The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030111	Escherichia coli strain MCJCHV-1 chromosome, complete genome	4939457	790348	851791	4939457	transposase,protease	Acinetobacter_phage(28.57%)	44	NA	NA
WP_001774042.1|790348_794905_+|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
WP_001335851.1|795034_795844_+	prepilin peptidase PppA	NA	NA	NA	NA	NA
WP_001305092.1|795909_796320_+	GspS/AspS pilotin family protein	NA	NA	NA	NA	NA
WP_001305091.1|796337_797297_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_000498847.1|797326_799387_+	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_000249375.1|799386_800880_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173425.1|800879_802103_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001087296.1|802119_802575_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001115117.1|802578_803142_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000820092.1|803138_803510_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_001254776.1|803506_804112_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000633240.1|804108_805086_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_000097240.1|805082_806261_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000942826.1|806262_806799_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_000124301.1|807857_808634_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000590258.1|808630_809290_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.7	2.9e-06
WP_000038461.1|809339_809963_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000066002.1|809959_811000_+	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_001259305.1|810999_812256_+	N-acylneuraminate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000723250.1|812252_813428_+	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_024188362.1|813420_814569_+	NeuE protein	NA	NA	NA	NA	NA
WP_000575410.1|814558_815788_+	poly-alpha-2,8 sialosyl sialyltransferase	NA	NA	NA	NA	NA
WP_001161835.1|815937_817143_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_000579517.1|817177_819205_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_000030745.1|819201_819942_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001298258.1|819951_821628_-	polysialic acid transporter KpsD	NA	NA	NA	NA	NA
WP_000905924.1|821651_822800_-	capsule polysaccharide transporter	NA	NA	NA	NA	NA
WP_001296394.1|822871_823855_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	6.2e-37
WP_000729638.1|824665_824821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001702848.1|824997_825816_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	5.9e-65
WP_000087856.1|825851_826154_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001223343.1|826488_828579_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_085949836.1|828855_830069_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_001305021.1|830671_830944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001521284.1|831234_831603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266542.1|831606_831822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948620.1|833824_835038_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_033561627.1|841149_843351_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750130.1|843432_844710_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015715.1|844706_846449_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001287500.1|846448_847396_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001296374.1|847396_849121_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000074477.1|849256_850450_+	MFS transporter	NA	NA	NA	NA	NA
WP_103103190.1|850562_851791_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.2e-170
>prophage 2
NZ_CP030111	Escherichia coli strain MCJCHV-1 chromosome, complete genome	4939457	1137170	1144310	4939457		Escherichia_phage(83.33%)	6	NA	NA
WP_001279001.1|1137170_1137809_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
WP_001539448.1|1137805_1139068_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847997.1|1139064_1139973_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_001272544.1|1140138_1140936_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	5.0e-69
WP_001141302.1|1140986_1141643_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_001539446.1|1141748_1144310_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	6.0e-31
>prophage 3
NZ_CP030111	Escherichia coli strain MCJCHV-1 chromosome, complete genome	4939457	1217043	1223869	4939457		Enterobacteria_phage(100.0%)	9	NA	NA
WP_001774022.1|1217043_1219377_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
WP_000856729.1|1219391_1219712_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459295.1|1219847_1220303_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244665.1|1220295_1220583_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_001774021.1|1220575_1221175_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	80.3	6.6e-50
WP_001149160.1|1221171_1221438_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001392508.1|1221991_1222726_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	6.1e-130
WP_001774020.1|1222722_1223223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001430678.1|1223296_1223869_+	phage polarity suppression family protein	NA	Q7M2A1	Enterobacteria_phage	96.8	1.4e-94
>prophage 4
NZ_CP030111	Escherichia coli strain MCJCHV-1 chromosome, complete genome	4939457	1358434	1404046	4939457	holin,terminase,integrase,tail	Escherichia_phage(56.0%)	55	1351487:1351504	1382700:1382717
1351487:1351504	attL	GCCAGGCCAACGCCTCCA	NA	NA	NA	NA
WP_001296289.1|1358434_1359901_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000138282.1|1359969_1361547_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001617201.1|1361739_1362990_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.0	8.0e-239
WP_001617200.1|1362993_1363188_-	DUF1382 family protein	NA	G9L698	Escherichia_phage	95.3	1.4e-25
WP_001617199.1|1363184_1363835_-	hypothetical protein	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	97.2	3.4e-124
WP_001550170.1|1363827_1364079_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	95.2	5.8e-40
WP_000675390.1|1364236_1364485_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_001617197.1|1364534_1365476_-	recombinase RecT	NA	A0A0F6TJP0	Escherichia_coli_O157_typing_phage	99.7	1.0e-177
