The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	7735	78858	4994045	protease,transposase	Ralstonia_phage(30.0%)	56	NA	NA
WP_011407164.1|7735_8572_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011407165.1|8758_9565_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|9841_11035_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011257014.1|11188_11860_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257015.1|11944_12706_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12752_13175_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13178_13592_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_109182051.1|13887_14655_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14665_14935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407167.1|15009_16470_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011257020.1|17116_18127_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|18398_19601_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|19742_21881_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|22091_22385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296734.1|22416_22914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257024.1|23160_24141_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	1.6e-88
WP_011257025.1|24188_25355_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_069959658.1|25501_26068_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_069959660.1|27542_28751_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011257029.1|29378_30401_-	sugar kinase	NA	NA	NA	NA	NA
WP_011258802.1|31223_32192_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407176.1|32679_33816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129215536.1|33812_34520_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.6e-05
WP_109182052.1|35121_36498_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.5	9.2e-79
WP_012443643.1|39510_39753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443642.1|39694_40018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257128.1|40483_41464_-|transposase	IS5-like element ISXoo7 family transposase	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
WP_011407184.1|42082_43372_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
WP_011407185.1|43811_44147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407187.1|44421_44853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155296471.1|45014_45167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743401.1|45201_46611_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041181902.1|46888_47104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257122.1|47928_48189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|48205_48538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080256644.1|48537_48996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407913.1|49355_50570_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_094187731.1|51090_51888_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182053.1|53603_54569_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_125168734.1|54565_54844_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_109182054.1|54987_56376_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407197.1|56423_57470_+	methylamine utilization protein	NA	NA	NA	NA	NA
WP_011407198.1|57610_58108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703730.1|58271_58904_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_011257110.1|58920_61083_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011407199.1|61197_61383_-	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_011257109.1|61405_64009_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_094187819.1|64005_65895_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_011257107.1|65951_67709_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_011407200.1|67711_69946_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_027703733.1|69942_71526_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_011257104.1|71999_73628_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_011257103.1|73624_74989_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_011257102.1|75181_76123_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_011407202.1|76363_78088_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
WP_109181945.1|78094_78858_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	88333	139389	4994045	transposase	Ralstonia_phage(57.14%)	48	NA	NA
WP_011258802.1|88333_89302_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011257091.1|89769_91587_-	type III secretion system outer membrane ring subunit SctC	NA	NA	NA	NA	NA
WP_011257090.1|91669_92500_-	type III secretion system export apparatus protein SctT	NA	NA	NA	NA	NA
WP_011257089.1|92496_93006_-	type III secretion protein HrpB7	NA	NA	NA	NA	NA
WP_011257088.1|92998_94327_-	type III secretion system ATPase SctN	NA	NA	NA	NA	NA
WP_011257087.1|94316_95018_-	type III secretion system stator protein SctL	NA	NA	NA	NA	NA
WP_011257086.1|95002_95632_-	type III secretion protein HrpB4	NA	NA	NA	NA	NA
WP_011257085.1|95639_96401_-	type III secretion inner membrane ring lipoprotein SctJ	NA	NA	NA	NA	NA
WP_011407211.1|96402_96795_-	type III secretion protein HrpB2	NA	NA	NA	NA	NA
WP_011257083.1|96828_97284_-	HrpB1 family type III secretion system apparatus protein	NA	NA	NA	NA	NA
WP_012443605.1|97498_98578_+	type III secretion system export apparatus subunit SctU	NA	NA	NA	NA	NA
WP_011257081.1|98571_100509_+	hypersensitivity response secretion protein hrcV	NA	NA	NA	NA	NA
WP_027704247.1|100508_101150_+	type III secretion system protein SctP	NA	NA	NA	NA	NA
WP_027704248.1|101242_102196_+	type III secretion system cytoplasmic ring protein SctQ	NA	NA	NA	NA	NA
WP_011407215.1|102182_102827_+	type III secretion system export apparatus protein SctR	NA	NA	NA	NA	NA
WP_011257077.1|102831_103092_+	type III secretion system export apparatus subunit SctS	NA	NA	NA	NA	NA
WP_011257076.1|103088_103916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257075.1|103912_104851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257074.1|104860_105103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257073.1|105183_105465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257072.1|105519_105990_+	protein HpaB	NA	NA	NA	NA	NA
WP_011257071.1|106404_108390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182055.1|108386_108833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|110533_111502_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011257310.1|111628_112864_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109182056.1|113034_114354_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407219.1|114542_115526_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_109182057.1|115896_117132_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407220.1|117567_119940_+	HPr kinase	NA	NA	NA	NA	NA
WP_011257061.1|120815_122444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407223.1|123001_123385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407224.1|123381_123867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407225.1|123870_124233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407226.1|124349_125786_-	Do family serine endopeptidase	NA	W5SAB9	Pithovirus	30.7	1.5e-10
WP_011407227.1|126027_126879_+	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
WP_011257053.1|127338_127656_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011257052.1|127961_128849_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_011407229.1|129555_130506_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.9	3.0e-97
WP_125168735.1|130619_130829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407230.1|130896_131157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257048.1|131209_131491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407231.1|131629_132688_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011407232.1|132828_133776_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
WP_011407233.1|134030_134342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|135808_136279_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011257042.1|136448_137141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257041.1|137232_137631_+	host attachment protein	NA	NA	NA	NA	NA
WP_011407237.1|138432_139389_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
>prophage 3
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	174196	263579	4994045	tRNA,transposase	Acidithiobacillus_phage(16.67%)	52	NA	NA
WP_109182058.1|174196_175162_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187801.1|176597_177396_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082325201.1|177634_179017_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	4.7e-75
WP_011407263.1|180418_181447_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407264.1|181691_182219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464354.1|183041_185225_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_011407267.1|185236_188587_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_011407268.1|188583_191700_-	DUF3416 domain-containing protein	NA	NA	NA	NA	NA
WP_011407278.1|198845_200165_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257184.1|200321_201842_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_011257185.1|201858_202137_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_011257186.1|202326_202665_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_011407279.1|203277_205263_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_011257188.1|206182_206995_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_011257189.1|207187_207799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257190.1|208215_209073_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	31.5	2.9e-14
WP_011257191.1|209310_211197_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_069963816.1|211762_213139_+|transposase	IS5-like element ISXoo4 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.7e-78
