|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	95.3	2.8e-116
WP_113649961.1|1910846_1911191_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
WP_000968644.1|1911187_1911637_-	hypothetical protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_113649962.1|1911633_1911972_-|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	90.2	2.6e-51
WP_000719066.1|1911980_1912298_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_113649963.1|1912342_1913569_-|capsid	phage major capsid protein	capsid	Q8W627	Enterobacteria_phage	91.9	1.8e-206
WP_077629529.1|1913582_1914269_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	99.5	7.0e-120
WP_113649964.1|1914210_1915452_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	94.7	7.9e-231
WP_000478599.1|1915451_1915634_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	80.0	8.2e-20
WP_113649965.1|1916631_1916811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113649966.1|1916897_1918559_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.5	2.6e-277
1917028:1917043	attL	GATTTTTTCTTGTTCG	NA	NA	NA	NA
WP_001353110.1|1918542_1918899_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	83.8	6.1e-51
WP_109553801.1|1919018_1919195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109553794.1|1919187_1919628_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	74.7	3.5e-64
WP_113649967.1|1919627_1919930_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	62.1	4.7e-28
WP_113649968.1|1919922_1921137_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	86.8	2.4e-208
WP_113649969.1|1921138_1921699_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	83.9	4.9e-87
WP_113649970.1|1921753_1922923_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	75.8	5.1e-163
WP_001053661.1|1923209_1923716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105472038.1|1923751_1924000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113649971.1|1924343_1924769_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_113649972.1|1924978_1927099_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	53.8	1.6e-175
WP_097335777.1|1927095_1927410_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001307906.1|1927416_1927650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113649973.1|1927624_1927870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113649974.1|1927818_1928076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113650758.1|1928068_1929145_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_113649975.1|1929322_1929904_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	60.1	2.2e-50
WP_021530547.1|1929961_1930240_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_032166742.1|1930303_1930525_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_032191485.1|1930502_1931726_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	46.6	2.3e-97
WP_001140906.1|1931731_1932925_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.7	2.5e-197
1931812:1931827	attR	CGAACAAGAAAAAATC	NA	NA	NA	NA
WP_113649976.1|1932924_1933407_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	1.1e-84
WP_113649977.1|1933554_1933905_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	3.3e-65
WP_077487348.1|1934009_1934192_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	73.8	4.2e-16
WP_032275013.1|1934408_1934906_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	98.2	1.4e-90
WP_021555247.1|1934905_1935121_-|lysis	phage lysis protein	lysis	M1FN85	Enterobacteria_phage	95.8	1.0e-32
WP_059245575.1|1935844_1936534_-	antiterminator	NA	I6PDF8	Cronobacter_phage	47.6	1.2e-55
WP_000139994.1|1936530_1936896_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	4.2e-39
WP_113649978.1|1936896_1937952_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	1.1e-87
WP_113649979.1|1937953_1938232_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	3.9e-05
WP_059278996.1|1938528_1938825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113649980.1|1939064_1939220_-	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.1	3.2e-17
WP_059278955.1|1939761_1940277_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	74.5	2.6e-34
WP_059278956.1|1940442_1940625_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_059278958.1|1940718_1941075_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.9e-58
WP_059278957.1|1941594_1942665_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	5.0e-64
WP_001700667.1|1942736_1943162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172735.1|1943158_1943461_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	1.1e-05
WP_072249393.1|1943495_1943930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135107.1|1943914_1944142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|1944143_1944422_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_072248456.1|1944713_1944869_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
>prophage 8
NZ_CP030783	Escherichia albertii strain 2012EL-1823B chromosome, complete genome	4809747	2160573	2202355	4809747	tail,terminase,integrase,head,lysis,transposase,portal,capsid	Enterobacteria_phage(37.21%)	50	2176840:2176855	2205188:2205203
WP_001023431.1|2160573_2160843_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
WP_113650032.1|2160844_2162158_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	95.2	8.5e-74
WP_113650033.1|2162219_2165633_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	95.8	0.0e+00
WP_113650034.1|2165704_2166334_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	83.0	6.1e-62
WP_113649535.1|2166231_2166969_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	6.1e-146
WP_113649534.1|2166973_2167672_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
WP_113649533.1|2167671_2168001_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_024228736.1|2170550_2170976_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	9.8e-64