WP_032153871.1|1365472_1366294_-	exodeoxyribonuclease VIII	NA	A0A2R9YJH7	Escherichia_phage	98.5	5.2e-162
WP_001102251.1|1366290_1366590_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	97.0	4.9e-46
WP_000836290.1|1366898_1367483_-	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001282459.1|1367637_1367868_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000168729.1|1368209_1369040_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	97.1	1.1e-154
WP_000843279.1|1369011_1369788_+	hypothetical protein	NA	G9L6A9	Escherichia_phage	100.0	4.6e-152
WP_032153870.1|1369905_1370250_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	96.5	6.9e-60
WP_032153869.1|1370311_1370875_+	hypothetical protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	74.2	9.0e-65
WP_001018057.1|1370871_1371162_+	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	82.3	1.2e-36
WP_001224665.1|1371734_1371917_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_032153985.1|1372082_1372442_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	75.5	2.4e-39
WP_032153864.1|1372443_1373217_+	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	47.7	2.0e-51
WP_016235742.1|1373209_1373491_+	ASCH domain-containing protein	NA	A0A077SLL0	Escherichia_phage	97.8	1.1e-47
WP_016235741.1|1373483_1373822_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	98.2	6.4e-58
WP_001090112.1|1373862_1374537_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.6	3.4e-119
WP_032153863.1|1374533_1376009_+	hypothetical protein	NA	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.2	2.2e-296
WP_001600316.1|1376052_1376475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335899.1|1377177_1377384_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_000852419.1|1377398_1379078_+|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.5	3.6e-303
WP_021517651.1|1379074_1379371_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	99.0	3.7e-46
WP_032153859.1|1379373_1380069_+	peptidase	NA	G9L6C4	Escherichia_phage	98.3	8.7e-94
WP_000268715.1|1380083_1381070_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
WP_032153858.1|1381121_1381559_+	hypothetical protein	NA	G9L6C6	Escherichia_phage	95.2	5.0e-71
WP_032153857.1|1381569_1381905_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	5.0e-55
WP_000424495.1|1381955_1382279_+	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
WP_000179264.1|1382278_1382884_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.5	6.2e-112
1382700:1382717	attR	TGGAGGCGTTGGCCTGGC	NA	NA	NA	NA
WP_022645084.1|1382883_1385355_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.3	0.0e+00
WP_000568023.1|1385354_1385819_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
WP_001555169.1|1385818_1386385_+	hypothetical protein	NA	A0A193GYJ4	Enterobacter_phage	81.5	1.5e-59
WP_032153984.1|1386384_1389132_+	bacteriophage protein	NA	A0A193GYI3	Enterobacter_phage	43.8	8.1e-119
WP_032153855.1|1389131_1392521_+	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	36.8	3.4e-183
WP_032153854.1|1392522_1393371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001555166.1|1393448_1393745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127505.1|1394524_1395220_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	100.0	5.4e-128
WP_001260052.1|1395366_1395999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708858.1|1396097_1396259_+	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_000993735.1|1396330_1396987_-	phage antirepressor Ant	NA	A0A1U9AJ93	Stx1_converting_phage	52.2	4.3e-50
WP_016245482.1|1397304_1397562_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	97.6	6.3e-42
WP_032153853.1|1397758_1400221_+|tail	phage tail fiber protein	tail	O09496	Escherichia_virus	48.8	3.3e-164
WP_000009883.1|1400293_1400698_+	hypothetical protein	NA	G9L6E6	Escherichia_phage	95.5	3.9e-62
WP_016245479.1|1400684_1400993_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	94.1	4.6e-47
WP_032153852.1|1400982_1401612_+	glycoside hydrolase family 19 protein	NA	A0A0F6R8M1	Escherichia_coli_O157_typing_phage	97.6	1.7e-112
WP_000637727.1|1401608_1402106_+	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	66.5	1.0e-48
WP_001774017.1|1402300_1402840_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	96.6	5.1e-41
WP_001311989.1|1402855_1403374_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000076001.1|1403684_1403876_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017558.1|1403893_1404046_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	92.0	1.9e-17
>prophage 5
NZ_CP030111	Escherichia coli strain MCJCHV-1 chromosome, complete genome	4939457	1772073	1781518	4939457		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001538980.1|1772073_1773000_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
WP_001538978.1|1773004_1773736_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1773716_1773824_-	protein YohO	NA	NA	NA	NA	NA
WP_001240405.1|1773883_1774615_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001538977.1|1774836_1776522_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	1.6e-303
WP_000598641.1|1776518_1777238_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1777284_1777755_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1777795_1778257_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001538974.1|1778381_1780385_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001538973.1|1780381_1781518_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
>prophage 6
NZ_CP030111	Escherichia coli strain MCJCHV-1 chromosome, complete genome	4939457	1871453	1877765	4939457		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001557079.1|1871453_1872848_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	1.8e-18
WP_001773992.1|1873022_1873916_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	2.3e-46
WP_001557078.1|1874288_1875374_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	2.3e-101
WP_001023638.1|1875373_1876273_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_001681957.1|1876330_1877209_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	5.6e-106
WP_001557076.1|1877213_1877765_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.9	2.3e-49