WP_011257193.1|213543_216267_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.0	4.8e-71
WP_041182356.1|216334_218488_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.5	2.0e-27
WP_011257195.1|218484_220176_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_041181914.1|220172_220436_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	4.4e-06
WP_011257196.1|220497_222699_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
WP_011257197.1|222695_224384_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_011257198.1|224917_226822_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_075239321.1|227082_227262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407290.1|227395_227863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257199.1|228020_228980_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_011407291.1|228964_229582_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011257200.1|229624_230044_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_011257201.1|230296_231202_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	39.2	4.4e-37
WP_011257202.1|231450_232335_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_011257203.1|232398_233181_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407292.1|233225_233987_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_011257206.1|234150_234480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407293.1|234798_235890_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_011407294.1|235958_237557_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_011407295.1|237721_238966_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_011257210.1|239417_240047_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	3.3e-52
WP_011257211.1|240253_242230_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.2	1.1e-112
WP_011407298.1|243616_244282_-	YceH family protein	NA	NA	NA	NA	NA
WP_011257214.1|244568_245579_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_011257215.1|245575_246307_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_011257216.1|246660_248190_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	1.0e-46
WP_011407300.1|248299_251332_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257218.1|251630_254669_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257219.1|254833_255886_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_075240491.1|256053_256299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407301.1|256297_257263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257221.1|257262_259923_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_008573820.1|261740_261944_-	YdcH family protein	NA	NA	NA	NA	NA
WP_109182059.1|262477_263579_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	2.1e-41
>prophage 4
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	282645	416868	4994045	holin,transposase,tRNA	Bacillus_phage(13.33%)	95	NA	NA
WP_011257031.1|282645_283614_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011257243.1|283867_286030_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011407318.1|286577_287882_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011407319.1|287941_288544_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011257245.1|288540_290445_+	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_011407325.1|299760_300576_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_041182297.1|300922_301885_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182012.1|301989_302752_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257253.1|304551_305610_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011257254.1|305620_305911_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257255.1|305900_306563_-	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_012446379.1|306559_307111_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257257.1|307122_307872_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407332.1|307871_308666_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257259.1|309050_309338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703982.1|309356_309914_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182061.1|309931_310897_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407336.1|311741_312698_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	2.9e-39
WP_109182012.1|312769_313532_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182062.1|313571_314370_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407338.1|314501_315716_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
WP_109182063.1|315775_316606_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257269.1|316768_318004_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011257271.1|319402_319831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407344.1|319841_320291_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257273.1|320271_320499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407346.1|320806_322561_-	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
WP_109182012.1|323501_324264_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703800.1|324317_324902_-	gluconokinase	NA	NA	NA	NA	NA
WP_011407349.1|325059_326442_+	MFS transporter	NA	NA	NA	NA	NA
WP_044757567.1|326444_328844_+	NdvB protein	NA	NA	NA	NA	NA
WP_109182064.1|328947_331590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257279.1|332337_335787_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011407353.1|335979_336564_-	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011407354.1|337040_337817_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069959686.1|337997_339299_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011257283.1|339301_339661_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_011257284.1|340097_341579_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
WP_109182027.1|341771_342737_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407357.1|343562_345725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182065.1|345851_348020_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011257288.1|348657_349287_-|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_011257289.1|349289_349721_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011257290.1|349777_350356_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_027703865.1|350451_351204_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_011257292.1|351428_351818_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011257293.1|351931_353605_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
WP_044757204.1|353601_354246_-	sterol-binding protein	NA	NA	NA	NA	NA
WP_011407366.1|357930_358215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182066.1|358566_359365_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|359424_360188_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182067.1|364142_365108_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042464374.1|366168_367275_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465421.1|369068_370007_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_080493948.1|370125_370914_-	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	4.5e-54
WP_012446343.1|370877_371669_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257314.1|371686_372682_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
WP_075242284.1|372718_373546_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_109182068.1|373630_374626_-	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_011407380.1|374691_374964_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_153296754.1|375084_375246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465424.1|375449_376037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257320.1|376033_376234_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011407383.1|376294_377896_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024712051.1|377927_378674_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
WP_011407385.1|378670_379864_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407386.1|380273_381296_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_041181930.1|381435_383001_-	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
WP_011257326.1|383011_384025_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407388.1|384014_384716_-	SapC family protein	NA	NA	NA	NA	NA
WP_011407389.1|384899_387914_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257330.1|388303_388993_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_069959690.1|389417_391655_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_069959691.1|391863_393654_+	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_069959692.1|393753_394212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257334.1|394876_395869_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_109182069.1|395993_397313_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407394.1|398618_399533_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407395.1|399660_400413_-	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.9	5.6e-22
WP_011257339.1|400646_403181_+	iron-uptake factor	NA	NA	NA	NA	NA
WP_041181934.1|403803_404685_-	TolB-like protein	NA	NA	NA	NA	NA
WP_011257342.1|404737_405589_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_011407398.1|405590_405977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257344.1|406011_406161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757197.1|406438_408571_+	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
WP_094187715.1|408708_409471_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407399.1|409660_409927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182029.1|410009_410975_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012446321.1|410987_411176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257349.1|411137_411608_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011257350.1|412298_413822_+	catalase	NA	A0A2K9L0T1	Tupanvirus	48.0	2.2e-97