WP_113649531.1|2170957_2171380_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	5.3e-70
WP_059217891.1|2172142_2172538_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	96.9	2.5e-69
WP_113649530.1|2172534_2173113_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	84.4	2.2e-74
WP_059217889.1|2173124_2173478_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	9.9e-62
WP_072249383.1|2173489_2173885_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	9.1e-56
WP_113649529.1|2173925_2174951_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	2.2e-186
WP_032285278.1|2175006_2175339_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	2.9e-55
WP_113649528.1|2175348_2176668_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	95.2	2.6e-224
WP_113650035.1|2176648_2178253_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	97.9	2.7e-300
2176840:2176855	attL	CGGCTTCTATCAGCAT	NA	NA	NA	NA
WP_000198149.1|2178245_2178452_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_052939138.1|2178448_2180374_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_113649526.1|2180348_2180894_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	97.2	1.3e-92
WP_059222288.1|2181292_2181430_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	82.2	1.5e-13
WP_059222289.1|2181598_2181913_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_101750478.1|2182218_2182314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059222290.1|2182397_2182865_-|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	92.9	4.2e-68
WP_113650036.1|2182861_2183359_-	lysozyme	NA	A5LH83	Enterobacteria_phage	98.2	9.3e-90
WP_000839596.1|2183358_2183574_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_024246368.1|2184288_2184852_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_072251268.1|2185382_2185505_-	antiterminator	NA	NA	NA	NA	NA
WP_059222310.1|2185535_2186225_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	2.1e-60
WP_054413016.1|2186221_2186587_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	4.2e-39
WP_059259435.1|2186587_2187643_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	8.3e-88
WP_113650037.1|2187644_2187923_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	3.3e-12
WP_001406737.1|2188090_2188246_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	94.1	1.2e-16
WP_113650038.1|2188317_2189406_+|transposase	transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.8	3.0e-08
WP_059276472.1|2189897_2190245_-	DUF551 domain-containing protein	NA	Q08J61	Stx2-converting_phage	56.5	6.8e-31
WP_113649514.1|2190302_2191468_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	47.0	1.2e-74
WP_113650039.1|2191490_2191904_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	57.3	7.6e-21
WP_059225508.1|2192062_2192479_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	68.3	1.2e-45
WP_059259428.1|2192486_2193248_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.2	4.1e-113
WP_113650040.1|2193271_2194018_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	79.7	1.5e-112
WP_113650041.1|2194024_2194987_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	58.3	5.1e-84
WP_059259424.1|2195010_2195436_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_059217915.1|2195458_2195755_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	46.4	4.3e-10
WP_059222065.1|2195878_2196355_+	DNA-binding protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000379569.1|2196671_2196824_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_059222115.1|2196835_2197474_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	7.4e-07
WP_001133037.1|2197474_2197684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113650042.1|2198596_2201068_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.2	5.0e-59
WP_000096344.1|2201126_2201330_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_059222069.1|2201329_2202355_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	5.2e-103
2205188:2205203	attR	ATGCTGATAGAAGCCG	NA	NA	NA	NA
>prophage 9
NZ_CP030783	Escherichia albertii strain 2012EL-1823B chromosome, complete genome	4809747	2264080	2275948	4809747		Enterobacteria_phage(33.33%)	11	NA	NA
WP_103767977.1|2264080_2264626_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.7	3.7e-55
WP_113650068.1|2264646_2265666_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI8	Catovirus	36.5	2.4e-44
WP_113650069.1|2265725_2266838_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	28.7	5.6e-26
WP_113650763.1|2266842_2267928_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L470	Tupanvirus	33.5	2.4e-29
WP_024233747.1|2267957_2268773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113650070.1|2268854_2269730_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.0	4.0e-104
WP_113650071.1|2269787_2270687_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.1	5.7e-29
WP_113650072.1|2270686_2271772_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	3.3e-100
WP_113650073.1|2272141_2273035_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_113650074.1|2273171_2273393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113650075.1|2274364_2275948_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	2.1e-34
>prophage 10
NZ_CP030783	Escherichia albertii strain 2012EL-1823B chromosome, complete genome	4809747	2284316	2359090	4809747	tail,terminase,transposase,head,lysis,holin,tRNA,portal	Enterobacteria_phage(28.12%)	60	NA	NA
WP_113650078.1|2284316_2285669_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	4.1e-07
WP_103054298.1|2285955_2286012_-	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_102204210.1|2286282_2286339_-	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_071529690.1|2286474_2286663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059277574.1|2286930_2288253_+	hypothetical protein	NA	H6WZN2	Escherichia_phage	76.4	9.1e-201
WP_072249333.1|2288559_2289204_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	58.5	1.3e-64