>prophage 7
NZ_CP030111	Escherichia coli strain MCJCHV-1 chromosome, complete genome	4939457	2626176	2693273	4939457	head,protease,tail,terminase,capsid,lysis,integrase,holin	Escherichia_phage(39.66%)	80	2640286:2640311	2693412:2693437
WP_000422063.1|2626176_2627226_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559258.1|2627445_2628204_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	9.7e-06
WP_001278898.1|2628200_2628791_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291206.1|2628830_2629706_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_024186832.1|2629918_2631808_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2631835_2632456_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001538692.1|2632452_2633334_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2633471_2633516_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001538691.1|2633607_2635170_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763537.1|2635169_2636765_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001538690.1|2636768_2638127_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000209513.1|2638138_2639332_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001357405.1|2639331_2640138_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
2640286:2640311	attL	GGTATCGATATCCATGTACCAGACCG	NA	NA	NA	NA
WP_001304589.1|2640765_2641218_-	VapA/VapB family virulence-associated protein	NA	NA	NA	NA	NA
WP_001304590.1|2641403_2641736_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000355614.1|2641853_2642150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204581.1|2642159_2642438_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_016238842.1|2644648_2645248_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	1.0e-106
WP_032300536.1|2649350_2649983_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_001351101.1|2649928_2650672_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	6.1e-146
WP_021524657.1|2650682_2651381_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	1.9e-128
WP_000807940.1|2651380_2651722_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_033561640.1|2651714_2654957_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.1	0.0e+00
WP_001538679.1|2655004_2655214_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	2.0e-33
WP_000710952.1|2655309_2655684_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275433.1|2655701_2656415_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	2.3e-126
WP_000133388.1|2656480_2656825_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573362.1|2656821_2657268_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_001007909.1|2657264_2657615_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	4.6e-59
WP_000125984.1|2657627_2657954_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063027.1|2660480_2660702_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
WP_000173054.1|2660746_2662684_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	97.8	0.0e+00
WP_001304597.1|2662748_2664410_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.6	0.0e+00
WP_000958372.1|2664406_2664970_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
WP_000829186.1|2665261_2665627_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.0	1.7e-61
WP_001304598.1|2665668_2665869_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000736383.1|2666067_2666292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082534.1|2666288_2666783_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	90.7	1.1e-74
WP_000992075.1|2667081_2667615_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	1.4e-99
WP_000731249.1|2667678_2668029_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	93.0	4.0e-55
WP_000284510.1|2668033_2668249_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001304600.1|2668325_2668571_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	87.7	1.1e-14
WP_001304601.1|2668608_2668791_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	4.6e-23
WP_000216690.1|2671873_2672038_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	2.6e-17
WP_001304604.1|2672034_2672466_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	95.1	8.1e-66
WP_000935524.1|2672929_2673988_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.9	5.2e-207
WP_000917768.1|2674138_2674336_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_000762880.1|2674562_2675384_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000904114.1|2675380_2675755_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_001265091.1|2675767_2676814_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	4.5e-110
WP_001403449.1|2676815_2677088_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	1.0e-10
WP_000401168.1|2677478_2678582_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001004956.1|2678562_2679213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|2679378_2679591_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000206826.1|2679825_2680170_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
WP_000207997.1|2680166_2680334_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000224216.1|2680344_2680608_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	3.9e-31
WP_001142588.1|2680609_2680828_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	93.1	3.6e-30
WP_000510387.1|2680829_2681045_-	hypothetical protein	NA	A0A222YWK2	Escherichia_phage	94.4	2.2e-35
WP_001289989.1|2681045_2681405_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	73.5	1.7e-37
WP_001224665.1|2681570_2681753_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_000403780.1|2681905_2682205_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.3e-50
WP_001209475.1|2682182_2682644_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_001266130.1|2682640_2682937_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001141099.1|2682933_2683326_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_000450708.1|2683341_2684112_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.0	1.5e-86
WP_001309414.1|2684145_2684688_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_001262415.1|2684599_2685640_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	89.8	1.0e-98
WP_000702041.1|2685711_2686137_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001053425.1|2686120_2686396_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	97.6	1.1e-39