WP_011257351.1|413880_414456_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_113160272.1|414740_414926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446316.1|415176_415401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257354.1|415863_416868_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	572593	630672	4994045	tRNA,transposase,integrase	Sinorhizobium_phage(10.0%)	52	580744:580760	629206:629222
WP_109182067.1|572593_573559_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407489.1|574026_575346_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257475.1|575875_576391_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011407490.1|576793_579016_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_103057279.1|579484_580510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959707.1|580493_581096_+	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
580744:580760	attL	GCGTAGTGCTGCGTCAT	NA	NA	NA	NA
WP_069959708.1|581426_582371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407493.1|582889_584266_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011407494.1|584350_586252_+	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
WP_011257482.1|586437_586653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407495.1|586759_587536_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407496.1|587697_588372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407497.1|588368_589142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257486.1|589365_589929_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_011257487.1|589939_592432_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
WP_011257488.1|592614_593889_-	RDD family protein	NA	NA	NA	NA	NA
WP_069959711.1|593930_594653_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_011257490.1|594693_595167_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_011257491.1|595209_596352_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_011407499.1|596423_597560_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_011257493.1|597692_598205_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_011257494.1|598599_599523_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_011407500.1|599522_600836_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011257496.1|600886_602608_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_044757153.1|602772_604050_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257498.1|604247_605072_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011407501.1|605075_606131_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_011257500.1|606296_607763_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_042465436.1|607759_608263_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_011257502.1|608372_609506_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_011407503.1|609748_610270_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011407504.1|610469_611384_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_011257505.1|611484_611925_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_011407505.1|612033_613908_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_011407506.1|614100_614421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960144.1|614572_614791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041181948.1|615170_616265_+|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	36.9	2.6e-52
WP_025988679.1|616503_616743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959713.1|618222_618942_+	P-type DNA transfer protein VirB5	NA	NA	NA	NA	NA
WP_011257512.1|618955_619435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181949.1|619431_619692_+	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_011257514.1|619693_620779_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_041181950.1|620785_621088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257516.1|622555_622966_+	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	52.0	7.0e-35
WP_041181951.1|623046_624321_+	DNA cytosine methyltransferase	NA	A0A191SB20	Nostoc_phage	37.4	8.3e-58
WP_011257518.1|624317_625115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257519.1|625374_626649_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.3	1.4e-110
WP_011257520.1|626782_626989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257521.1|626985_627258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407508.1|627254_627500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257523.1|627643_627772_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011407512.1|629436_630672_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
629206:629222	attR	ATGACGCAGCACTACGC	NA	NA	NA	NA
>prophage 6
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	779873	817338	4994045	tRNA,transposase	Enterobacteria_phage(36.36%)	32	NA	NA
WP_109182077.1|779873_781193_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407610.1|783221_784535_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
WP_011407611.1|784524_785343_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_069959723.1|785565_786507_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011257675.1|786506_787253_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011407612.1|787478_788534_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011407613.1|788589_789477_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407614.1|789473_790031_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
WP_011407615.1|790027_790936_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
WP_011257680.1|791052_792456_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011407616.1|792501_793848_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_011407617.1|793981_794713_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_011257683.1|794712_795342_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_011258802.1|795445_796414_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407618.1|796559_798647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446093.1|798643_800293_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_011257686.1|800408_801017_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	31.4	1.8e-23
WP_011257687.1|801567_802212_-	ABC transporter	NA	NA	NA	NA	NA
WP_011257688.1|802208_803135_-	MCE family protein	NA	NA	NA	NA	NA
WP_011257689.1|803137_803980_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.1	9.1e-13
WP_011407620.1|804065_805178_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_109182078.1|805347_806595_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_011407621.1|806656_807118_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011257693.1|807260_808955_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011257694.1|809066_809471_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_011407623.1|809602_810376_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011257696.1|810386_810854_+	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_011407624.1|810850_811333_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182079.1|811891_813211_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182080.1|813368_814688_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407627.1|814900_815869_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_109182081.1|816018_817338_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	874672	928019	4994045	protease,transposase	Ralstonia_phage(25.0%)	45	NA	NA
WP_011258802.1|874672_875641_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011257741.1|877379_877670_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_011407655.1|877684_878719_-	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_011257743.1|878721_879354_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_011257744.1|879373_880240_-	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_011257745.1|880236_882081_-	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_011257746.1|882077_882752_-	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_011407656.1|882879_885171_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_109182084.1|885282_886248_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257750.1|886638_887214_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_011407659.1|887326_887836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010368401.1|887934_888129_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_011257752.1|888218_889196_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011257753.1|889425_889866_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_011257754.1|890143_891088_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_011407660.1|891170_891914_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
WP_010368407.1|892118_892358_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
WP_011407661.1|892499_893735_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_011407662.1|893905_895261_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_011257758.1|895321_896395_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_069959732.1|896391_897351_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_011257760.1|897347_897701_+	type IV fimbriae assembly protein	NA	NA	NA	NA	NA
WP_133261978.1|898403_899186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407665.1|899547_899874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181972.1|900109_901708_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_011257763.1|901853_902750_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_011407667.1|902825_903980_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_069963828.1|904174_906766_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_011407669.1|907088_907226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960159.1|907498_908698_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_011407672.1|909197_911414_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703871.1|911493_912492_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011257770.1|912601_912784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182085.1|913763_916751_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182786.1|916925_917873_+	glycerophosphodiester phosphodiesterase family protein	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