WP_072243672.1|2289278_2289914_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	71.3	5.0e-56
WP_059222121.1|2290565_2290793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059217651.1|2291472_2292033_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	68.6	1.1e-65
WP_001023431.1|2292147_2292417_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
WP_113650032.1|2292418_2293732_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	95.2	8.5e-74
WP_113650079.1|2293793_2297207_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	95.9	0.0e+00
WP_025238684.1|2297340_2297862_+	superoxide dismutase	NA	Q9MC02	Salmonella_phage	66.7	2.0e-63
WP_072243911.1|2297904_2298546_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.2	3.6e-94
WP_113650080.1|2298443_2299187_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	1.0e-148
WP_113650081.1|2299191_2299890_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	95.7	1.3e-129
WP_000847335.1|2299889_2300219_-|tail	tail protein	tail	A0A2R9YJM0	Escherichia_phage	98.2	1.5e-56
WP_113649514.1|2301143_2302308_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	47.0	1.2e-74
WP_113650082.1|2302719_2304312_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	8.4e-185
WP_000259002.1|2304308_2304515_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_113650083.1|2306397_2306946_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	83.5	2.3e-57
WP_048969873.1|2307328_2307469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059222296.1|2307436_2307991_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	87.0	1.5e-85
WP_059222297.1|2308204_2308672_-|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	90.3	1.1e-68
WP_032274775.1|2308668_2309166_-	lysozyme	NA	A5LH83	Enterobacteria_phage	98.8	1.9e-90
WP_000284524.1|2309165_2309381_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_059222268.1|2311106_2311820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|2312027_2312717_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|2312731_2312854_-	YlcG family protein	NA	NA	NA	NA	NA
WP_059222269.1|2313190_2314150_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_113650084.1|2316478_2317726_+	multidrug transporter subunit MdtA	NA	NA	NA	NA	NA
WP_113650085.1|2320847_2323925_+	multidrug transporter subunit MdtC	NA	NA	NA	NA	NA
WP_113650086.1|2323925_2325272_+	MFS transporter	NA	NA	NA	NA	NA
WP_113650087.1|2325328_2326732_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.5e-33
WP_000137865.1|2326728_2327451_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	8.3e-31
WP_054412170.1|2327638_2327971_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_113650088.1|2328118_2329480_+	U32 family peptidase	NA	Q6DW11	Phage_TP	98.4	2.3e-215
WP_072179090.1|2330139_2330916_+	cytolethal distending toxin type II subunit CdtA	NA	G1BEM3	Escherichia_phage	93.8	1.1e-126
WP_059219457.1|2330912_2331722_+	cytolethal distending toxin type II subunit CdtB	NA	G1BEM4	Escherichia_phage	94.4	1.7e-141
WP_059219458.1|2331736_2332282_+	cytolethal distending toxin type II subunit CdtC	NA	M1SNM4	Escherichia_phage	90.1	8.3e-92
WP_095575843.1|2332615_2333515_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.2	1.3e-12
WP_059218213.1|2333605_2334658_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_059279076.1|2334912_2336190_+	MFS transporter	NA	NA	NA	NA	NA
WP_059268543.1|2336186_2337191_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	27.7	3.4e-14
WP_113650089.1|2337187_2338153_+	sugar kinase	NA	NA	NA	NA	NA
WP_113650090.1|2338126_2338873_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_113650091.1|2338918_2340262_-	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_113650092.1|2342929_2345503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025238750.1|2345588_2346404_-	hypothetical protein	NA	D0R7H8	Paenibacillus_phage	37.6	9.4e-23
WP_025238749.1|2346469_2347270_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_113650093.1|2347266_2348055_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019947.1|2348277_2348550_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_113650094.1|2348670_2349492_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_025238745.1|2349709_2350048_+	heavy metal resistance protein	NA	NA	NA	NA	NA
WP_113650095.1|2350129_2351164_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_113650765.1|2353674_2354349_-	fimbrial assembly protein	NA	NA	NA	NA	NA
WP_000830488.1|2354439_2354982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001046485.1|2355273_2355555_-	DUF2574 family protein	NA	NA	NA	NA	NA
WP_001005464.1|2355815_2356925_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_113650096.1|2357056_2359090_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	28.0	2.3e-57
>prophage 11
NZ_CP030783	Escherichia albertii strain 2012EL-1823B chromosome, complete genome	4809747	2370338	2379710	4809747		Enterobacteria_phage(85.71%)	10	NA	NA
WP_113650099.1|2370338_2371400_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	86.6	1.7e-141
WP_113650100.1|2371396_2373394_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	85.1	0.0e+00
WP_000643193.1|2373524_2373986_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	89.5	8.4e-69
WP_000950403.1|2374028_2374499_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	96.8	2.2e-80
WP_113650101.1|2374545_2375265_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
WP_059278477.1|2375261_2376947_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	97.5	1.7e-297
WP_001240387.1|2377168_2377900_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	96.5	2.2e-108
WP_001216963.1|2377959_2378067_+	membrane protein	NA	NA	NA	NA	NA
WP_113650102.1|2378047_2378779_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569309.1|2378783_2379710_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 12
