The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031126	Bacillus licheniformis strain 0DA23-1 chromosome, complete genome	4405373	616370	660791	4405373	plate,holin,tRNA,terminase,protease,integrase,portal,tail,head,capsid	Bacillus_phage(55.26%)	60	626620:626637	663896:663913
WP_003179225.1|616370_616847_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_003179227.1|616827_617517_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003179229.1|617529_617988_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_003179232.1|617977_619003_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.5	2.1e-67
WP_080624180.1|619242_621168_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.3	4.2e-61
WP_003179234.1|621314_621821_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_003179237.1|621824_622472_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003179239.1|622514_622694_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_011201569.1|622700_623477_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	28.7	5.3e-15
WP_003179243.1|623522_623717_-	YdiK family protein	NA	NA	NA	NA	NA
WP_003179245.1|623713_624448_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003179248.1|624673_624958_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.7	2.9e-19
WP_003179250.1|625002_626637_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.7	2.1e-159
626620:626637	attL	ATGGGCGGAATGATGTAA	NA	NA	NA	NA
WP_025807787.1|626718_627936_-|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	64.9	8.0e-143
WP_025807788.1|627949_628582_-	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	62.4	1.9e-71
WP_025807791.1|628746_628995_+	helix-turn-helix transcriptional regulator	NA	A0A1B2APZ4	Phage_Wrath	65.8	1.1e-19
WP_025807793.1|629021_629216_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025807794.1|629228_629930_+	Rha family transcriptional regulator	NA	A0A0S2MVD8	Bacillus_phage	67.8	4.4e-85
WP_025807795.1|629942_630341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025807797.1|630439_630784_+	hypothetical protein	NA	A0A0K2CZE4	Paenibacillus_phage	55.8	6.6e-10
WP_025807799.1|630788_630998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009330098.1|630987_631200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025807801.1|631254_631473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017475008.1|631574_631793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025807804.1|631785_632664_+	replication protein	NA	V9QKF6	Oenococcus_phage	44.6	4.7e-52
WP_025807806.1|632647_633481_+	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	37.0	5.4e-34
WP_144581996.1|633494_633653_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_025807808.1|633804_634353_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	43.3	5.2e-09
WP_017474694.1|634457_634607_+	BH0509 family protein	NA	NA	NA	NA	NA
WP_017474644.1|634677_634878_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.9	4.2e-09
WP_017474645.1|634913_635147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474597.1|635660_635909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025808209.1|636206_636647_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	51.1	2.3e-36
WP_080627099.1|636646_637189_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	60.6	3.3e-56
WP_025808178.1|637418_638222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048407332.1|638562_638784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026080869.1|639019_639661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080627100.1|639820_640195_+	HNH endonuclease	NA	Q38456	Bacillus_phage	81.5	4.4e-60
WP_009330377.1|640576_641110_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	80.2	2.8e-68
WP_009330378.1|641109_642819_+|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	87.3	1.0e-300
WP_009330392.1|643006_644251_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	83.4	1.4e-206
WP_025807960.1|644240_644870_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	81.8	6.0e-94
WP_017475036.1|644910_646227_+|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	50.0	7.9e-96
WP_009329208.1|646252_646702_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	53.3	4.0e-15
WP_009329207.1|646717_647068_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	60.0	1.3e-32
WP_069500677.1|646997_647372_+|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	65.6	2.4e-37
WP_069500676.1|647364_647748_+	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	69.3	5.9e-44
WP_069500675.1|647744_648125_+	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	54.8	1.8e-32
WP_009329203.1|648124_648733_+|tail	major tail protein	tail	Q9ZXE9	Bacillus_phage	54.6	8.2e-56
WP_009329202.1|648792_649128_+	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	58.9	5.0e-31
WP_025807965.1|649325_653216_+|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	62.7	0.0e+00
WP_009330398.1|653215_654052_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	71.8	2.0e-113
WP_080626726.1|654064_655774_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	69.2	1.9e-219
WP_069500673.1|655810_657385_+	hypothetical protein	NA	M4ZSB3	Bacillus_phage	86.6	1.1e-261
WP_069500672.1|657421_658768_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	86.3	9.9e-86
WP_080626727.1|658780_659104_+	bZIP transcription factor	NA	M4ZR44	Bacillus_phage	46.4	7.8e-13
WP_080626728.1|659100_659286_+	XkdX family protein	NA	NA	NA	NA	NA
WP_069500916.1|659348_659618_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	61.8	9.6e-25
WP_080626729.1|659633_659897_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	77.0	2.7e-32
WP_080626730.1|659948_660791_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	54.3	3.7e-46
663896:663913	attR	ATGGGCGGAATGATGTAA	NA	NA	NA	NA
>prophage 2
NZ_CP031126	Bacillus licheniformis strain 0DA23-1 chromosome, complete genome	4405373	734225	744149	4405373		Synechococcus_phage(50.0%)	9	NA	NA
WP_003179530.1|734225_735521_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.1	5.9e-19