WP_011407676.1|918371_918908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182086.1|918978_920298_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182087.1|920642_921605_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	2.2e-42
WP_011257778.1|921738_922299_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011257779.1|922341_922824_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_011407679.1|922986_923463_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011257781.1|923873_924773_+	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011257782.1|925012_925399_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011407680.1|926028_927156_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257784.1|927155_928019_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 8
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	933319	1097833	4994045	protease,transposase,integrase	Ralstonia_phage(25.0%)	116	1026016:1026034	1094944:1094962
WP_011257788.1|933319_934102_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_109182119.1|934212_935589_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.4	5.0e-77
WP_011257791.1|935832_936468_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_103057263.1|937094_937628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257793.1|937753_937951_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_011407685.1|937960_939073_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011257795.1|939053_940388_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257796.1|940621_941542_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
WP_011257797.1|941618_942935_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_011257798.1|943207_944587_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011407686.1|944607_945264_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_011257800.1|945392_946046_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407687.1|946316_946778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703665.1|947837_948722_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257806.1|948842_950291_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_011257807.1|950358_951006_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_011257808.1|951822_952896_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_011407690.1|953226_954789_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
WP_011407691.1|954785_955910_-	threonine dehydratase	NA	NA	NA	NA	NA
WP_011257810.1|955985_956243_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_011257811.1|956226_957948_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
WP_011257812.1|957991_958993_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011407693.1|960269_962147_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011407694.1|962572_964924_+	biopolymer transporter Tol	NA	NA	NA	NA	NA
WP_011407695.1|965034_965928_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407696.1|965976_968943_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
WP_011257817.1|969557_970706_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011257818.1|970819_971356_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
WP_011407697.1|971552_972035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182067.1|974310_975276_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109182120.1|975272_975446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446005.1|975730_976222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257827.1|977901_979158_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011257828.1|979317_979881_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_011257829.1|980247_981606_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_027703752.1|981605_982202_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_011257831.1|982348_983233_+	membrane protein	NA	NA	NA	NA	NA
WP_011257834.1|985214_985829_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011257835.1|985911_986898_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|987013_987508_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|987752_989582_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011407704.1|989600_990071_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|990993_992121_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|992221_993604_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_011257842.1|993851_995975_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407706.1|996503_997022_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_109182088.1|997729_998831_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.2e-41
WP_011257570.1|999346_1000582_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_103057209.1|1001195_1002044_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_011407175.1|1003790_1004759_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407713.1|1007035_1008271_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109182089.1|1009253_1010573_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182948.1|1011318_1012242_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.3e-36
WP_109182121.1|1013304_1014270_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|1014571_1016149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|1016216_1016980_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1019648_1020617_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011407721.1|1020877_1021339_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011257866.1|1021887_1022130_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_109182012.1|1022123_1022887_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_049756327.1|1022919_1023651_-	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
WP_109182091.1|1025470_1026223_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
1026016:1026034	attL	GCGACAGCGGCTACACCGG	NA	NA	NA	NA
WP_109181928.1|1026224_1027190_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257874.1|1027453_1028461_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011257875.1|1028604_1029366_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_012445939.1|1032681_1033974_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1034066_1034693_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|1034817_1036104_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_012445937.1|1036247_1038719_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
WP_002806049.1|1038932_1039205_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_011407728.1|1040036_1042007_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011407729.1|1042712_1043891_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011257886.1|1043887_1044655_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011257887.1|1044667_1045324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257888.1|1045351_1045804_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_011257889.1|1045812_1046547_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_011257891.1|1046982_1047687_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_109182092.1|1048605_1049142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445927.1|1050033_1050234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960070.1|1053419_1055570_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
WP_044757078.1|1055566_1057264_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_011257897.1|1057583_1059788_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
WP_011257898.1|1059784_1061479_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_075239641.1|1061475_1061739_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_109182093.1|1061800_1064008_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-19
WP_075242494.1|1064004_1065684_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_075239641.1|1065680_1065944_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_011257899.1|1066005_1066563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182094.1|1066645_1067611_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407739.1|1067709_1068396_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
WP_011257902.1|1068506_1068911_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_011407740.1|1069121_1070171_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257904.1|1070191_1070941_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011257905.1|1070940_1071690_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011257906.1|1071689_1072721_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257907.1|1072738_1073098_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011407742.1|1073122_1073620_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011257909.1|1073616_1073862_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011257910.1|1073858_1074305_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011257911.1|1074866_1076963_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
WP_011257912.1|1076969_1077290_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011257913.1|1077387_1077981_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_011407744.1|1078082_1078433_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257915.1|1078552_1079086_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011257916.1|1079082_1081035_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011257917.1|1081027_1081984_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011407746.1|1081989_1082943_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_012445908.1|1082981_1084850_+	membrane protein	NA	NA	NA	NA	NA