NZ_CP030783	Escherichia albertii strain 2012EL-1823B chromosome, complete genome	4809747	2597619	2660872	4809747	terminase,head,lysis,holin,coat,tRNA,portal	Enterobacteria_phage(43.86%)	80	NA	NA
WP_001283571.1|2597619_2598432_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_113650164.1|2598431_2599445_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_113650165.1|2599510_2600647_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	2.2e-22
WP_059250533.1|2600745_2601729_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_059219569.1|2601725_2602904_-	arabinose transporter	NA	NA	NA	NA	NA
WP_059275159.1|2603179_2604400_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_113650166.1|2604558_2606565_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_025238639.1|2606845_2607133_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089214.1|2607166_2607715_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000379359.1|2607714_2608524_-	membrane protein	NA	NA	NA	NA	NA
WP_059275157.1|2608523_2609348_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_059275156.1|2609351_2610437_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.1	6.3e-91
WP_113650167.1|2610471_2611404_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_059275155.1|2611568_2612120_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_059219574.1|2612442_2613285_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_059275153.1|2613286_2613817_-	fimbrial protein	NA	NA	NA	NA	NA
WP_059219576.1|2613813_2614293_-	fimbrial protein	NA	NA	NA	NA	NA
WP_059219577.1|2614289_2614793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195822.1|2615579_2616065_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_113650168.1|2616267_2618412_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_059219579.1|2618411_2619722_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_113650169.1|2619902_2620187_-	DUF406 family protein	NA	NA	NA	NA	NA
WP_059219580.1|2620558_2621899_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776777.1|2621960_2622716_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_113650170.1|2623391_2624549_+	DUF4102 domain-containing protein	NA	K7P7E1	Enterobacteria_phage	99.0	1.1e-221
WP_113650171.1|2624627_2626793_-	hypothetical protein	NA	Q9AYY6	Salmonella_phage	92.2	1.6e-61
WP_113650172.1|2626879_2627389_+	HNH endonuclease	NA	A0A291AXK3	Shigella_phage	44.9	3.4e-31
WP_001407254.1|2627501_2627789_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	64.2	7.9e-25
WP_001085227.1|2627803_2628025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113650173.1|2628024_2628753_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	66.0	4.4e-80
WP_113650174.1|2628841_2629552_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	71.4	2.8e-87
WP_000655894.1|2629541_2629715_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	89.1	1.5e-18
WP_024139083.1|2629826_2630210_+	Arc family DNA-binding protein	NA	I6RSL2	Salmonella_phage	84.3	3.7e-54
WP_113650768.1|2630275_2630644_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	97.5	2.5e-63
WP_113650175.1|2630668_2632507_-	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	74.3	3.1e-247
WP_113650176.1|2632506_2633913_-	acyltransferase	NA	I6RSG0	Salmonella_phage	55.2	1.2e-126
WP_032153668.1|2633922_2634618_-	hypothetical protein	NA	G5DA80	Enterobacteria_phage	99.4	1.4e-91
WP_000614033.1|2634620_2635076_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	99.3	6.7e-87
WP_113650177.1|2635075_2635924_-	hypothetical protein	NA	Q716G6	Shigella_phage	92.9	3.4e-100
WP_113650178.1|2635923_2637342_-	hypothetical protein	NA	A0A088CQ70	Enterobacteria_phage	99.4	2.7e-275
WP_001140510.1|2637351_2637813_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_113650179.1|2637793_2637982_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	98.4	8.5e-28
WP_113650180.1|2638023_2639277_-|coat	coat protein	coat	A0A088CQ56	Enterobacteria_phage	98.1	6.5e-233
WP_113650181.1|2639295_2640189_-	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	98.3	2.2e-129
WP_113650182.1|2640279_2642478_-|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	98.4	0.0e+00
WP_113650183.1|2642479_2643895_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.6	7.5e-278
WP_000113731.1|2643891_2644332_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_000807788.1|2644334_2644577_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_089520360.1|2644680_2645052_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	89.4	5.9e-57
WP_113650184.1|2645210_2645753_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	98.9	2.7e-98
WP_001385991.1|2645956_2646394_-|lysis	lysis protein	lysis	Q9MCN3	Enterobacteria_phage	98.6	8.5e-71
WP_096940076.1|2646390_2646867_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	99.4	2.4e-87
WP_000783734.1|2646850_2647174_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_113650185.1|2647662_2648151_-	antiterminator	NA	M1FPN0	Enterobacteria_phage	98.8	7.7e-89
WP_113650186.1|2648194_2648800_-	recombination protein NinG	NA	K7PHP1	Enterobacterial_phage	97.0	3.1e-95
WP_113650187.1|2648792_2648963_-	protein ninF	NA	M1FPE8	Enterobacteria_phage	94.6	1.8e-24
WP_001254251.1|2648959_2649142_-	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.3e-28
WP_000153270.1|2649138_2649666_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_113650188.1|2649662_2650109_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	91.9	2.9e-74
WP_113650189.1|2650395_2651772_-	replicative DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	99.3	1.8e-252
WP_113650190.1|2651768_2652590_-	replication of DNA	NA	K7PJZ3	Enterobacterial_phage	98.9	2.8e-152
WP_113650191.1|2652770_2653070_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	98.0	1.1e-48
WP_000064149.1|2653208_2653442_-	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	98.7	2.3e-35
WP_000428099.1|2653555_2654260_+	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	99.6	4.3e-133