WP_061576038.1|735595_736312_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	42.4	2.4e-46
WP_003179532.1|736313_736568_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	8.0e-05
WP_003179533.1|736564_737248_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_009329142.1|737231_739460_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.5	3.2e-158
WP_003179536.1|739435_740866_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	4.5e-52
WP_011197613.1|740989_742030_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	46.3	2.7e-62
WP_080626734.1|742026_742614_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.1	1.1e-28
WP_003179539.1|742610_744149_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.0	4.3e-77
>prophage 3
NZ_CP031126	Bacillus licheniformis strain 0DA23-1 chromosome, complete genome	4405373	973933	980871	4405373		uncultured_Caudovirales_phage(50.0%)	11	NA	NA
WP_080626760.1|973933_974257_+	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	35.7	1.4e-06
WP_080626761.1|974431_974767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626762.1|974763_975009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155761925.1|975008_975182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626763.1|975182_975509_+	hypothetical protein	NA	R4JGJ3	Bacillus_phage	36.1	9.9e-08
WP_080626765.1|975860_976244_+	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	40.7	6.0e-20
WP_080626766.1|977016_977811_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	52.3	4.8e-64
WP_080626767.1|977780_978281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026588499.1|978280_978484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626768.1|978480_979830_+	AAA family ATPase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	52.6	1.7e-125
WP_080626769.1|979851_980871_+	DNA primase	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	45.9	9.5e-73
>prophage 4
NZ_CP031126	Bacillus licheniformis strain 0DA23-1 chromosome, complete genome	4405373	984600	1075462	4405373	holin,protease,terminase,tRNA,integrase,portal,tail,head,transposase,capsid	Bacillus_phage(43.75%)	98	1036711:1036726	1075882:1075897
WP_017474282.1|984600_985356_+	hypothetical protein	NA	A0A0N9SJW5	Paenibacillus_phage	49.8	1.1e-52
WP_080626771.1|985379_985811_+	hypothetical protein	NA	A0A2H4IZM8	uncultured_Caudovirales_phage	41.0	8.8e-12
WP_080626772.1|985851_986931_+	hypothetical protein	NA	A0A2H4J459	uncultured_Caudovirales_phage	36.5	2.8e-14
WP_080626773.1|987136_989434_+	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	37.5	6.0e-123
WP_080626774.1|989434_990484_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	53.8	2.2e-80
WP_048356262.1|990483_990804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157664248.1|990800_991319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626776.1|991324_991690_+	hypothetical protein	NA	M4HNF9	Bacillus_phage	38.1	1.7e-11
WP_080626777.1|991694_991952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626778.1|991948_992143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626779.1|992139_992340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155761926.1|992336_992486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114555277.1|992479_992842_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J6X7	uncultured_Caudovirales_phage	55.0	9.6e-28
WP_080626780.1|992848_994948_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	78.4	0.0e+00
WP_006640508.1|994979_995312_+	DUF1140 family protein	NA	NA	NA	NA	NA
WP_075876064.1|995350_996319_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	80.3	4.5e-149
WP_080626781.1|996369_996951_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	55.1	2.0e-43
WP_048354323.1|996950_997178_+	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	78.2	6.0e-20
WP_155761927.1|997178_997349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626782.1|997353_997911_+	hypothetical protein	NA	A0A142F1S8	Bacillus_phage	61.4	8.7e-28
WP_080626783.1|997926_998991_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	51.9	2.4e-34
WP_016885220.1|998987_999548_+	hypothetical protein	NA	A0A0N9SJZ0	Paenibacillus_phage	46.4	6.7e-36
WP_080626784.1|999536_999923_-	hypothetical protein	NA	A0A0N9SHP7	Paenibacillus_phage	37.0	2.0e-07
WP_080626785.1|1000033_1001308_+	N-6 DNA methylase	NA	A0A0N9ST12	Paenibacillus_phage	65.3	1.9e-150
WP_080626786.1|1001307_1001697_+	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	43.3	2.5e-18
WP_080626787.1|1001689_1002178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626788.1|1002266_1003067_+	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	54.6	7.0e-71
WP_080626789.1|1003099_1003411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626790.1|1003422_1004850_-	lipase	NA	NA	NA	NA	NA
WP_017474209.1|1004900_1005245_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_080626791.1|1005381_1005600_+	helix-turn-helix transcriptional regulator	NA	A0A1Z1DA26	Bacillus_phage	43.1	1.3e-08
WP_080626792.1|1006585_1006864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016885205.1|1006853_1007228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048407310.1|1007220_1007769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053075443.1|1007769_1008159_+	HNH endonuclease	NA	C7BGG5	Burkholderia_phage	35.2	9.4e-05
WP_080626793.1|1008475_1008775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626794.1|1009185_1009524_+	HNH endonuclease	NA	A0A0K2CZH3	Paenibacillus_phage	57.8	1.3e-13
WP_011197905.1|1009643_1009967_+|terminase	P27 family phage terminase small subunit	terminase	A0A0K2CZN8	Paenibacillus_phage	69.8	6.8e-33
WP_080626795.1|1009941_1011723_+|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	67.1	1.9e-246
WP_073411216.1|1011734_1013033_+|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	44.2	4.3e-86
WP_069500356.1|1012986_1013733_+|protease	Clp protease ClpP	protease	A0A0K2CYC6	Paenibacillus_phage	49.6	2.4e-57