WP_011407749.1|1086365_1086881_+	peptide deformylase	NA	NA	NA	NA	NA
WP_103057268.1|1087397_1088156_+	cellulase	NA	NA	NA	NA	NA
WP_041182379.1|1088628_1089375_+	cellulase	NA	NA	NA	NA	NA
WP_011407751.1|1089991_1091593_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_011257570.1|1092581_1093817_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407317.1|1094645_1095614_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	5.6e-99
1094944:1094962	attR	CCGGTGTAGCCGCTGTCGC	NA	NA	NA	NA
WP_075241901.1|1096081_1096432_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_109182095.1|1096513_1097833_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	1136563	1179010	4994045	transposase	Leptospira_phage(25.0%)	41	NA	NA
WP_109182097.1|1136563_1137665_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.5e-42
WP_011407778.1|1139095_1139719_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_011257965.1|1139742_1139982_+	rubredoxin	NA	NA	NA	NA	NA
WP_011257966.1|1140031_1140913_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011407780.1|1141062_1141512_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_109181886.1|1141662_1142310_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_011257969.1|1142401_1142872_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_011407783.1|1142868_1143459_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_011257971.1|1144067_1144367_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_011407784.1|1144363_1144585_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_011407785.1|1144820_1145363_+	YecA family protein	NA	NA	NA	NA	NA
WP_011257974.1|1145373_1146714_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_162013040.1|1147231_1147390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181887.1|1147421_1148185_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257975.1|1148417_1149743_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_011257976.1|1149941_1150289_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011407789.1|1150285_1152694_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_011257978.1|1152872_1154030_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_011257979.1|1154045_1154645_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C6K8R3	Cassava_brown_streak_virus	34.8	3.8e-13
WP_011257980.1|1154641_1155037_-	glyoxalase	NA	NA	NA	NA	NA
WP_011257981.1|1155033_1155759_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_011257982.1|1155868_1156729_+	YicC family protein	NA	NA	NA	NA	NA
WP_011257983.1|1156845_1157457_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	30.9	3.1e-10
WP_099051298.1|1157637_1158435_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407791.1|1158583_1158883_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_011257986.1|1159011_1161183_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_011257987.1|1161262_1161643_+	RidA family protein	NA	NA	NA	NA	NA
WP_011407792.1|1161663_1163817_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011257989.1|1163942_1164881_+	inosine-uridine preferring nucleoside hydrolase	NA	NA	NA	NA	NA
WP_005911911.1|1164952_1165195_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011407793.1|1165408_1166698_+	citrate synthase	NA	NA	NA	NA	NA
WP_011407794.1|1167075_1167726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257992.1|1168035_1170465_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_011407795.1|1170680_1171739_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011257994.1|1171738_1172497_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011257995.1|1172493_1173159_+	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_011257996.1|1173155_1173689_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011407796.1|1173708_1175658_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_094187763.1|1175728_1176527_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407713.1|1176669_1177905_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407799.1|1177975_1179010_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	1218226	1250215	4994045	transposase	Feldmannia_irregularis_virus(16.67%)	24	NA	NA
WP_094187715.1|1218226_1218989_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182098.1|1219078_1220044_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407833.1|1221942_1222620_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_027704066.1|1222699_1223089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182099.1|1223301_1224189_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	33.1	2.4e-32
WP_041182001.1|1224622_1225606_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	2.2e-98
WP_011407838.1|1225779_1227867_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011407839.1|1228018_1228678_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_094187758.1|1228758_1229556_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407841.1|1229578_1229758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258045.1|1229776_1230181_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258046.1|1230214_1230574_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258047.1|1230817_1231690_-	ion transporter	NA	NA	NA	NA	NA
WP_011258048.1|1231762_1232989_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
WP_011407842.1|1233234_1233852_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_042464589.1|1235388_1236996_+	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
WP_011258050.1|1236992_1237418_+	cytochrome c	NA	NA	NA	NA	NA
WP_011407846.1|1237442_1237946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407850.1|1239388_1239838_+	azurin	NA	NA	NA	NA	NA
WP_027703881.1|1243228_1244518_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_044757054.1|1244803_1247983_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258055.1|1248479_1249349_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.4e-29
WP_011258056.1|1249370_1250042_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_012444927.1|1250038_1250215_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	1331850	1425607	4994045	tRNA,transposase	Acinetobacter_phage(33.33%)	59	NA	NA
WP_109181890.1|1331850_1332907_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011407897.1|1333227_1334721_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_005919170.1|1334920_1335253_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_128896923.1|1336964_1338062_+	HutD family protein	NA	NA	NA	NA	NA
WP_011258133.1|1340215_1341799_-	alpha-L-arabinofuranosidase	NA	NA	NA	NA	NA
WP_027704032.1|1342046_1343096_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_011407903.1|1343383_1344175_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_109181891.1|1344362_1345328_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407905.1|1345629_1347006_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_011407907.1|1348578_1349649_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_011407908.1|1349639_1350437_+	aminotransferase class IV family protein	NA	NA	NA	NA	NA
WP_011258141.1|1350546_1350804_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_011407909.1|1350847_1351360_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_011407910.1|1351425_1352205_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_005989873.1|1352328_1352736_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_011407911.1|1353361_1354852_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011407912.1|1355192_1355600_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_011407913.1|1356019_1357234_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_011407915.1|1358559_1358835_-	glutathione transferase	NA	NA	NA	NA	NA
WP_011258151.1|1358864_1359170_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_011407916.1|1359615_1362201_+	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.4	3.8e-126
WP_041182015.1|1362325_1363237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181892.1|1363267_1363417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258158.1|1366480_1368358_+	TonB-dependent vitamin B12 receptor	NA	A0A0P0I887	Acinetobacter_phage	29.5	4.9e-06
WP_011258160.1|1370130_1370724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703819.1|1370723_1371323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258162.1|1371319_1371931_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_011258163.1|1372444_1372966_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_011407923.1|1372962_1374009_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258165.1|1374005_1374596_+	fructose 2,6-bisphosphatase	NA	NA	NA	NA	NA
WP_011258166.1|1374592_1375327_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_011407924.1|1375501_1376698_-	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_011407925.1|1376694_1378464_-	iron transporter	NA	NA	NA	NA	NA
WP_011258170.1|1379633_1381436_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_011258171.1|1381432_1382659_-	siderophore biosynthesis protein PvsA	NA	NA	NA	NA	NA
WP_011407927.1|1382894_1385036_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_011258173.1|1385036_1385798_-	4-hydroxy-2-oxovalerate aldolase	NA	NA	NA	NA	NA
WP_162013048.1|1385942_1387043_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	4.7e-41
WP_109181893.1|1387207_1388905_-	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_069964950.1|1390003_1392403_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	33.3	6.4e-11
WP_011258178.1|1392735_1395123_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.9	9.2e-10
WP_069959771.1|1395396_1395837_-	VOC family protein	NA	NA	NA	NA	NA
WP_011407931.1|1396300_1398688_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.7	7.1e-10
WP_011407932.1|1398863_1400780_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.5	1.2e-65
WP_011407933.1|1401051_1401477_+	YcxB family protein	NA	NA	NA	NA	NA
WP_011407934.1|1401500_1402376_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.4	2.0e-15
