The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017235	Lactobacillus delbrueckii subsp. bulgaricus strain L99 chromosome, complete genome	1848107	934373	1015211	1848107	transposase,protease,integrase,tRNA	Streptococcus_phage(27.78%)	57	930153:930171	1027461:1027479
930153:930171	attL	CTGGTTCTTCTTCAGCTTG	NA	NA	NA	NA
WP_003621053.1|934373_935015_-|integrase	tyrosine-type recombinase/integrase	integrase	A3F636	Streptococcus_phage	34.9	2.3e-24
WP_041813527.1|935349_935790_-	hydrolase	NA	NA	NA	NA	NA
WP_035170348.1|935878_936115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114893891.1|937108_938395_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_114893890.1|938592_938871_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_114893889.1|943647_943980_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_114893898.1|945038_946979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162817348.1|946982_950792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003618110.1|952116_952578_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011678292.1|952577_954305_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	1.6e-32
WP_114893899.1|954304_956062_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.5	4.4e-41
WP_003618103.1|956144_956453_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_077302214.1|956497_956896_-	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	32.4	8.4e-09
WP_114894091.1|956912_957218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080585129.1|958056_958536_-	ribonuclease HI	NA	A0A0H3UZB5	Geobacillus_virus	32.1	1.2e-14
WP_114894092.1|958757_959240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114893900.1|959447_959714_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_114893901.1|959715_960435_-	HAD family hydrolase	NA	M1H9H9	Acanthocystis_turfacea_Chlorella_virus	24.6	1.4e-06
WP_162817342.1|961249_961519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114893903.1|962111_962897_-	DNA polymerase III subunit epsilon	NA	A0A1X9I5C8	Streptococcus_phage	31.3	1.5e-17
WP_114893904.1|962901_963501_-	MmcQ family protein	NA	NA	NA	NA	NA
WP_114893905.1|963507_964281_-	DUF218 domain-containing protein	NA	NA	NA	NA	NA
WP_114893906.1|964273_964573_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_114893907.1|967054_967498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060598015.1|967813_969847_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_060598016.1|969839_971135_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_060598019.1|971800_972259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081044837.1|972513_973443_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_162817349.1|973977_974166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060598021.1|974226_977409_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	22.4	1.4e-18
WP_138464002.1|977521_977770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060598023.1|978093_979284_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	23.5	2.6e-05
WP_060598269.1|979276_981868_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.4	1.7e-97
WP_060598024.1|982262_982472_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_114893909.1|983151_984378_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	47.5	2.8e-95
WP_035165481.1|984600_984792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041806519.1|984841_985690_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_003620561.1|985735_987160_-	NOL1/NOP2/sun family putative RNA methylase	NA	NA	NA	NA	NA
WP_003623050.1|987152_988127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076026420.1|988126_988867_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002880372.1|988977_989175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011543930.1|989321_989933_-	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_014564970.1|990011_990764_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_060598026.1|991917_993348_-	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_114893910.1|993448_994969_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_114893911.1|994972_995896_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.7	2.1e-26
WP_114893912.1|996226_996688_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_114894093.1|997138_997558_+	3-beta hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_114893913.1|997619_998531_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_114893914.1|1000696_1006108_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.3	7.2e-10
WP_114893915.1|1007144_1007645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114893916.1|1007765_1008428_+	DedA family protein	NA	NA	NA	NA	NA
WP_060598032.1|1008731_1009748_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	39.1	4.1e-60
WP_014564984.1|1009823_1011122_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	28.4	8.2e-53
WP_041814345.1|1011174_1012479_-|transposase	ISL3-like element ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.0	1.1e-57
WP_014564986.1|1012615_1013665_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.2	1.9e-52
WP_014564987.1|1013987_1015211_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.7	1.0e-97
1027461:1027479	attR	CAAGCTGAAGAAGAACCAG	NA	NA	NA	NA
>prophage 2
NZ_CP017235	Lactobacillus delbrueckii subsp. bulgaricus strain L99 chromosome, complete genome	1848107	1022191	1091164	1848107	transposase,protease,integrase,tRNA	Streptococcus_phage(18.75%)	55	1024366:1024425	1049556:1049634
WP_014564992.1|1022191_1023415_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.2	7.4e-96
1024366:1024425	attL	CTTTGGCAGCCAGCTCAGTCTTCTTGTATCCAGTTCTAGAGTAGAGCGAATCGTCAAAGA	NA	NA	NA	NA
WP_003618241.1|1025677_1025989_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011543945.1|1026168_1027005_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_114893917.1|1027047_1027614_+	signal peptidase I	NA	NA	NA	NA	NA
WP_002878604.1|1027683_1027875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064081700.1|1028261_1029500_-	peptidase T	NA	NA	NA	NA	NA