WP_000753626.1|2686503_2686965_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	99.3	7.6e-78
WP_000379612.1|2687218_2687374_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_001304608.1|2687533_2687773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016238838.1|2687775_2688096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001351093.1|2688073_2688511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449191.1|2688911_2689100_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2689096_2689288_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048416.1|2689380_2691852_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2691916_2692165_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2692142_2693273_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
2693412:2693437	attR	GGTATCGATATCCATGTACCAGACCG	NA	NA	NA	NA
>prophage 8
NZ_CP030111	Escherichia coli strain MCJCHV-1 chromosome, complete genome	4939457	2797773	2840373	4939457	transposase,lysis,tRNA,tail	Enterobacteria_phage(58.33%)	38	NA	NA
WP_000654168.1|2797773_2798052_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
WP_001538630.1|2798048_2800109_-	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	53.5	3.3e-125
WP_050575893.1|2800167_2803578_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.9	0.0e+00
WP_000839596.1|2803757_2803973_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|2804562_2805645_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204794.1|2805833_2806217_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	2.0e-55
WP_000971095.1|2806302_2806443_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_001538628.1|2806439_2806802_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.9	2.1e-59
WP_000774478.1|2806798_2807089_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	6.7e-48
WP_001538627.1|2807081_2807252_-	protein ninE	NA	K7P7K0	Enterobacteria_phage	67.9	4.1e-13
WP_001053004.1|2807251_2807707_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.2e-59
WP_072093903.1|2807703_2807805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700202.1|2808154_2809198_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001773871.1|2809234_2812786_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001538625.1|2813035_2813737_-	replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.3	1.0e-126
WP_001538622.1|2814967_2816044_-|transposase	IS110-like element ISEc21 family transposase	transposase	NA	NA	NA	NA
WP_001254932.1|2816926_2818078_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001556896.1|2819990_2820848_-	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	38.9	8.3e-54
WP_001556895.1|2820847_2822365_-	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	53.0	8.1e-145
WP_001773892.1|2822801_2824052_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248679.1|2824223_2824877_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2824886_2825348_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001298466.1|2825401_2826508_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001295971.1|2826543_2827185_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_033561626.1|2827188_2828559_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265481.1|2828728_2829400_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2829399_2830860_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|2830935_2832057_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|2832105_2833332_-	peptidase T	NA	NA	NA	NA	NA
WP_000531578.1|2833581_2834718_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_001538615.1|2834701_2835565_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	27.8	5.1e-11
WP_000937496.1|2835796_2836063_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.3	2.3e-18
WP_001538613.1|2836131_2836788_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_071586406.1|2836842_2836941_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
WP_000355700.1|2836980_2837274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204582.1|2837283_2837562_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	1.0e-21
WP_113305462.1|2837558_2839622_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	62.7	2.8e-148
WP_016238842.1|2839773_2840373_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	1.0e-106
>prophage 9
NZ_CP030111	Escherichia coli strain MCJCHV-1 chromosome, complete genome	4939457	2844475	2882030	4939457	head,portal,tail,terminase,capsid,lysis,integrase,holin	Escherichia_phage(42.5%)	50	2835257:2835271	2882686:2882700
2835257:2835271	attL	GATCTCGGTGCCAGC	NA	NA	NA	NA
WP_032300536.1|2844475_2845108_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_001327694.1|2845801_2846500_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	7.6e-130
WP_000847298.1|2846499_2846829_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001538602.1|2846825_2849387_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	90.7	0.0e+00
WP_001538601.1|2849367_2849781_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001299690.1|2849807_2850239_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_001538600.1|2850257_2851004_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.4	1.5e-123
WP_000683079.1|2851011_2851407_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_001538599.1|2851403_2851937_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	1.1e-56
WP_001204533.1|2851952_2852306_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000201498.1|2852298_2852682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522592.1|2852733_2853762_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
WP_000256835.1|2853819_2854167_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
WP_001773874.1|2854203_2855709_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.3	6.1e-100
WP_001538596.1|2855698_2857291_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	8.4e-185
WP_000258993.1|2857287_2857494_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_089502733.1|2857477_2859448_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.4	6.2e-262
WP_001538594.1|2859377_2859926_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.0	1.4e-57