WP_017474201.1|1013732_1014887_+|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	61.6	4.9e-126
WP_026080791.1|1014927_1015425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474199.1|1015427_1015667_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0C5ABB4	Paenibacillus_phage	40.5	1.5e-08
WP_080626796.1|1015671_1016007_+|head	phage head closure protein	head	A0A2I7SC03	Paenibacillus_phage	50.5	1.1e-22
WP_080626797.1|1016003_1016426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197913.1|1016422_1016767_+	hypothetical protein	NA	A0A0S2SY15	Bacillus_phage	40.9	1.0e-15
WP_011197914.1|1016775_1017357_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_073411210.1|1017307_1017622_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	64.6	2.1e-23
WP_011197916.1|1017672_1018008_+	hypothetical protein	NA	H0USX2	Bacillus_phage	40.7	1.2e-11
WP_080626798.1|1018250_1023551_+|tail	phage tail tape measure protein	tail	A0A288WG88	Bacillus_phage	42.6	8.1e-99
WP_069500360.1|1023551_1024373_+|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	48.5	1.5e-65
WP_069500361.1|1024382_1025909_+	hypothetical protein	NA	A6M966	Geobacillus_virus	36.3	8.4e-49
WP_080627101.1|1027427_1028000_+	hypothetical protein	NA	A0A2I7S7J8	Vibrio_phage	40.4	1.3e-07
WP_080626799.1|1029472_1029769_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	50.0	1.3e-17
WP_003181188.1|1029769_1029964_+	XkdX family protein	NA	NA	NA	NA	NA
WP_003181190.1|1029967_1030231_+|holin	holin	holin	NA	NA	NA	NA
WP_080626800.1|1030297_1031233_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	65.9	9.6e-96
WP_011197925.1|1031254_1031512_+|holin	holin	holin	A0A0U4JE55	Bacillus_phage	52.9	2.3e-20
WP_016885193.1|1031955_1032222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161658333.1|1032242_1033376_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016885191.1|1033820_1034036_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069500365.1|1034195_1035014_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069500366.1|1035086_1035416_+	YolD-like family protein	NA	O64030	Bacillus_phage	34.6	2.2e-07
1036711:1036726	attL	TTAAAAATTCAAGAGG	NA	NA	NA	NA
WP_003179971.1|1038220_1038430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003179974.1|1039632_1039848_+	hypothetical protein	NA	D6R3Y4	Bacillus_phage	73.5	7.9e-22
WP_011201594.1|1039841_1040192_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J4U2	uncultured_Caudovirales_phage	57.1	4.8e-08
WP_069500368.1|1040250_1040589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003179977.1|1040614_1042339_-|transposase	transposase	transposase	A0A1L2JY53	Aeribacillus_phage	33.6	8.4e-05
WP_100224395.1|1042613_1042901_+	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	47.8	6.4e-19
WP_009329006.1|1043131_1043572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071583540.1|1048931_1050257_+	TGS domain-containing protein	NA	NA	NA	NA	NA
WP_003179982.1|1050503_1050722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003179983.1|1051109_1051874_+	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_017474999.1|1052279_1054055_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_025807987.1|1054257_1055025_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.5e-30
WP_087634947.1|1055021_1056035_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003179993.1|1056031_1056868_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003179995.1|1056881_1058012_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_071583541.1|1058042_1058501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003179999.1|1058497_1058704_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003180000.1|1059253_1059466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180002.1|1059573_1060320_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.8	3.2e-09
WP_080626803.1|1060285_1061755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026699457.1|1061744_1062653_+	PqqD family protein	NA	NA	NA	NA	NA
WP_011197680.1|1062649_1062934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180010.1|1063041_1063311_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_009328997.1|1063635_1064265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071583959.1|1064345_1065494_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_009328996.1|1065557_1066463_+	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_085959525.1|1066497_1066980_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_003180021.1|1067071_1067686_+	YhbD family protein	NA	NA	NA	NA	NA
WP_003180023.1|1067700_1068411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180026.1|1068425_1069127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328994.1|1069527_1071423_+	serine/threonine protein kinase PrkA	NA	A0MN77	Thermus_phage	36.6	3.3e-103
WP_080626804.1|1072504_1074097_-	recombinase family protein	NA	I3VYZ3	Thermoanaerobacterium_phage	24.5	2.6e-32
WP_150194401.1|1074267_1074456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626805.1|1074577_1075462_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3M2X0	Bacillus_phage	40.1	2.7e-55
1075882:1075897	attR	TTAAAAATTCAAGAGG	NA	NA	NA	NA
>prophage 5
NZ_CP031126	Bacillus licheniformis strain 0DA23-1 chromosome, complete genome	4405373	1091795	1149839	4405373	tail,holin	Bacillus_phage(86.27%)	76	NA	NA
WP_080626823.1|1091795_1092035_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	58.9	1.7e-17
WP_080626824.1|1092056_1092245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626825.1|1092348_1092561_+	hypothetical protein	NA	U5PTT2	Bacillus_phage	60.0	3.6e-11
WP_080626826.1|1092557_1092878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087634952.1|1092867_1093227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087634953.1|1093322_1093997_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	49.3	2.8e-41
WP_157664254.1|1093971_1094172_+	hypothetical protein	NA	O64134	Bacillus_phage	57.4	4.2e-09