WP_042464613.1|1403484_1404303_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_125168742.1|1406412_1406694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407938.1|1406911_1407703_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011258190.1|1408464_1409895_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011407939.1|1410107_1411976_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.0	9.7e-15
WP_011407940.1|1412000_1414325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407609.1|1417114_1418299_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_075239694.1|1418390_1419743_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_011407945.1|1419808_1420744_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_011407946.1|1420810_1421410_-	LysE family translocator	NA	NA	NA	NA	NA
WP_011407947.1|1421444_1422305_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_011407948.1|1422322_1423363_-	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_011258802.1|1424638_1425607_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 12
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	1470961	1534737	4994045	transposase	uncultured_Caudovirales_phage(50.0%)	49	NA	NA
WP_109181897.1|1470961_1471927_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182392.1|1472279_1472984_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_005926176.1|1473521_1473746_-	putative selenoprotein	NA	NA	NA	NA	NA
WP_011407979.1|1473745_1475818_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_011407980.1|1476049_1476907_+	pirin family protein	NA	NA	NA	NA	NA
WP_082323236.1|1477942_1480345_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.2	4.6e-41
WP_027704078.1|1480399_1481260_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_075241467.1|1481328_1481907_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_044757488.1|1481896_1483309_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_109181898.1|1483318_1485742_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	3.1e-37
WP_011258248.1|1485738_1486686_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_158645225.1|1486901_1487285_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_041182394.1|1487679_1488228_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_075245366.1|1488622_1489180_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_069959782.1|1491358_1493260_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.2e-30
WP_027704078.1|1493314_1494175_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_075251795.1|1494243_1494822_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011258251.1|1495285_1495519_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407994.1|1495739_1496306_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407995.1|1496508_1497096_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_162013049.1|1497448_1497883_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_069959784.1|1497879_1500288_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011407999.1|1500632_1501094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408000.1|1501340_1502231_-	pirin family protein	NA	NA	NA	NA	NA
WP_012444354.1|1502998_1503712_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_011258259.1|1503815_1504565_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_042465485.1|1504925_1505177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408003.1|1505509_1507567_+	M13 family peptidase	NA	A0A1V0SHG2	Klosneuvirus	28.6	1.2e-79
WP_069960076.1|1509514_1510636_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_012444362.1|1510650_1511457_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_069959785.1|1511461_1512745_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011408007.1|1512771_1513287_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_069959786.1|1513297_1515454_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.1	2.9e-10
WP_011408009.1|1515521_1517519_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258268.1|1517537_1517867_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_125168745.1|1517906_1518125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181899.1|1518356_1521821_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_014502625.1|1522223_1522766_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408011.1|1523177_1524086_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_094187763.1|1524431_1525230_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042464653.1|1525373_1526093_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_109181900.1|1526248_1527283_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258276.1|1527303_1528116_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408014.1|1528851_1529235_+	membrane protein	NA	NA	NA	NA	NA
WP_011408015.1|1529393_1530563_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
WP_011408016.1|1530557_1531616_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	4.1e-71
WP_011408017.1|1531676_1532489_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408018.1|1533004_1533388_+	membrane protein	NA	NA	NA	NA	NA
WP_011408019.1|1533573_1534737_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
>prophage 13
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	1548432	1642761	4994045	tRNA,transposase	Bacillus_virus(12.5%)	54	NA	NA
WP_011258297.1|1548432_1549263_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_011408032.1|1549324_1550092_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011258299.1|1550091_1550307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408033.1|1550452_1551244_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258301.1|1551389_1552565_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011408036.1|1554798_1555437_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011258305.1|1555612_1557553_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_011258306.1|1557769_1558324_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011408037.1|1558545_1559976_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_012444398.1|1560078_1561497_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	3.3e-47
WP_011258309.1|1561913_1562639_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_011408038.1|1562737_1563148_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041182034.1|1563199_1564156_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	1.0e-39
WP_011408040.1|1564399_1566781_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258314.1|1569434_1569845_+	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_011408042.1|1570144_1570327_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_011258316.1|1570459_1571500_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011258317.1|1571572_1573018_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_011257031.1|1574548_1575517_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181902.1|1575729_1577049_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109181903.1|1577344_1577890_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_011408047.1|1577886_1579350_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011258323.1|1580810_1581065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075242210.1|1581467_1582001_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_014502654.1|1582026_1582428_+	membrane protein	NA	NA	NA	NA	NA
WP_011258326.1|1582776_1583019_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_114889757.1|1592589_1593087_+	RraA family protein	NA	NA	NA	NA	NA
WP_162814320.1|1594865_1595492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114889751.1|1595612_1595810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181903.1|1603171_1603717_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_011408047.1|1603713_1605177_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011258323.1|1606636_1606891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075242210.1|1607293_1607827_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_014502654.1|1607852_1608254_+	membrane protein	NA	NA	NA	NA	NA
WP_011258326.1|1608602_1608845_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_069964510.1|1610206_1612111_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
WP_075243271.1|1612374_1614771_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_011258331.1|1614920_1615643_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_011258334.1|1618562_1619063_+	putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase	NA	NA	NA	NA	NA
WP_075241746.1|1619004_1620681_+	serine hydrolase	NA	NA	NA	NA	NA
WP_011258336.1|1620827_1622093_+	potassium transporter	NA	NA	NA	NA	NA
WP_011258337.1|1622151_1623345_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.3	4.0e-22
WP_012444424.1|1623341_1624031_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_033013597.1|1624136_1625606_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011258340.1|1625625_1626462_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011258341.1|1626487_1627591_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_044756980.1|1627587_1630644_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_069960188.1|1630709_1631300_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_069959790.1|1631431_1633264_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
WP_094187715.1|1633339_1634103_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181904.1|1634145_1635465_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408063.1|1636762_1641253_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_128415435.1|1641252_1641741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|1641792_1642761_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 14
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	1774168	1840013	4994045	tRNA,transposase	Bacillus_phage(20.0%)	42	NA	NA
WP_011260830.1|1774168_1775404_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|1775454_1776218_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069959795.1|1776284_1777661_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	1.1e-58