WP_000193240.1|2654528_2654891_+	hypothetical protein	NA	A0A1P8DTD0	Proteus_phage	51.4	6.2e-19
WP_000088203.1|2655497_2655770_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_053901473.1|2655828_2656278_+	hypothetical protein	NA	I6RSN8	Salmonella_phage	83.2	9.3e-65
WP_077637843.1|2656521_2656761_+	host cell division inhibitory peptide Kil	NA	K7PL44	Enterobacteria_phage	97.5	2.0e-37
WP_000613343.1|2656757_2656946_+	hypothetical protein	NA	G9L668	Escherichia_phage	98.4	3.8e-28
WP_000365280.1|2656954_2657662_+	recombinase	NA	K7PKU3	Enterobacteria_phage	100.0	7.6e-138
WP_106642979.1|2657662_2658178_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	88.9	1.1e-66
WP_113650192.1|2658186_2658735_+	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	98.4	1.6e-103
WP_113650193.1|2658751_2659048_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	99.0	1.9e-50
WP_000548531.1|2659114_2659306_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_105211110.1|2659316_2659598_+	hypothetical protein	NA	Q6H9Z3	Enterobacteria_phage	97.8	3.6e-46
WP_024238365.1|2659696_2659918_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	94.5	2.1e-33
WP_059219448.1|2659917_2660202_+	ASCH domain-containing protein	NA	A0A1I9LJL9	Stx_converting_phage	90.4	7.5e-44
WP_000545733.1|2660274_2660442_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_024171019.1|2660499_2660700_+	excisionase	NA	K7P7V0	Enterobacteria_phage	98.5	4.2e-33
WP_113650194.1|2660692_2660872_+	hypothetical protein	NA	Q716F8	Shigella_phage	79.5	1.8e-11
>prophage 13
NZ_CP030783	Escherichia albertii strain 2012EL-1823B chromosome, complete genome	4809747	2883794	2967108	4809747	tail,terminase,lysis,transposase,tRNA	Enterobacteria_phage(55.56%)	91	NA	NA
WP_000997428.1|2883794_2884832_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_113650256.1|2884821_2885025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113650257.1|2885038_2885458_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	36.5	2.4e-14
WP_059219677.1|2885526_2886225_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_113650258.1|2886256_2888917_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_059219668.1|2889030_2890386_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_077871032.1|2890429_2890753_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_113650259.1|2890749_2892048_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.1	7.4e-46
WP_002461515.1|2898029_2900603_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	3.4e-127
WP_059221470.1|2900732_2901464_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_000079117.1|2901460_2902441_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_113650260.1|2902575_2903313_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_085949852.1|2903360_2903549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|2903583_2903925_+	ribosome-associated inhibitor A	NA	NA	NA	NA	NA
WP_001386991.1|2904028_2904076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059268590.1|2904173_2905334_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_059221465.1|2905376_2906498_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_113650261.1|2906508_2907579_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.4	9.0e-90
WP_059221461.1|2907787_2908153_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_059221458.1|2908293_2908812_+	YfiR family protein	NA	NA	NA	NA	NA
WP_113650262.1|2908804_2910028_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_113650263.1|2910043_2910526_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065254.1|2910602_2910950_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264780.1|2910992_2911760_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043332.1|2911790_2912339_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2912357_2912606_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460033.1|2912854_2914216_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_113650770.1|2914382_2915174_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_024165304.1|2915238_2916480_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_002461510.1|2916533_2917127_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059177.1|2917248_2918127_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_113650264.1|2918212_2919874_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_025238538.1|2920022_2920367_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_044716665.1|2920411_2920702_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600197.1|2920691_2921168_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_000162574.1|2921299_2921782_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_059257173.1|2922630_2922879_+	damage-inducible protein DinI	NA	K7PLW4	Enterobacteria_phage	97.6	1.2e-37
WP_015987614.1|2922986_2923559_-	cytolethal distending toxin type I subunit CdtC	NA	A5LH54	Enterobacteria_phage	100.0	2.8e-106
WP_113650265.1|2923914_2924961_+|transposase	transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.8	2.9e-08
WP_000358619.1|2925474_2926188_-	cytolethal distending toxin type I subunit CdtA	NA	A5LH52	Enterobacteria_phage	100.0	2.9e-137
WP_072247470.1|2926926_2927049_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_059217928.1|2927035_2927626_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_113650266.1|2927807_2928434_+	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	7.7e-25
WP_059257175.1|2928672_2929308_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	46.4	1.1e-42
WP_001023428.1|2929416_2929686_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	2.4e-44
WP_113650267.1|2929687_2931001_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	95.2	8.5e-74
WP_113650268.1|2931061_2934559_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	96.5	0.0e+00
WP_028127181.1|2935036_2935678_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	3.8e-96