WP_080626827.1|1094171_1095926_+	right-handed parallel beta-helix repeat-containing protein	NA	F8WPS8	Bacillus_phage	43.4	4.5e-123
WP_155761929.1|1096144_1096297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626829.1|1096348_1096576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626830.1|1096801_1097548_+	DUF3603 family protein	NA	A0A109ZRE1	Bacillus_phage	34.9	3.5e-32
WP_087634999.1|1097570_1097963_+	dCMP deaminase family protein	NA	F8WPT6	Bacillus_phage	72.8	2.8e-49
WP_157664255.1|1097946_1098216_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	S5MA41	Brevibacillus_phage	38.8	4.5e-06
WP_071583448.1|1098339_1098573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626833.1|1098575_1098773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071583450.1|1098958_1099360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626834.1|1099356_1099668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626835.1|1099767_1100550_+	hypothetical protein	NA	A0A0E3T6A0	Bacillus_phage	35.3	2.8e-32
WP_080626836.1|1100559_1101048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626837.1|1101022_1101724_+	hypothetical protein	NA	A0A0E3X9H9	Bacillus_phage	38.6	1.5e-37
WP_080626838.1|1101737_1102235_+	hypothetical protein	NA	A0A1L2JY27	Aeribacillus_phage	51.2	1.3e-30
WP_080626839.1|1102333_1102978_+	hypothetical protein	NA	A0A1D6X8E5	Bacillus_phage	39.3	5.2e-08
WP_080626840.1|1103106_1103385_+	hypothetical protein	NA	U5PY47	Bacillus_phage	50.0	8.7e-13
WP_080626841.1|1103384_1103942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626842.1|1103964_1104738_+	hypothetical protein	NA	U5Q178	Bacillus_phage	50.2	3.4e-70
WP_080626843.1|1104799_1105102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071583460.1|1105580_1106258_+	hypothetical protein	NA	A0A1D6X837	Bacillus_phage	33.3	1.5e-21
WP_080626844.1|1106257_1107844_+	hypothetical protein	NA	S5MLT2	Bacillus_phage	36.7	1.2e-93
WP_080626845.1|1107936_1109295_+	hypothetical protein	NA	A0A0E3JT25	Bacillus_phage	58.9	1.4e-148
WP_080626846.1|1109311_1110361_+	hypothetical protein	NA	A0A1D6X836	Bacillus_phage	41.6	1.2e-59
WP_071583464.1|1110381_1110801_+	hypothetical protein	NA	U5PXS9	Bacillus_phage	56.9	1.6e-29
WP_080626847.1|1110830_1111760_+	hypothetical protein	NA	A0A0E3X9I2	Bacillus_phage	58.7	3.6e-95
WP_071583466.1|1111832_1112231_+	hypothetical protein	NA	A0A0E3T6A9	Bacillus_phage	40.5	1.3e-14
WP_142396724.1|1112293_1112596_+	hypothetical protein	NA	A0A0E3T7L9	Bacillus_phage	58.2	2.2e-25
WP_155761930.1|1112595_1112757_+	hypothetical protein	NA	U5Q1C8	Bacillus_phage	58.7	1.0e-05
WP_142396723.1|1112772_1113279_+	hypothetical protein	NA	U5PWF3	Bacillus_phage	74.4	4.4e-63
WP_071583469.1|1113307_1113553_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_080626850.1|1113620_1114340_+	hypothetical protein	NA	A0A1D6X862	Bacillus_phage	36.0	2.3e-28
WP_080626851.1|1114358_1114829_+	hypothetical protein	NA	U5Q195	Bacillus_phage	59.5	4.0e-42
WP_080626852.1|1115091_1115544_+	hypothetical protein	NA	U5PWN1	Bacillus_phage	42.6	1.2e-27
WP_080626853.1|1115536_1116034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626854.1|1116039_1116504_+	hypothetical protein	NA	S5MLT8	Bacillus_phage	41.1	2.9e-29
WP_080626855.1|1116516_1122477_+|tail	phage tail tape measure protein	tail	A0A0E3M0Y3	Bacillus_phage	56.4	5.7e-08
WP_080626856.1|1122476_1122839_+	hypothetical protein	NA	A0A0E3T7M6	Bacillus_phage	55.4	2.6e-33
WP_080626857.1|1122855_1126965_+	hypothetical protein	NA	A0A1D6X857	Bacillus_phage	45.4	9.3e-143
WP_080626858.1|1126984_1129387_+	hypothetical protein	NA	R4JGT1	Bacillus_phage	47.1	1.1e-159
WP_080626859.1|1129407_1129947_+	hypothetical protein	NA	A0A1L2JY73	Aeribacillus_phage	42.0	2.8e-07
WP_080626860.1|1129968_1130433_+	hypothetical protein	NA	A0A0H3UZD0	Geobacillus_virus	47.0	1.0e-29
WP_080626861.1|1130532_1130835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626862.1|1130862_1131942_+	LysM peptidoglycan-binding domain-containing protein	NA	O64040	Bacillus_phage	68.7	2.9e-19
WP_080626863.1|1131954_1132239_+|holin	phage holin	holin	J7KDR1	Streptococcus_phage	42.2	6.6e-08
WP_080626864.1|1132313_1132679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626865.1|1132737_1133256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626866.1|1133266_1133818_-	hypothetical protein	NA	U5Q1A7	Bacillus_phage	41.1	6.2e-26
WP_080626867.1|1133814_1134663_-	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	52.1	3.3e-79
WP_080626868.1|1134649_1135165_-	dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	41.3	7.0e-24
WP_080626869.1|1135175_1135907_-	PD-(D/E)XK nuclease family protein	NA	S5M851	Bacillus_phage	40.4	7.1e-54
WP_080626870.1|1135906_1136533_-	3'-5' exonuclease	NA	A0A0N9SJX9	Paenibacillus_phage	37.8	9.1e-26
WP_071583484.1|1136560_1136743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626871.1|1136758_1137769_-	toprim domain-containing protein	NA	S5M855	Bacillus_phage	48.7	2.8e-85
WP_071583486.1|1137771_1137951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626872.1|1138006_1139347_-	hypothetical protein	NA	A0A1D6X893	Bacillus_phage	53.1	5.9e-123
WP_080626873.1|1139339_1139879_-	AAA family ATPase	NA	A0A0E3X9J6	Bacillus_phage	45.6	2.5e-32
WP_157664259.1|1139908_1140601_-	sigma-70 family RNA polymerase sigma factor	NA	U5Q0I1	Bacillus_phage	38.9	7.2e-32
WP_080626875.1|1140669_1140882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626876.1|1140874_1141261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626877.1|1141333_1141618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626878.1|1141682_1142126_-	hypothetical protein	NA	S5MLV8	Bacillus_phage	49.0	9.0e-28
WP_080626879.1|1142184_1142853_-	AAA family ATPase	NA	F8WPX9	Bacillus_phage	47.1	3.5e-39
WP_080626880.1|1142883_1143429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626881.1|1143452_1143992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626882.1|1144021_1145023_-	AAA family ATPase	NA	A0A0E3T6D1	Bacillus_phage	47.5	9.7e-70