WP_008578058.1|1778039_1778714_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_011408164.1|1779344_1779749_-	response regulator	NA	NA	NA	NA	NA
WP_011408165.1|1779827_1780325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959808.1|1780463_1782260_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	2.6e-81
WP_011408166.1|1782814_1783360_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_069959809.1|1783461_1787583_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
WP_011408167.1|1787803_1790446_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182063.1|1791887_1793402_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_094187715.1|1793572_1794335_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408171.1|1794646_1795159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408172.1|1795221_1796340_-	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_011408173.1|1796336_1796615_-	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_011408174.1|1796611_1797364_-	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_109181911.1|1797360_1798260_-	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_002812057.1|1798343_1798424_-	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_042464698.1|1798713_1800900_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_042465507.1|1801182_1802625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756949.1|1802957_1805060_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_069959810.1|1805301_1807746_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_011408178.1|1807759_1808284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408179.1|1808483_1810511_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	4.6e-95
WP_011408180.1|1810524_1811244_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_011258505.1|1811240_1812155_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	48.5	1.2e-63
WP_011258506.1|1812448_1813324_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_044756943.1|1813320_1814271_-	glutathione synthase	NA	NA	NA	NA	NA
WP_005913706.1|1814520_1814922_+	response regulator	NA	NA	NA	NA	NA
WP_011258508.1|1814939_1815302_+	response regulator	NA	A0A220YL79	Alteromonas_virus	26.8	9.0e-10
WP_003482487.1|1815301_1815832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258510.1|1815871_1817908_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.1	2.1e-23
WP_109181912.1|1818021_1824948_+	response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.9e-11
WP_011408184.1|1824955_1826158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258512.1|1826191_1826668_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011258513.1|1826918_1827542_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408185.1|1827553_1828636_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258518.1|1833257_1834322_+	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
WP_011258519.1|1834318_1835050_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_011408189.1|1835074_1837033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258521.1|1837174_1838278_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_011408191.1|1838777_1840013_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	1931802	1992618	4994045	protease,transposase	Tupanvirus(18.18%)	50	NA	NA
WP_094187715.1|1931802_1932566_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408239.1|1933514_1934321_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_011408242.1|1936353_1937739_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011408243.1|1937877_1939383_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011408244.1|1939393_1940575_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011408245.1|1941367_1942540_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_027703337.1|1942699_1943602_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_011408247.1|1943840_1944806_+	cation transporter	NA	NA	NA	NA	NA
WP_011258595.1|1945022_1947104_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_041182077.1|1947340_1947961_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_011258597.1|1947957_1948857_+	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_011408249.1|1948966_1950553_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	6.5e-28
WP_041182078.1|1950733_1952524_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	40.5	3.5e-22
WP_011258600.1|1952630_1953431_+	signal peptidase I	NA	NA	NA	NA	NA
WP_011258601.1|1953461_1953839_+	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011258602.1|1953828_1954509_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.4	1.7e-17
WP_011258603.1|1954505_1955405_+	GTPase Era	NA	NA	NA	NA	NA
WP_011258604.1|1955628_1956351_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_011408250.1|1956499_1957222_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011408251.1|1957380_1958715_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	27.2	1.0e-29
WP_011258607.1|1958889_1959387_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_011258607.1|1959732_1960230_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_011257310.1|1960325_1961561_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011408252.1|1961789_1963166_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_041182416.1|1963285_1963969_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_011408254.1|1963985_1965020_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011408255.1|1965200_1966778_+	cryptochrome/photolyase family protein	NA	A0A1V0SE91	Indivirus	25.6	2.2e-44
WP_011408256.1|1966895_1967900_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_011408257.1|1967899_1968454_+	hypoxanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011408258.1|1968539_1969292_+	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_003488188.1|1969378_1969585_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	9.3e-20
WP_014504008.1|1971095_1971740_-	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_011408263.1|1971729_1974231_-	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_011408264.1|1974227_1975832_-	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	36.6	4.9e-15
WP_011258619.1|1975828_1976062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408265.1|1976058_1977081_-	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_011258621.1|1977417_1977783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408267.1|1977779_1978370_-	cell shape determination protein CcmA	NA	NA	NA	NA	NA
WP_011408268.1|1978467_1980177_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	2.1e-16
WP_011258624.1|1980285_1980612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408269.1|1980841_1981186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408270.1|1981308_1982484_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011258626.1|1982639_1985468_+|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
WP_011258627.1|1985528_1986629_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_041182081.1|1987095_1987623_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258629.1|1988024_1988198_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_011258630.1|1988358_1988613_-	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258631.1|1988787_1989054_+	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_041182418.1|1989244_1989811_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_109181915.1|1991298_1992618_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	2008440	2080653	4994045	tRNA,protease,transposase,coat	Emiliania_huxleyi_virus(22.22%)	56	NA	NA
WP_109181916.1|2008440_2009203_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069964915.1|2009594_2012159_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_011408290.1|2013138_2013486_+	RidA family protein	NA	NA	NA	NA	NA
WP_012445221.1|2013648_2014719_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_044756918.1|2014736_2015519_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_011258654.1|2015515_2016061_-	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_109181917.1|2016057_2017353_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	32.4	1.5e-38
WP_114889753.1|2017349_2018162_-	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_027704227.1|2018232_2019483_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011408297.1|2019479_2020478_-	acyl-CoA desaturase	NA	G4YAW5	Emiliania_huxleyi_virus	30.6	2.3e-18
WP_012445217.1|2020703_2021537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258659.1|2021533_2022097_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012445216.1|2022155_2022524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258660.1|2022609_2023392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445213.1|2024010_2024439_-	Rnf electron transport complex subunit RnfB	NA	NA	NA	NA	NA
WP_012445212.1|2024440_2025037_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_109181918.1|2025226_2027311_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012445211.1|2027535_2027985_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_109181919.1|2028748_2029801_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408305.1|2030077_2031475_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_011258667.1|2031471_2032449_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_011258668.1|2032630_2034568_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258669.1|2034988_2035765_-	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258670.1|2035769_2036444_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_082323429.1|2038074_2039451_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.0e-78
WP_011408311.1|2039490_2039886_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_069959817.1|2039928_2041404_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.5	2.2e-102
