The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030881	Lactiplantibacillus plantarum strain nF1 chromosome, complete genome	3120761	535746	544257	3120761		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645861.1|535746_536229_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
WP_003642586.1|536212_537343_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003642587.1|537345_538077_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_003642588.1|538078_538333_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_011101895.1|538332_539013_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642590.1|539005_541225_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.3	7.7e-144
WP_003642591.1|541209_542664_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_003642592.1|542660_543686_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.7	8.4e-61
WP_003642593.1|543678_544257_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.0	1.9e-22
>prophage 2
NZ_CP030881	Lactiplantibacillus plantarum strain nF1 chromosome, complete genome	3120761	688849	750031	3120761	terminase,integrase,transposase,head,capsid,portal	Lactobacillus_phage(20.0%)	56	737764:737785	751715:751736
WP_162816645.1|688849_689674_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_003642731.1|690306_691182_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_003642732.1|691184_692471_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	24.0	2.7e-08
WP_003642733.1|692521_693802_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_003644677.1|693952_694849_+	DegV family protein	NA	NA	NA	NA	NA
WP_003644676.1|695454_696429_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_041153411.1|696618_698607_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003642737.1|698803_699145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003644674.1|699231_699681_-	VOC family protein	NA	NA	NA	NA	NA
WP_003642738.1|700741_701329_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003642739.1|701413_702967_+	ABC-F family ATP-binding cassette domain-containing protein	NA	Q6DMX7	Streptococcus_phage	27.0	1.2e-39
WP_003644673.1|703227_704418_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_003642741.1|704641_704872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642742.1|704897_705119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642743.1|705265_705730_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003642744.1|705951_706845_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_003644672.1|706911_707775_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003642746.1|708336_708501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642747.1|708559_709303_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_024971718.1|709408_710596_+	MFS transporter	NA	NA	NA	NA	NA
WP_041153409.1|710809_711127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642750.1|711202_711763_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_003642752.1|712519_713458_-	EamA family transporter	NA	NA	NA	NA	NA
WP_015380652.1|713654_713924_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_063493393.1|713933_715277_+	PFL family protein	NA	NA	NA	NA	NA
WP_003642755.1|715649_716378_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.1	2.8e-34
WP_003642756.1|716374_717898_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003561810.1|718018_718948_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_003642757.1|719241_720423_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	30.1	1.0e-46
WP_003642758.1|720657_721515_+	GRP family sugar transporter	NA	NA	NA	NA	NA
WP_003642759.1|721735_723088_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003646619.1|723513_723705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063493424.1|724109_726104_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	40.8	1.0e-30
WP_041153408.1|727669_729433_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	40.9	6.2e-96
WP_003639252.1|730372_730516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101805.1|730710_730854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024971517.1|731541_734277_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003642770.1|734376_736353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642771.1|736407_736893_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003642772.1|736941_737214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642773.1|737238_737472_-	hypothetical protein	NA	NA	NA	NA	NA
737764:737785	attL	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
WP_063493425.1|737960_739118_-|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	34.3	6.6e-54
WP_024971519.1|739192_739873_-	helix-turn-helix transcriptional regulator	NA	L0P7E1	Lactobacillus_phage	56.7	1.9e-13
WP_033620097.1|740024_740201_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024971520.1|740480_740699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024971521.1|740695_741496_+	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_024971522.1|741495_742890_+	virulence protein	NA	Q4ZD27	Staphylococcus_phage	36.3	1.1e-71
WP_024971523.1|743033_743453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024971524.1|743477_743660_+	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_024971525.1|743669_744008_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	35.6	5.5e-09
WP_024971526.1|744000_744390_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	44.3	3.0e-19