WP_080626883.1|1145012_1145270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626884.1|1145333_1146284_-	hypothetical protein	NA	A0A1D6X8A5	Bacillus_phage	43.4	1.9e-51
WP_080626885.1|1146392_1147433_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A0E3JQ77	Bacillus_phage	67.4	9.9e-134
WP_080626886.1|1147508_1149839_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0E3M3E9	Bacillus_phage	57.6	3.2e-257
>prophage 6
NZ_CP031126	Bacillus licheniformis strain 0DA23-1 chromosome, complete genome	4405373	1474059	1541323	4405373	terminase,portal,coat,tail,plate,holin	Bacillus_phage(27.78%)	81	NA	NA
WP_009328811.1|1474059_1474509_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011197778.1|1474659_1475148_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009328809.1|1475279_1475792_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009328808.1|1475862_1476261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328807.1|1476309_1476696_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011197779.1|1476842_1477199_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_009328806.1|1477485_1477695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197781.1|1477774_1477906_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_009328805.1|1478035_1478293_+	sporulation protein	NA	NA	NA	NA	NA
WP_011197782.1|1478331_1480614_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	35.6	1.0e-90
WP_016885900.1|1480735_1480993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328801.1|1481032_1481620_-	DedA family protein	NA	NA	NA	NA	NA
WP_161620988.1|1482697_1483594_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	55.6	1.2e-84
WP_011197785.1|1483610_1484006_-	GtrA family protein	NA	NA	NA	NA	NA
WP_009328797.1|1484170_1484590_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009328796.1|1484599_1485109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328793.1|1485173_1485896_-	esterase family protein	NA	NA	NA	NA	NA
WP_011197786.1|1485886_1486219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011197787.1|1486412_1486901_-	DNA damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_009328787.1|1486981_1487929_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_009328785.1|1488237_1489362_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	25.6	5.3e-16
WP_011197788.1|1489351_1490527_+	cystathionine beta-lyase	NA	A0A0B5JD48	Pandoravirus	29.3	6.7e-22
WP_011197789.1|1490572_1491763_-	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_011197790.1|1491936_1492506_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009328774.1|1492495_1492780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474216.1|1492955_1494329_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	23.9	3.8e-08
WP_080626900.1|1494633_1495620_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_016885898.1|1496221_1496305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061565996.1|1496743_1496923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474214.1|1496956_1497535_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_017474213.1|1497621_1497909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474212.1|1498116_1499007_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011197796.1|1499327_1501157_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_080626901.1|1501184_1502903_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_003180765.1|1502960_1503848_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180767.1|1503939_1504812_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003180768.1|1504859_1505237_+	glyoxalase	NA	NA	NA	NA	NA
WP_009328757.1|1505280_1505829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180772.1|1506281_1507016_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	60.8	4.2e-30
WP_011197798.1|1507071_1508496_-	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	24.6	5.1e-16
WP_075223542.1|1508511_1509090_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075223543.1|1509102_1509438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180779.1|1509466_1509880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180781.1|1510254_1510737_-	DUF600 family protein	NA	NA	NA	NA	NA
WP_003180784.1|1513007_1513655_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	47.5	4.1e-45
WP_003180785.1|1513668_1514325_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	49.7	4.0e-40
WP_003180787.1|1514513_1514867_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.6	2.7e-19
WP_003180788.1|1515039_1515300_+	helix-turn-helix transcriptional regulator	NA	S5MA07	Brevibacillus_phage	41.2	7.9e-08
WP_003180790.1|1515289_1515586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080624211.1|1515586_1516417_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	31.0	1.3e-27
WP_035317447.1|1516316_1517117_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	48.1	6.1e-59
WP_003180798.1|1517387_1517729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180800.1|1517725_1517929_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	54.7	1.9e-12
WP_003180803.1|1518049_1518553_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	38.7	1.4e-21
WP_003180804.1|1518695_1519496_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	51.4	5.7e-65
WP_009328741.1|1519492_1520791_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	60.2	7.2e-150
WP_003180808.1|1520794_1522309_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.5	3.4e-143
WP_009328740.1|1522316_1523165_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	62.8	2.1e-57
WP_009328739.1|1523182_1524118_+|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	64.1	1.1e-102
WP_011201613.1|1524205_1524586_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_009328738.1|1524582_1524939_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_080626902.1|1524935_1525424_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	45.2	3.8e-35