WP_000140746.1|2935575_2936319_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	1.1e-147
WP_113650269.1|2936323_2937022_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.6	5.8e-130
WP_113650270.1|2937021_2937351_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	1.8e-57
WP_059245459.1|2937347_2940422_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	92.6	0.0e+00
WP_001161009.1|2940393_2940723_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|2940731_2941118_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211124.1|2941178_2941922_-|tail	tail protein	tail	A5LH35	Enterobacteria_phage	99.6	6.0e-133
WP_001079419.1|2941932_2942334_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_001283153.1|2942931_2943207_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001322266.1|2943199_2943568_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	9.7e-52
WP_001072975.1|2947087_2947300_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_113649441.1|2947296_2949396_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.7	0.0e+00
WP_000421824.1|2949404_2949944_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	99.4	3.0e-94
WP_097729360.1|2950270_2950453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000881326.1|2950420_2951038_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_113650271.1|2951187_2951655_-|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	90.3	1.4e-68
WP_032275013.1|2951651_2952149_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	98.2	1.4e-90
WP_021555247.1|2952148_2952364_-|lysis	phage lysis protein	lysis	M1FN85	Enterobacteria_phage	95.8	1.0e-32
WP_059255892.1|2953067_2953271_+	hypothetical protein	NA	Q9MBZ6	Enterobacteria_phage	96.7	4.5e-27
WP_059255899.1|2953321_2953585_-	Shiga toxin Stx2f subunit B	NA	A0A1B5FPJ9	Escherichia_phage	97.7	1.4e-41
WP_113650272.1|2953597_2954557_-	Shiga toxin subunit A	NA	A0A1B5FPE4	Escherichia_phage	97.8	2.7e-170
WP_113650273.1|2955006_2955378_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	87.5	9.4e-55
WP_032154268.1|2955374_2955617_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	98.8	9.2e-35
WP_059255905.1|2955628_2957020_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	97.8	6.3e-261
WP_059255907.1|2957016_2957895_-	AAA family ATPase	NA	Q8W641	Enterobacteria_phage	81.2	3.9e-115
WP_113650274.1|2957905_2958802_-	DNA-binding protein	NA	Q8W642	Enterobacteria_phage	98.5	1.9e-69
WP_113650275.1|2958788_2959022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113650276.1|2959018_2959681_-	hypothetical protein	NA	Q8W643	Enterobacteria_phage	97.7	2.2e-115
WP_112871281.1|2959783_2960491_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	88.9	1.6e-114
WP_113650277.1|2960471_2960771_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	89.6	1.1e-34
WP_000800136.1|2960904_2961594_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	88.2	6.1e-116
WP_113650278.1|2961739_2962288_+	XRE family transcriptional regulator	NA	A0A1B5FPB8	Escherichia_phage	70.3	1.1e-40
WP_113650279.1|2962175_2962439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113650280.1|2962578_2962785_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	94.1	5.8e-30
WP_000391589.1|2962983_2963172_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	100.0	4.5e-29
WP_113650281.1|2963168_2963750_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	90.7	1.2e-104
WP_113650282.1|2963926_2964115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113650283.1|2964111_2964939_+	SPFH/Band 7/PHB domain protein	NA	Q8W654	Enterobacteria_phage	98.9	6.2e-131
WP_113650284.1|2964979_2965339_+	hypothetical protein	NA	Q8W655	Enterobacteria_phage	90.2	1.3e-56
WP_059255928.1|2965370_2965613_+	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	93.8	1.1e-35
WP_059255930.1|2965616_2965763_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	87.5	1.0e-20
WP_001406059.1|2965771_2965981_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	86.8	1.6e-30
WP_113650285.1|2965935_2967108_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	87.1	5.4e-197
>prophage 14
NZ_CP030783	Escherichia albertii strain 2012EL-1823B chromosome, complete genome	4809747	4032701	4042545	4809747	transposase,integrase	Morganella_phage(33.33%)	12	4030709:4030723	4035561:4035575
4030709:4030723	attL	AAATTCAATAAACTG	NA	NA	NA	NA
WP_021548272.1|4032701_4033970_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.3	5.1e-193
WP_001059729.1|4033966_4034617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024169704.1|4035088_4035307_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_113650551.1|4035386_4036433_-|transposase	transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.8	2.9e-08
4035561:4035575	attR	AAATTCAATAAACTG	NA	NA	NA	NA
WP_063101432.1|4036851_4037685_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000476150.1|4037677_4037860_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001419054.1|4037853_4038921_+	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	38.4	8.6e-16
WP_113650552.1|4038913_4039108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024673.1|4039104_4039368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|4039364_4039586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058745.1|4039578_4040181_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.9	3.6e-27
WP_001355493.1|4040193_4042545_+	hypothetical protein	NA	A0A1W6JPG0	Morganella_phage	48.2	2.2e-72
>prophage 15
NZ_CP030783	Escherichia albertii strain 2012EL-1823B chromosome, complete genome	4809747	4073991	4087683	4809747	integrase	Enterobacteria_phage(88.89%)	15	NA	NA
WP_024229489.1|4073991_4075170_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	91.2	1.1e-208
WP_001352776.1|4075186_4075828_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_000344414.1|4076022_4077432_-	maturase	NA	NA	NA	NA	NA
WP_103530019.1|4077754_4078327_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	5.5e-94