WP_024971527.1|745064_745538_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_063493426.1|745534_747238_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.3	7.0e-121
WP_021356362.1|747191_747392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063493427.1|747392_748493_+|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	33.4	3.2e-50
WP_024971529.1|748489_750031_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.4	1.1e-43
751715:751736	attR	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
>prophage 3
NZ_CP030881	Lactiplantibacillus plantarum strain nF1 chromosome, complete genome	3120761	1596081	1606721	3120761	transposase	Lactobacillus_phage(90.0%)	10	NA	NA
WP_114071735.1|1596081_1597776_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.3	1.8e-92
WP_003643091.1|1597712_1597943_-	cell surface protein	NA	A0A2P0ZL95	Lactobacillus_phage	100.0	1.4e-37
WP_003643092.1|1597917_1598385_-	hypothetical protein	NA	A0A2P0ZL91	Lactobacillus_phage	100.0	2.7e-83
WP_003643094.1|1598729_1599170_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	99.3	8.0e-77
WP_003643095.1|1599240_1599801_-	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	100.0	2.7e-101
WP_063493310.1|1599888_1602327_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.9	0.0e+00
WP_003643097.1|1602329_1602944_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_003643099.1|1603287_1604235_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_024971568.1|1604420_1605392_+	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	99.1	8.2e-183
WP_003644269.1|1605482_1606721_-	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	99.7	5.7e-221
>prophage 4
NZ_CP030881	Lactiplantibacillus plantarum strain nF1 chromosome, complete genome	3120761	2218524	2316280	3120761	terminase,tail,integrase,tRNA,head,holin,capsid,protease,plate,portal	Lactobacillus_phage(30.43%)	115	2284024:2284039	2317972:2317987
WP_003640984.1|2218524_2219169_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003640983.1|2219333_2220011_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003640982.1|2220179_2222162_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	28.9	1.2e-50
WP_003640980.1|2223048_2224095_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.7	3.5e-62
WP_003640979.1|2224099_2224555_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_011101142.1|2224547_2225126_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_024971500.1|2225109_2225835_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003640976.1|2226114_2227167_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_003640975.1|2227204_2227975_+	phosphonate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.8	4.9e-13
WP_003640974.1|2227964_2228768_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_003640972.1|2229643_2230441_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_003640971.1|2230462_2231563_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_003643943.1|2231696_2232692_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.2	5.9e-51
WP_003640969.1|2232830_2233616_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_003643942.1|2233619_2234516_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	9.9e-82
WP_003640967.1|2234614_2234962_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_003640966.1|2234986_2236006_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640965.1|2236022_2236352_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_016510978.1|2236348_2237014_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640963.1|2237517_2238156_-	ketohydroxyglutarate aldolase	NA	NA	NA	NA	NA
WP_003640962.1|2238170_2239433_-	PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_003640961.1|2239443_2239719_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003640960.1|2239725_2240163_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_063493330.1|2240294_2242343_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003640957.1|2242695_2242947_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003637790.1|2242961_2243561_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640956.1|2243576_2243885_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_024971504.1|2243906_2245616_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	4.0e-55
WP_003640954.1|2246142_2246649_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003640953.1|2246651_2247260_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003640952.1|2247482_2247713_+	redoxin NrdH	NA	X2KRY7	Enterococcus_phage	40.0	2.8e-09
WP_063493329.1|2247851_2250017_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.0	1.1e-267
WP_003640950.1|2250044_2251055_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	60.5	3.1e-108
WP_003640949.1|2251136_2251712_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	41.7	6.4e-26
WP_003640948.1|2251886_2254490_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_003640947.1|2254785_2255454_+	cell surface protein	NA	NA	NA	NA	NA
WP_003640946.1|2255466_2256444_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_162816647.1|2257223_2258747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080315010.1|2258874_2258976_-	hypothetical protein	NA	C1KFN7	Lactobacillus_virus	66.7	9.1e-05
WP_011101134.1|2259141_2259348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041153513.1|2260194_2260554_-|holin	holin	holin	A0A2P0ZLG6	Lactobacillus_phage	82.5	5.8e-33
WP_011101132.1|2260540_2260837_-	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	76.5	4.4e-39