WP_003180824.1|1525436_1525877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180826.1|1525877_1526102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197804.1|1526101_1527448_+|portal	phage portal protein	portal	S5MNC1	Brevibacillus_phage	40.2	1.5e-78
WP_003180830.1|1527449_1527893_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	44.7	2.1e-24
WP_003180832.1|1528075_1528525_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	38.7	4.1e-12
WP_003180833.1|1528566_1528704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626903.1|1528707_1532490_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	45.3	1.7e-42
WP_003180838.1|1532482_1533139_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	32.6	4.0e-24
WP_009328734.1|1533195_1534176_+	hypothetical protein	NA	H7BV96	unidentified_phage	32.3	9.2e-41
WP_003180843.1|1534172_1534481_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	37.3	1.0e-06
WP_003180844.1|1534499_1534925_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	39.0	5.4e-14
WP_009328732.1|1534917_1535961_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	9.7e-73
WP_009328731.1|1535947_1536868_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	28.3	5.0e-12
WP_003180850.1|1536881_1537268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180851.1|1537283_1538489_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	48.3	9.3e-27
WP_003180853.1|1538526_1539558_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	48.2	1.0e-18
WP_003180856.1|1539660_1539930_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.0	1.6e-24
WP_003180859.1|1539944_1540208_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	67.8	5.3e-28
WP_003180861.1|1540258_1541323_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	50.8	1.1e-44
>prophage 7
NZ_CP031126	Bacillus licheniformis strain 0DA23-1 chromosome, complete genome	4405373	2542240	2554420	4405373		Staphylococcus_phage(55.56%)	15	NA	NA
WP_080626939.1|2542240_2542834_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.6	2.0e-14
WP_009327962.1|2542823_2543579_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.6	1.4e-07
WP_003183108.1|2543761_2543857_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003183111.1|2543977_2544499_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003183113.1|2544509_2544884_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003183115.1|2544985_2545450_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	70.7	1.7e-45
WP_003183117.1|2545484_2546681_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.9	2.1e-116
WP_003183118.1|2546702_2547350_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.5	7.4e-39
WP_003183120.1|2547361_2548450_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	38.1	6.6e-64
WP_003183123.1|2548810_2549155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003183125.1|2549417_2551604_-	AAA family ATPase	NA	A0A220BYT7	Staphylococcus_phage	41.3	1.4e-150
WP_003183127.1|2551730_2552168_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003183128.1|2552326_2552632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009327959.1|2552621_2553752_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	43.3	1.4e-77
WP_080626940.1|2553982_2554420_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	43.3	3.2e-17
>prophage 8
NZ_CP031126	Bacillus licheniformis strain 0DA23-1 chromosome, complete genome	4405373	2945931	3039383	4405373	head,tRNA,protease,terminase,portal,coat,tail,capsid,plate,holin	Bacillus_phage(78.43%)	105	NA	NA
WP_003183980.1|2945931_2947077_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.2	5.5e-85
WP_069500660.1|2947105_2948134_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003183984.1|2948174_2948375_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003183985.1|2948367_2949372_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.3	1.2e-06
WP_003183986.1|2949381_2949987_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003183987.1|2950109_2950631_-	intercompartmental signaling factor BofC	NA	NA	NA	NA	NA
WP_003183988.1|2950873_2951524_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_003183990.1|2951801_2951981_-	small acid-soluble spore protein H	NA	NA	NA	NA	NA
WP_003183991.1|2952076_2952541_-	DNA damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_003183992.1|2952601_2953312_-	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	55.9	3.0e-49
WP_003183993.1|2953725_2953905_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	76.3	1.5e-21
WP_003183994.1|2953996_2954323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003183995.1|2954464_2955187_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_080626953.1|2956859_2957495_-	sporulation protein	NA	NA	NA	NA	NA
WP_003184005.1|2957666_2958719_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_003184007.1|2958834_2959944_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_009327769.1|2959965_2960805_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_003184010.1|2960785_2962360_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_009327768.1|2962460_2963639_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	25.3	1.2e-31
WP_003184015.1|2963607_2964150_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_003184017.1|2964193_2965063_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003184018.1|2965071_2965515_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_080626954.1|2965628_2966915_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_003184022.1|2966947_2967526_-	sporulation protein	NA	NA	NA	NA	NA