WP_113650557.1|4078400_4078901_-	transactivation protein	NA	NA	NA	NA	NA
WP_113650558.1|4078897_4079632_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.4	5.2e-129
WP_113650559.1|4080183_4080450_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	3.1e-44
WP_032226384.1|4080446_4081001_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	80.2	4.0e-41
WP_113650560.1|4080993_4081281_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	96.8	1.9e-47
WP_113650561.1|4081273_4081729_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	1.0e-63
WP_113650562.1|4081864_4082185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113650563.1|4082199_4084533_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_113650564.1|4084739_4084886_+|integrase	attP region and P4int integrase	integrase	NA	NA	NA	NA
WP_072178993.1|4085951_4086572_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_113650565.1|4086645_4087683_+	hydroxyacid dehydrogenase	NA	Q9JMN3	Wolbachia_phage	43.0	7.2e-68
>prophage 1
NZ_CP030784	Escherichia albertii strain 2012EL-1823B plasmid unnamed1, complete sequence	100341	55	50596	100341	terminase,tail,plate	Escherichia_phage(77.78%)	56	NA	NA
WP_000067710.1|55_1762_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	100.0	0.0e+00
WP_113650788.1|1987_2989_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	97.0	1.6e-173
WP_001285362.1|3005_4202_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_113650789.1|4370_5180_-	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	97.4	1.6e-155
WP_001113742.1|5472_6357_-	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
WP_113650790.1|6691_7084_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	98.5	1.3e-70
WP_113650791.1|7261_7684_-	ppfA	NA	Q71TL5	Escherichia_phage	77.9	3.6e-42
WP_113650792.1|7722_8502_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	93.5	5.1e-111
WP_077249853.1|8510_8690_-	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	96.6	1.2e-26
WP_001177860.1|8964_9249_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
WP_113650793.1|9241_10147_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.0	1.7e-158
WP_113650794.1|10143_13185_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	83.7	0.0e+00
WP_113650795.1|14358_14685_-	hypothetical protein	NA	Q71T98	Escherichia_phage	91.2	9.3e-22
WP_000900641.1|15103_15529_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	99.3	2.4e-70
WP_113440588.1|15528_15693_+	DUF3927 domain-containing protein	NA	Q71T96	Escherichia_phage	98.1	1.3e-16
WP_113650796.1|16164_17529_+	replicative DNA helicase	NA	O80281	Escherichia_phage	98.9	2.6e-251
WP_113650797.1|17528_18527_+	hypothetical protein	NA	A0A077SL52	Escherichia_phage	99.1	6.2e-194
WP_089641585.1|18573_19206_-|plate	baseplate protein	plate	Q1MVH8	Enterobacteria_phage	99.4	2.0e-89
WP_113650838.1|19198_20062_-|tail	phage tail tape measure protein	tail	A0A077SLQ1	Escherichia_phage	99.0	2.7e-161
WP_113650798.1|20219_21005_-|plate	baseplate	plate	Q71T90	Escherichia_phage	97.3	2.2e-141
WP_113650799.1|20991_21720_-|tail	phage tail protein	tail	A0A077SK19	Escherichia_phage	97.9	1.1e-136
WP_113650800.1|21723_22941_-|tail	phage tail protein	tail	A0A077SL53	Escherichia_phage	98.8	7.8e-223
WP_000235786.1|22950_23328_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840931.1|23474_23720_+	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000943609.1|23722_24301_+	norphogenetic protein	NA	Q71T85	Escherichia_phage	100.0	1.5e-107
WP_000096174.1|24367_24523_+	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_089589712.1|24464_25127_+	norphogenetic protein	NA	Q71T83	Escherichia_phage	99.5	1.7e-123
WP_000484116.1|25024_25651_+	norphogenetic protein	NA	Q1MVG8	Enterobacteria_phage	100.0	2.1e-123
WP_054486473.1|25647_26325_+	serine/threonine protein phosphatase	NA	Q71TJ1	Escherichia_phage	98.7	9.3e-133
WP_000267620.1|27103_27322_+	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
WP_113650801.1|27323_28586_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	98.1	4.7e-231
WP_000021755.1|28658_29165_+	hypothetical protein	NA	A0A077SK53	Escherichia_phage	98.8	5.4e-93
WP_113650802.1|29429_32546_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.3	4.4e-28
WP_113650803.1|32652_33837_-	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	26.1	9.9e-05
WP_113650804.1|33833_35390_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	2.2e-105
WP_001190712.1|35572_35794_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_113650805.1|35793_36174_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	5.7e-63
WP_000113018.1|36178_36358_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
WP_113650806.1|36385_37429_+	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	97.1	1.3e-202
WP_001312282.1|37517_37970_+	late promoter-activating protein (Gp10)	NA	Q71T63	Escherichia_phage	99.3	6.7e-79
WP_113650807.1|38056_39250_+|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	95.2	2.2e-198
WP_113650808.1|39249_40734_+|terminase	terminase	terminase	Q5QBP2	Enterobacteria_phage	98.4	1.3e-288
WP_071594056.1|42056_42176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112924364.1|42194_42416_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	78.8	3.5e-25
WP_096321053.1|42412_43525_+	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	86.8	7.7e-177
WP_059249247.1|44511_44730_-	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	87.0	9.8e-28
WP_072248186.1|44695_44791_-	peptidase	NA	Q38402	Escherichia_phage	93.3	2.0e-09
WP_072248187.1|44809_44923_-	peptidase	NA	Q38401	Escherichia_phage	88.9	1.1e-11
WP_000542339.1|45335_45557_+	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	95.9	1.2e-33
WP_000067532.1|45564_46596_+	recombinase	NA	A0A077SLE7	Escherichia_phage	99.7	2.9e-194
WP_113650809.1|46646_46958_+	lysogeny establishment protein	NA	Q71TG4	Escherichia_phage	94.2	3.7e-44