WP_114071740.1|2260837_2261896_-	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	60.4	1.3e-45
WP_011101130.1|2261964_2262141_-	XkdX family protein	NA	NA	NA	NA	NA
WP_011101129.1|2262140_2262461_-	DUF2977 domain-containing protein	NA	NA	NA	NA	NA
WP_011101128.1|2262461_2263202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101127.1|2263207_2263822_-|plate	phage baseplate upper protein	plate	A0A1J0MFQ3	Staphylococcus_phage	47.8	7.3e-44
WP_011101126.1|2263836_2264829_-	SGNH/GDSL hydrolase family protein	NA	A0A1J0MFI8	Staphylococcus_phage	41.0	4.1e-36
WP_041153515.1|2264833_2266708_-|tail	phage tail protein	tail	A0A1X9IGI5	Lactococcus_phage	33.2	7.9e-49
WP_011101124.1|2266707_2267445_-	hypothetical protein	NA	A0A1S5SA63	Streptococcus_phage	36.6	4.1e-41
WP_063493328.1|2267438_2271443_-	tape measure protein	NA	E9LUR1	Lactobacillus_phage	44.6	1.5e-81
WP_011101122.1|2271442_2271679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101121.1|2271747_2272260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041153517.1|2272277_2272865_-|tail	tail protein	tail	NA	NA	NA	NA
WP_011101119.1|2272876_2273263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101118.1|2273263_2273818_-|tail	tail protein	tail	NA	NA	NA	NA
WP_011101117.1|2273807_2274131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041153518.1|2274135_2274501_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_041153519.1|2274515_2275586_-|capsid	phage capsid protein	capsid	A0A0S0N2Q7	Pseudomonas_phage	30.6	2.0e-33
WP_041153520.1|2275599_2276247_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_041153521.1|2276354_2277299_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_162786275.1|2277298_2278894_-|portal	phage portal protein	portal	D2IZM0	Enterococcus_phage	34.2	1.0e-65
WP_041153523.1|2278946_2280233_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4IYR5	uncultured_Caudovirales_phage	50.6	1.5e-115
WP_011101110.1|2280216_2280813_-|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	33.3	5.8e-14
WP_041153524.1|2280852_2281002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101108.1|2281222_2282005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642805.1|2282376_2282838_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	1.1e-39
WP_011101106.1|2282965_2283133_-	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	87.0	2.3e-13
WP_161792467.1|2283129_2283567_-	DUF1642 domain-containing protein	NA	Q5ULV5	Lactobacillus_virus	45.2	1.9e-14
WP_011101104.1|2283566_2283914_-	hypothetical protein	NA	O03921	Lactobacillus_phage	93.9	1.9e-57
WP_011101103.1|2283906_2284089_-	hypothetical protein	NA	NA	NA	NA	NA
2284024:2284039	attL	CGTTTGAACTTCTAGT	NA	NA	NA	NA
WP_041153525.1|2284209_2284578_-	hypothetical protein	NA	A0A291I9N7	Lactobacillus_phage	67.0	7.7e-41
WP_011101099.1|2284711_2284942_-	hypothetical protein	NA	O03916	Lactobacillus_phage	63.2	1.2e-23
WP_041153526.1|2284938_2285358_-	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	40.9	7.0e-22
WP_041153527.1|2285350_2285884_-	hypothetical protein	NA	O03915	Lactobacillus_phage	50.3	3.5e-34
WP_041153528.1|2285888_2286611_-	phage antirepressor KilAC domain-containing protein	NA	Q38585	Streptococcus_virus	45.0	2.1e-50
WP_041153529.1|2286607_2286895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063493326.1|2286891_2287845_-	DUF4373 domain-containing protein	NA	NA	NA	NA	NA
WP_041153530.1|2287937_2288612_-	ERF family protein	NA	A0A2H4J439	uncultured_Caudovirales_phage	51.5	1.7e-30
WP_041153531.1|2288639_2288897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072535967.1|2288899_2289280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041153534.1|2289651_2289939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101088.1|2289944_2290499_-	hypothetical protein	NA	O03909	Lactobacillus_phage	100.0	3.6e-98
WP_011101087.1|2290559_2290742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101086.1|2290900_2291101_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011101085.1|2291247_2291484_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	30.7	8.5e-09
WP_041153535.1|2291521_2291836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101082.1|2292310_2292673_+	helix-turn-helix domain-containing protein	NA	A0A0U4KKM4	Exiguobacterium_phage	32.0	2.6e-09
WP_041153536.1|2292684_2293101_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	29.8	9.1e-06
WP_011101080.1|2293173_2293542_+	membrane protein	NA	NA	NA	NA	NA
WP_011101079.1|2293571_2294618_+	Ltp family lipoprotein	NA	V9QJ01	Oenococcus_phage	44.4	9.3e-23
WP_011101078.1|2294759_2294936_+	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	53.4	1.2e-07
WP_011101077.1|2295425_2296589_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_011101076.1|2296768_2297971_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A126GGK4	Streptococcus_phage	29.8	6.9e-38
WP_003637775.1|2298122_2298491_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_003643933.1|2298552_2299056_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003640943.1|2299254_2299944_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_003640942.1|2300044_2300470_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_003640941.1|2300571_2301459_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003643932.1|2301486_2302035_-	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_003640939.1|2302139_2302325_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003637768.1|2302336_2302486_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_033620089.1|2302547_2303150_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003640936.1|2303656_2304202_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_063493325.1|2304203_2304989_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_003640934.1|2304960_2305371_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_024971787.1|2305372_2306785_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.0	2.3e-45