WP_003184023.1|2967751_2968033_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003184025.1|2968045_2968387_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003184027.1|2968399_2968708_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003184028.1|2968864_2969731_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_003184030.1|2969723_2970515_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003184032.1|2970660_2971089_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_061578553.1|2971088_2971409_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003184035.1|2971453_2972260_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_011198163.1|2972262_2972943_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003184039.1|2972997_2973516_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003184040.1|2973512_2974421_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003184042.1|2974451_2975462_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_162785922.1|2976061_2976253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162785923.1|2976224_2976647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626956.1|2976745_2977114_+	YolD-like family protein	NA	O64030	Bacillus_phage	40.4	2.0e-17
WP_035338316.1|2977336_2978458_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	35.1	2.4e-53
WP_025807654.1|2978710_2980327_+	ribonuclease YeeF family protein	NA	NA	NA	NA	NA
WP_006637262.1|2980339_2980756_+	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	44.1	3.6e-26
WP_080626957.1|2980786_2981740_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HSE6	Bacillus_phage	42.0	1.2e-61
WP_069500507.1|2981787_2982051_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	77.0	7.9e-32
WP_069500916.1|2982066_2982336_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	61.8	9.6e-25
WP_039072971.1|2982399_2982582_-	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	47.9	1.8e-06
WP_069500506.1|2982578_2982902_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	37.9	5.8e-08
WP_080626958.1|2982914_2984354_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	40.5	9.4e-58
WP_080626959.1|2984392_2985946_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	77.2	7.3e-234
WP_080626960.1|2985982_2987692_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	69.1	3.6e-218
WP_017475032.1|2987704_2988541_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	72.2	1.4e-114
WP_080626961.1|2988540_2992431_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	65.1	0.0e+00
WP_009329202.1|2992628_2992964_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	58.9	5.0e-31
WP_080626962.1|2993024_2993633_-|tail	phage tail protein	tail	Q9ZXE9	Bacillus_phage	54.6	1.4e-55
WP_009329204.1|2993632_2994013_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	55.6	3.0e-32
WP_009329205.1|2994009_2994393_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	70.9	4.1e-45
WP_009329206.1|2994385_2994760_-|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	63.9	1.2e-36
WP_080626963.1|2994689_2995040_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	59.1	2.8e-32
WP_009329208.1|2995055_2995505_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	53.3	4.0e-15
WP_017475036.1|2995530_2996847_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	50.0	7.9e-96
WP_025807960.1|2996887_2997517_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	81.8	6.0e-94
WP_009330396.1|2997506_2998751_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	83.4	6.1e-207
WP_009330378.1|2998938_3000648_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	87.3	1.0e-300
WP_017475038.1|3000647_3001181_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	80.2	2.8e-68
WP_087634980.1|3001562_3001937_-	HNH endonuclease	NA	Q38456	Bacillus_phage	80.6	5.8e-60
WP_017475040.1|3002096_3002741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185368.1|3002959_3003184_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009329244.1|3003933_3004314_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	82.9	8.8e-48
WP_025807623.1|3004426_3004804_-	hypothetical protein	NA	R4JMS5	Bacillus_phage	57.9	4.3e-31
WP_009329249.1|3004819_3005335_-	hypothetical protein	NA	D6R425	Bacillus_phage	83.6	1.1e-82
WP_017695850.1|3005338_3005509_-	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	56.6	5.1e-08
WP_017474566.1|3005505_3006045_-	nuclease	NA	Q9ZXC2	Bacillus_phage	89.9	1.1e-88
WP_080626964.1|3006041_3006479_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	75.9	1.5e-62
WP_080626965.1|3006456_3006828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626966.1|3007049_3009482_-	DNA primase	NA	D6R422	Bacillus_phage	80.0	0.0e+00
WP_017474381.1|3009542_3009983_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	89.0	2.9e-71
WP_017474382.1|3010001_3010355_-	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	56.6	3.9e-26
WP_080626967.1|3010344_3011280_-	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	91.0	3.2e-160
WP_057957666.1|3011283_3011841_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	71.4	2.4e-70
WP_069500681.1|3012034_3012304_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	55.8	9.0e-23
WP_048355993.1|3012300_3012492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626968.1|3012642_3012882_-	helix-turn-helix transcriptional regulator	NA	D6R414	Bacillus_phage	62.0	3.3e-16
WP_048355991.1|3013131_3013575_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	63.9	4.9e-42
WP_048355990.1|3013606_3014086_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	59.9	1.3e-43
WP_080626969.1|3014125_3015514_+	recombinase family protein	NA	Q9T200	Bacillus_phage	60.5	6.9e-159
WP_009329283.1|3015526_3015913_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_003184048.1|3015967_3016540_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003184050.1|3016693_3017725_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_003184052.1|3017928_3018678_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_003184054.1|3018820_3020125_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003184055.1|3020200_3022843_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	2.8e-161