WP_001322427.1|2860394_2860748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2860870_2861197_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_032142285.1|2861507_2861975_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
WP_001280932.1|2861977_2862109_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_001446668.1|2862123_2862306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092866.1|2862462_2862996_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_001037014.1|2863032_2863923_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.9	2.1e-108
WP_000284506.1|2863927_2864143_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001538590.1|2864219_2864465_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	92.6	8.8e-17
WP_023143432.1|2864502_2864685_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	85.0	5.1e-22
WP_001336019.1|2867042_2867378_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.7	1.4e-44
WP_000562553.1|2867658_2867790_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_001545909.1|2868685_2869507_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.8e-77
WP_000139998.1|2869521_2869884_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	9.6e-36
WP_001550965.1|2869884_2870943_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.7	1.7e-88
WP_023141427.1|2870944_2871217_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_000813254.1|2871384_2871540_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_011076332.1|2871798_2872017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001550964.1|2872630_2872813_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	2.4e-27
WP_160516836.1|2872906_2873320_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	2.0e-58
WP_001151150.1|2873320_2873743_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|2873783_2874854_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693850.1|2874925_2875351_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|2875334_2875577_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001420344.1|2875968_2876307_+	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_000379575.1|2876599_2876755_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171946.1|2876914_2877133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001517906.1|2877097_2877301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2877701_2877890_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070259.1|2877886_2878078_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000003742.1|2880673_2880943_+	excisionase	NA	NA	NA	NA	NA
WP_000074984.1|2880911_2882030_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	5.9e-84
2882686:2882700	attR	GATCTCGGTGCCAGC	NA	NA	NA	NA
>prophage 1
NZ_CP030112	Escherichia coli strain MCJCHV-1 plasmid pNMEC-O75A, complete sequence	88421	17500	60908	88421	transposase,integrase,protease	Macacine_betaherpesvirus(28.57%)	43	10576:10591	63630:63645
10576:10591	attL	TACTGATGCATGACAA	NA	NA	NA	NA
WP_000016982.1|17500_18307_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_000852146.1|19080_19836_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000772446.1|20423_21590_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817036.1|21589_22561_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_001348615.1|23427_24330_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086185.1|24714_25398_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_001104873.1|25398_25620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274437.1|25633_26068_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001671341.1|27434_27737_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271753.1|27783_28206_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027516.1|28202_28394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|29428_29659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170714.1|29710_31072_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001348621.1|31119_31683_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	1.0e-20
WP_001774176.1|31708_31915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032143370.1|32135_32324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000936285.1|33209_35111_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.1	3.1e-32
WP_042045560.1|35260_35758_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	72.3	3.3e-39
WP_000616807.1|36220_36874_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|36966_37224_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|37156_37558_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001262765.1|37842_39153_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000027057.1|39429_40290_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_114523785.1|40588_41293_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	5.8e-138
WP_000557454.1|41461_42322_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067858.1|43868_44573_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000951934.1|45564_45756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000248278.1|45779_46007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080860.1|46057_47194_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_014342212.1|47160_47310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|48636_49341_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000449408.1|49490_49649_+	copper-sensitivity suppressor C	NA	NA	NA	NA	NA
WP_000949452.1|49638_50145_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_012372823.1|50327_51143_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000118029.1|51489_53376_+	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_000178050.1|53416_53944_+	iron transporter	NA	NA	NA	NA	NA
WP_000119836.1|54047_55427_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_033561596.1|55429_56713_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000729218.1|56702_57833_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000117262.1|57837_58533_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_001267176.1|58519_59005_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000874189.1|59029_59515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001189106.1|60419_60908_-|transposase	transposase	transposase	A0A077SK28	Escherichia_phage	93.2	6.7e-24
63630:63645	attR	TTGTCATGCATCAGTA	NA	NA	NA	NA