WP_003640932.1|2307062_2308553_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_114071741.1|2308878_2310054_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_063493323.1|2310069_2311449_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003640928.1|2312327_2312864_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	45.8	2.4e-35
WP_003640927.1|2313002_2313299_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003640926.1|2313307_2313991_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_003643927.1|2314066_2315398_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.3	5.4e-68
WP_003640924.1|2315587_2316280_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
2317972:2317987	attR	ACTAGAAGTTCAAACG	NA	NA	NA	NA
>prophage 5
NZ_CP030881	Lactiplantibacillus plantarum strain nF1 chromosome, complete genome	3120761	2420095	2479177	3120761	bacteriocin,protease,tRNA	uncultured_Mediterranean_phage(22.22%)	55	NA	NA
WP_003646511.1|2420095_2421367_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.7	4.5e-96
WP_003642042.1|2421833_2423447_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	1.2e-143
WP_063493334.1|2423619_2424216_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003642040.1|2424260_2424701_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_024971479.1|2425063_2425996_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_171786060.1|2426004_2427363_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.9	5.2e-26
WP_003642037.1|2427382_2428192_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_024971609.1|2428360_2429347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642034.1|2429429_2430452_-	YdcF family protein	NA	NA	NA	NA	NA
WP_003643830.1|2430740_2431721_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.3	4.9e-42
WP_003642032.1|2432086_2432911_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003642031.1|2433146_2434529_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	33.2	5.7e-28
WP_003642030.1|2434597_2435434_-	pur operon repressor	NA	NA	NA	NA	NA
WP_003642029.1|2435926_2436190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642028.1|2436204_2436747_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_003646500.1|2437825_2438623_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003642023.1|2438615_2439314_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.8	1.2e-15
WP_003642022.1|2439582_2440527_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_129560435.1|2440572_2440755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642021.1|2440836_2441703_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003642020.1|2441835_2442087_-	Veg family protein	NA	NA	NA	NA	NA
WP_003642019.1|2442191_2443082_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_011101014.1|2443078_2443642_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_003642017.1|2443628_2444405_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_024971610.1|2444527_2445712_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_003643823.1|2445944_2447996_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
WP_024971611.1|2448317_2448707_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003642012.1|2449303_2450146_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_003642011.1|2450145_2450850_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_003642010.1|2450871_2451831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642009.1|2451823_2453098_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003642008.1|2453143_2454061_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_003643820.1|2454229_2455024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024971613.1|2455028_2456162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643818.1|2456615_2457629_-|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_003642004.1|2457741_2458488_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003642003.1|2458637_2459534_-	ROK family protein	NA	NA	NA	NA	NA
WP_003642002.1|2459654_2461091_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	9.7e-31
WP_003643816.1|2461108_2462464_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642000.1|2462686_2463109_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003641999.1|2463098_2463287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641998.1|2463293_2464655_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641997.1|2464727_2465438_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003643815.1|2465845_2466862_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003643814.1|2467300_2468077_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_003641994.1|2468335_2470645_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003641993.1|2470739_2470943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044429069.1|2471080_2471767_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641991.1|2471860_2472541_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641990.1|2472627_2473296_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641987.1|2474142_2475519_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_041153507.1|2475534_2477685_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	6.1e-45