WP_059216940.1|1029543_1030341_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_064081699.1|1030333_1031026_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_064081698.1|1031169_1031610_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_064081697.1|1031609_1032437_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_114893918.1|1033641_1033983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064081743.1|1033985_1036100_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_064081742.1|1036114_1038700_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_064081741.1|1038712_1042204_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_064081740.1|1042216_1045753_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_050952513.1|1045767_1046328_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_064081739.1|1046339_1046954_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_064081738.1|1047097_1049191_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_064081737.1|1049313_1049493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114893919.1|1050095_1051319_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.0	2.3e-97
1049556:1049634	attR	TCTTTGACGATTCGCTCTACTCTAGAACTGGATACAAGAAGACTGAGCTGGCTGCCAAAGATGGTGCCCAGATTGATGC	NA	NA	NA	NA
WP_064081683.1|1052444_1054682_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.2	2.4e-60
WP_003620400.1|1056623_1057760_-	sigma-70 family RNA polymerase sigma factor	NA	G8CLC7	Synechococcus_phage	35.9	1.6e-36
WP_089119926.1|1057795_1058917_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	36.6	2.9e-38
WP_114893920.1|1058958_1060077_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	2.4e-37
WP_064081562.1|1060048_1061887_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.7	5.4e-58
WP_064081561.1|1061918_1063985_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003618715.1|1063977_1064889_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_064081560.1|1065153_1065903_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_011543965.1|1065902_1066808_-	GTPase Era	NA	NA	NA	NA	NA
WP_003618710.1|1066791_1067211_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_003618709.1|1067212_1067737_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_114893921.1|1067736_1068684_-	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	48.8	4.0e-49
WP_002880182.1|1068837_1069014_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003618707.1|1069183_1070041_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_089119927.1|1070100_1070370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089119928.1|1070435_1071320_-	YitT family protein	NA	NA	NA	NA	NA
WP_081044841.1|1072480_1072792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060598055.1|1072752_1073001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003618701.1|1073244_1074429_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_114893922.1|1074610_1075921_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_155589467.1|1076277_1076424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002880191.1|1076798_1077695_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003623888.1|1077776_1079171_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IB03	Erwinia_phage	26.2	8.5e-32
WP_003618695.1|1079173_1079707_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_014565032.1|1079815_1080703_-	tyrosine recombinase XerC	NA	S5W9T9	Leptospira_phage	30.2	1.4e-24
WP_114893923.1|1080702_1082022_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_064081723.1|1082153_1084337_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	34.8	2.7e-93
WP_003613722.1|1084463_1085303_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	37.4	2.4e-29
WP_014565035.1|1085400_1086171_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	37.2	9.5e-25
WP_014565036.1|1086160_1087018_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_002880201.1|1087092_1087323_-	YozE family protein	NA	NA	NA	NA	NA
WP_041814367.1|1087326_1088172_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	45.0	1.3e-19
WP_014565038.1|1088305_1088968_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_003618685.1|1088993_1090184_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	47.8	2.4e-43
WP_014565040.1|1090264_1091164_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	40.1	2.1e-52
>prophage 3
NZ_CP017235	Lactobacillus delbrueckii subsp. bulgaricus strain L99 chromosome, complete genome	1848107	1238146	1246718	1848107		Prochlorococcus_phage(33.33%)	8	NA	NA
WP_003618420.1|1238146_1238728_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	35.4	1.1e-25
WP_014565103.1|1238727_1239771_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.3	6.3e-64
WP_014565104.1|1239773_1241252_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.2	2.3e-51
WP_014565105.1|1241227_1243450_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	6.5e-143
WP_003615545.1|1243449_1244124_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003615547.1|1244123_1244372_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003615550.1|1244376_1245099_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	36.8	1.3e-36
WP_014565107.1|1245422_1246718_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.6	1.4e-20
>prophage 4
NZ_CP017235	Lactobacillus delbrueckii subsp. bulgaricus strain L99 chromosome, complete genome	1848107	1676745	1682516	1848107		Streptomyces_phage(50.0%)	6	NA	NA
WP_114894046.1|1676745_1677525_-	hydrolase	NA	A0A1V0DZX6	Clostridioides_phage	36.1	3.1e-07
WP_114894047.1|1678416_1679199_-	C40 family peptidase	NA	A0A2L1IW19	Streptomyces_phage	42.7	3.4e-14
WP_089120100.1|1679386_1679860_-	C40 family peptidase	NA	A0A2L1IW19	Streptomyces_phage	41.9	1.4e-15
WP_011544283.1|1680032_1681079_-	lactate dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	29.4	1.8e-26
WP_014565357.1|1681363_1681849_-	C40 family peptidase	NA	A0A2L1IW19	Streptomyces_phage	40.4	2.5e-15
WP_114894048.1|1681973_1682516_-	AAA family ATPase	NA	U5J9X2	Bacillus_phage	35.4	1.3e-12