WP_113650810.1|47200_48313_-	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	88.9	3.0e-181
WP_097759241.1|48309_48531_-	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	82.2	5.6e-31
WP_113650811.1|49125_49767_+	maturation control protein	NA	A0A077SK30	Escherichia_phage	88.7	4.0e-101
WP_113650812.1|49901_50300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113650813.1|50347_50596_-	modulator protein	NA	Q71TG0	Escherichia_phage	97.6	5.7e-40
>prophage 2
NZ_CP030784	Escherichia albertii strain 2012EL-1823B plasmid unnamed1, complete sequence	100341	58884	76719	100341	head,holin,portal,tail	Escherichia_phage(68.42%)	20	NA	NA
WP_113650822.1|58884_59100_-	hypothetical protein	NA	A0A077SK04	Escherichia_phage	92.5	1.7e-19
WP_113650823.1|59159_60869_+|portal	phage portal protein	portal	Q1MVN6	Enterobacteria_phage	99.3	0.0e+00
WP_000132937.1|60861_61881_+|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
WP_072017497.1|61860_62037_-|holin	antiholin	holin	Q71TR5	Escherichia_phage	91.4	7.4e-26
WP_001467310.1|62172_62730_-	lysozyme	NA	Q71TF3	Escherichia_phage	98.4	3.0e-105
WP_000068865.1|62899_63388_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	100.0	5.0e-88
WP_113650824.1|63585_64380_+	hypothetical protein	NA	Q71TF1	Escherichia_phage	97.0	2.1e-144
WP_113650825.1|64372_65467_+	hypothetical protein	NA	Q71T61	Escherichia_phage	34.4	2.1e-33
WP_001165933.1|65498_65810_-	hypothetical protein	NA	A0A077SLG5	Escherichia_phage	100.0	1.8e-46
WP_113650839.1|65799_67077_-	ddrB domain protein	NA	A0A1B0VFX4	Salmonella_phage	97.2	3.0e-233
WP_113650826.1|67791_68895_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_113650827.1|69028_69415_-	ddrA	NA	Q1MVM8	Enterobacteria_phage	99.2	1.2e-44
WP_113650828.1|69411_71331_-	hypothetical protein	NA	A0A077SLK4	Escherichia_phage	94.5	0.0e+00
WP_002433476.1|71332_71935_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	98.5	3.0e-98
WP_000580776.1|71921_72365_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_000887652.1|72361_72691_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000332809.1|72758_73040_-	hypothetical protein	NA	Q71TD9	Escherichia_phage	97.8	8.7e-45
WP_000905119.1|73167_73728_+	DNA-invertase	NA	Q71TD8	Escherichia_phage	98.9	1.0e-97
WP_001164101.1|75630_76158_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	85.7	3.8e-81
WP_001164135.1|76185_76719_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	85.3	5.9e-82
>prophage 3
NZ_CP030784	Escherichia albertii strain 2012EL-1823B plasmid unnamed1, complete sequence	100341	79874	100336	100341	transposase	Escherichia_phage(52.94%)	21	NA	NA
WP_001286327.1|79874_80309_-	hypothetical protein	NA	Q71TD4	Escherichia_phage	100.0	4.3e-75
WP_001189838.1|80387_81224_-	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	99.3	5.8e-153
WP_033553796.1|81223_82657_-	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	99.8	1.1e-271
WP_000002800.1|82653_83010_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_113650829.1|83009_86402_-	lytic transglycosylase domain-containing protein	NA	Q1MVL3	Enterobacteria_phage	98.0	0.0e+00
WP_113650830.1|86483_87365_-	morphogenetic protein	NA	A0A1B0VBL3	Salmonella_phage	99.3	2.4e-173
WP_000506612.1|87379_87991_-	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.0	8.4e-109
WP_113650831.1|88625_88895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113650832.1|89166_89655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113650833.1|89641_89842_-	hypothetical protein	NA	Q71TC4	Escherichia_phage	88.0	4.2e-17
WP_016231365.1|90241_90463_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	97.3	8.1e-38
WP_113650834.1|90459_91500_+	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	94.2	1.5e-174
WP_113650835.1|91684_92764_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105288799.1|92998_93223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047655137.1|93241_94042_+	protein kilA	NA	Q1MVK4	Enterobacteria_phage	99.2	9.2e-148
WP_000205064.1|94646_94913_+	hypothetical protein	NA	A0A1B0VAC8	Salmonella_phage	94.3	5.6e-41
WP_052893097.1|95603_95834_+	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	94.7	9.7e-34
WP_113650836.1|96016_96613_-	hypothetical protein	NA	A0A077SLI4	Escherichia_phage	99.5	3.1e-108
WP_059221975.1|96784_97294_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	98.8	1.9e-90
WP_000035304.1|97305_97887_-	hypothetical protein	NA	A0A077SL48	Escherichia_phage	99.5	1.3e-103
WP_113650837.1|98746_100336_-	hypothetical protein	NA	Q1MVJ6	Enterobacteria_phage	98.5	3.4e-303
>prophage 1
NZ_CP030785	Escherichia albertii strain 2012EL-1823B plasmid unnamed2, complete sequence	81110	58775	66550	81110	integrase	Morganella_phage(25.0%)	13	61473:61487	69736:69750
WP_000085939.1|58775_59459_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.9e-29
WP_113650858.1|59533_59839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113650873.1|59842_60745_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_113650859.1|60782_61040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000618110.1|61149_61398_+	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_113650860.1|61394_61832_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	46.8	7.8e-24
61473:61487	attL	CAGGCCGGTTTTCCT	NA	NA	NA	NA
WP_113650861.1|61831_62839_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	58.8	3.1e-100
WP_113650862.1|62867_63101_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	52.7	6.4e-17
WP_077250594.1|63105_63534_-	plasmid stability protein	NA	NA	NA	NA	NA
WP_001103697.1|63502_64474_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	1.3e-66
WP_000633916.1|64696_65341_+	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.5	3.0e-40
WP_000239529.1|65334_65610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113650863.1|65740_66550_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.6e-54
69736:69750	attR	AGGAAAACCGGCCTG	NA	NA	NA	NA