WP_003184058.1|3023304_3023496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016885545.1|3023515_3024538_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_063906779.1|3024565_3026023_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009329296.1|3026171_3027467_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_009329298.1|3027492_3028467_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_080626970.1|3028470_3029262_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_009329302.1|3029251_3030193_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_011198166.1|3030232_3031063_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_009329306.1|3031068_3032430_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003184074.1|3032618_3033104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003184076.1|3033152_3033740_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_080626971.1|3033736_3036061_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	45.2	7.7e-187
WP_080626972.1|3036279_3037935_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	35.7	1.4e-17
WP_003184083.1|3038117_3039383_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.5	7.2e-147
>prophage 9
NZ_CP031126	Bacillus licheniformis strain 0DA23-1 chromosome, complete genome	4405373	3381688	3421237	4405373	plate,protease,terminase,integrase,portal,coat,tail,capsid,head,transposase,holin	Bacillus_phage(63.89%)	49	3379389:3379448	3421330:3421405
3379389:3379448	attL	CAAACGCTTCTCAAGCTCTGCTTTTTTCTCTTCGAAGCCAGGCTTGCCGAGAAGGGCGAA	NA	NA	NA	NA
WP_087635001.1|3381688_3382123_+	DUF4231 domain-containing protein	NA	A0A0S2MYH2	Enterococcus_phage	47.9	3.4e-27
WP_080627000.1|3382119_3382524_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_080627001.1|3382525_3382723_-	hypothetical protein	NA	Q4ZA73	Staphylococcus_virus	65.0	3.9e-15
WP_080627002.1|3383019_3384519_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080627003.1|3384533_3384932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080627004.1|3384977_3386057_-	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	53.0	5.2e-45
WP_080627005.1|3386108_3386372_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	75.9	2.3e-31
WP_071583811.1|3386387_3386657_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	62.9	3.3e-25
WP_080627006.1|3386719_3386902_-	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	47.9	1.8e-06
WP_080627007.1|3386898_3387222_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	47.4	2.0e-13
WP_080627106.1|3387234_3388581_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	42.3	1.9e-65
WP_080627008.1|3388597_3391243_-	peptidase G2	NA	D6R401	Bacillus_phage	57.0	1.4e-293
WP_080627009.1|3391279_3392992_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	65.6	1.2e-216
WP_080627010.1|3393004_3393841_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	67.1	1.3e-107
WP_080627011.1|3393840_3398310_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	42.4	1.3e-70
WP_043054229.1|3398518_3398884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043054228.1|3398937_3399555_-|tail	tail protein	tail	NA	NA	NA	NA
WP_043054227.1|3399569_3399953_-	phage protein	NA	NA	NA	NA	NA
WP_043054226.1|3399949_3400348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080627012.1|3400347_3400656_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	37.6	9.7e-13
WP_003185351.1|3400645_3400948_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	1.2e-12
WP_065643430.1|3400968_3401394_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	56.0	2.9e-15
WP_075646713.1|3401416_3402697_-|capsid	phage major capsid protein	capsid	A0A288WGE9	Bacillus_phage	43.8	2.6e-75
WP_080627013.1|3402766_3403498_-|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	56.4	8.9e-57
WP_071583905.1|3403442_3404753_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.3	3.2e-105
WP_035316082.1|3404753_3404945_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_071583906.1|3404957_3406667_-|terminase	terminase large subunit	terminase	W8CZ43	Bacillus_phage	63.8	2.1e-210
WP_071583907.1|3406663_3407179_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	44.0	6.3e-33
WP_080627014.1|3407409_3407784_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	1.8e-29
WP_080627015.1|3407810_3408119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006637235.1|3408333_3408558_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003185369.1|3409296_3409677_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	83.7	3.0e-48
WP_080627017.1|3410051_3410876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080627107.1|3410959_3411154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080627018.1|3411277_3411793_-	hypothetical protein	NA	D6R425	Bacillus_phage	83.6	1.1e-82
WP_003185375.1|3411795_3411966_-	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	54.7	8.8e-08
WP_080627019.1|3411962_3412502_-	nuclease	NA	Q9ZXC2	Bacillus_phage	91.1	5.9e-90
WP_080627020.1|3412498_3412936_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	75.2	4.2e-62
WP_080627021.1|3413204_3415643_-	DNA primase	NA	D6R422	Bacillus_phage	80.3	0.0e+00
WP_061578359.1|3415703_3416144_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	91.8	3.1e-73
WP_080627022.1|3416143_3417076_-	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	90.4	1.2e-154
WP_080627023.1|3417079_3417637_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	71.9	1.6e-69
WP_080627024.1|3417729_3417972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080627025.1|3418065_3418332_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	51.2	9.5e-17
WP_017474831.1|3418455_3418725_-	hypothetical protein	NA	S5MC08	Brevibacillus_phage	50.0	8.4e-21
WP_026587143.1|3418730_3418916_-	helix-turn-helix transcriptional regulator	NA	A0A1C8E998	Bacillus_phage	70.5	1.5e-16
WP_080627026.1|3419184_3419613_+	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	65.2	1.2e-45
WP_080627027.1|3419621_3420044_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	61.6	2.0e-45
WP_080627028.1|3420088_3421237_+|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	34.6	3.6e-52
3421330:3421405	attR	CAAACGCTTCTCAAGCTCTGCTTTTTTCTCTTCGAAGCCAGGCTTGCCGAGAAGGGCGAACATGTTGACTTTGTAT	NA	NA	NA	NA