WP_003641985.1|2477951_2478122_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_003643811.1|2478146_2478305_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_003646470.1|2478403_2479177_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP030881	Lactiplantibacillus plantarum strain nF1 chromosome, complete genome	3120761	2482606	2529390	3120761	bacteriocin,transposase,protease	Paramecium_bursaria_Chlorella_virus(50.0%)	46	NA	NA
WP_003641979.1|2482606_2482753_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003561746.1|2483451_2484627_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003641977.1|2484990_2485737_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641976.1|2485767_2486967_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003641975.1|2487084_2487252_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003641974.1|2487379_2487580_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003641973.1|2488441_2488609_+|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnJ	bacteriocin	NA	NA	NA	NA
WP_003641972.1|2488639_2488813_+|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnK	bacteriocin	NA	NA	NA	NA
WP_003641971.1|2488809_2489478_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003641969.1|2489889_2490093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011100995.1|2490477_2491662_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_024971607.1|2491706_2493083_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_003641966.1|2493608_2494424_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003641965.1|2494583_2495456_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011100993.1|2495526_2496318_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_063493346.1|2496321_2497476_+	MFS transporter	NA	NA	NA	NA	NA
WP_003641962.1|2497479_2498097_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003641960.1|2498478_2498754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641957.1|2499344_2499482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641956.1|2500024_2500432_-	immunity 63 family protein	NA	NA	NA	NA	NA
WP_114071742.1|2500508_2500655_-	glycohydrolase toxin TNT-related protein	NA	NA	NA	NA	NA
WP_003641954.1|2500857_2501049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641952.1|2501498_2501885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641950.1|2502264_2502543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641949.1|2502654_2502918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024971428.1|2502961_2503879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033607791.1|2503875_2504151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063493345.1|2505640_2509324_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003641945.1|2509910_2510633_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	3.2e-30
WP_003641944.1|2510647_2512477_-	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_003643773.1|2512491_2514009_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_024971425.1|2514474_2515806_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003641941.1|2515883_2516855_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_041153430.1|2516855_2518382_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003641939.1|2518619_2519066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024971424.1|2519955_2520867_-	oxidoreductase	NA	NA	NA	NA	NA
WP_025015650.1|2521003_2521924_+	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_003641936.1|2522089_2522662_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003641935.1|2522765_2523221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641934.1|2523239_2523710_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_114071743.1|2523819_2525016_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|2525046_2525556_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_003643763.1|2525668_2526037_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003641930.1|2526301_2527807_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003641929.1|2527964_2528633_-	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_003643762.1|2528826_2529390_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP030882	Lactiplantibacillus plantarum strain nF1 plasmid unnamed1, complete sequence	40759	8275	23138	40759	transposase	Enterococcus_phage(33.33%)	11	NA	NA
WP_033615749.1|8275_10423_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.1	9.8e-253
WP_072535998.1|10450_10903_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_003646115.1|11353_12040_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	49.6	9.9e-58
WP_003646551.1|12596_15020_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	50.3	2.0e-201
WP_050557824.1|15109_15712_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	53.9	1.8e-50
WP_041153657.1|15794_17513_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.3	1.4e-92
WP_003645574.1|17875_18493_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	36.5	1.8e-18
WP_126043855.1|18956_19301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003645576.1|19425_20442_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	31.9	1.3e-32
WP_101494317.1|20647_21016_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	77.0	2.2e-48
WP_003645578.1|21008_23138_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	89.8	0.0e+00