WP_011408313.1|2042200_2042617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256646.1|2042630_2042801_-	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_011258676.1|2046489_2047053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445197.1|2047525_2048869_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_011408316.1|2049009_2049612_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408317.1|2049685_2050132_+	membrane protein	NA	NA	NA	NA	NA
WP_075244058.1|2050209_2050440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181921.1|2052577_2053990_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_042464756.1|2054722_2056903_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258685.1|2057742_2058702_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_011408321.1|2058877_2062468_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	4.4e-181
WP_011408322.1|2062925_2063666_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.6e-24
WP_027703356.1|2063662_2064919_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011258689.1|2064957_2065749_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_011258690.1|2065772_2066234_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_069959820.1|2066230_2067244_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_012445188.1|2067643_2070010_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_011408324.1|2070093_2071440_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_011258694.1|2071466_2072657_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_011258695.1|2072659_2073487_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027703358.1|2073483_2074245_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_011258697.1|2074262_2074820_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011258698.1|2075000_2075723_-	UMP kinase	NA	NA	NA	NA	NA
WP_011408325.1|2075779_2076157_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258700.1|2076284_2077163_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_011258701.1|2077332_2078136_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011408326.1|2078511_2079237_-	molecular chaperone	NA	NA	NA	NA	NA
WP_041182086.1|2079239_2079572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258703.1|2079618_2080653_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 17
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	2135482	2265725	4994045	tRNA,transposase	Ralstonia_phage(20.83%)	93	NA	NA
WP_109181923.1|2135482_2136802_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408358.1|2137136_2138063_-	TolC family protein	NA	NA	NA	NA	NA
WP_011258748.1|2138192_2138798_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_109181924.1|2139136_2140906_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.5	3.0e-58
WP_027703751.1|2140902_2141505_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	4.8e-16
WP_011258751.1|2141763_2142357_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
WP_011258752.1|2142555_2143992_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
WP_011258753.1|2144233_2145436_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_011258754.1|2145478_2148307_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_011408361.1|2148487_2149420_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408362.1|2149416_2150916_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_041182090.1|2151253_2151517_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_011258758.1|2151796_2152297_-	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_011258759.1|2152538_2153906_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
WP_109181925.1|2156929_2157692_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408367.1|2159144_2160548_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_042464794.1|2160670_2161093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258770.1|2161725_2162562_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_044756884.1|2162571_2163558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258772.1|2163554_2164430_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
WP_011408371.1|2164426_2164789_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042464800.1|2164791_2165040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408372.1|2165175_2165733_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_027703707.1|2165824_2166790_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408374.1|2166815_2168165_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	2.4e-79
WP_011258777.1|2168157_2168394_+	protein SlyX	NA	NA	NA	NA	NA
WP_042464803.1|2168394_2169147_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_042464805.1|2169480_2170326_+	transporter	NA	NA	NA	NA	NA
WP_109182102.1|2170466_2171642_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011408378.1|2171655_2172966_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011408379.1|2172962_2173949_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011408380.1|2173945_2175151_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_011408381.1|2175537_2178291_-	methionine synthase	NA	NA	NA	NA	NA
WP_011408382.1|2178433_2179573_-	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
WP_011258786.1|2179569_2180565_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
WP_011408383.1|2180653_2181835_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464808.1|2181834_2181975_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464810.1|2182346_2183792_+	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
WP_011258790.1|2184358_2186887_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	4.0e-64
WP_109181926.1|2187097_2187896_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181927.1|2188966_2189728_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_094187736.1|2189760_2190523_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408388.1|2190551_2190899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259046.1|2191057_2192026_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_109181928.1|2193378_2194344_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2194788_2195973_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011408398.1|2196027_2197503_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.9e-99
WP_109181929.1|2197824_2198007_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_011258800.1|2198155_2199355_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_069960202.1|2200215_2201184_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_109181915.1|2201396_2202716_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258803.1|2202852_2203821_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_109181930.1|2204100_2204899_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181931.1|2205124_2206090_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181932.1|2208319_2209285_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2210316_2211285_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181933.1|2212461_2213564_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-36
WP_027704061.1|2213750_2214218_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408403.1|2214578_2215238_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011258822.1|2215349_2216699_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_094187763.1|2216848_2217647_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408404.1|2218086_2219406_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407175.1|2219618_2220587_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011408405.1|2220650_2221235_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_011258825.1|2221334_2222348_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153296780.1|2223038_2223305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408408.1|2227454_2227754_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_042464821.1|2227757_2227952_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_069959831.1|2235209_2239337_-	avirulence protein	NA	NA	NA	NA	NA
WP_109181935.1|2239625_2240945_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109181936.1|2242776_2243862_-	peptidase C13	NA	NA	NA	NA	NA
WP_011408416.1|2244189_2244888_-	acireductone synthase	NA	NA	NA	NA	NA
WP_011408417.1|2244890_2245457_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_011408418.1|2245468_2246146_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_069959832.1|2246234_2247665_-	amino acid permease	NA	NA	NA	NA	NA
WP_033013325.1|2247741_2249214_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258841.1|2249359_2249947_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011258842.1|2250102_2251344_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
WP_011258843.1|2251552_2252971_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011408424.1|2253005_2253305_+	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_011258845.1|2253301_2255173_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_041182103.1|2255462_2256476_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011258848.1|2256475_2256907_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_012445014.1|2256903_2257464_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_011408426.1|2257497_2259435_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011258851.1|2259603_2260074_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011258852.1|2260070_2260241_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_109181937.1|2260237_2260990_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_011258853.1|2261084_2261780_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_011408428.1|2261776_2262421_-	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
WP_011408429.1|2262647_2263796_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011408430.1|2263935_2264739_+	amidohydrolase	NA	NA	NA	NA	NA
WP_109181928.1|2264759_2265725_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	2366372	2477799	4994045	tRNA,transposase	Xanthomonas_phage(61.11%)	94	NA	NA
WP_012444952.1|2366372_2367785_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.2	3.0e-40
WP_094187798.1|2368297_2369096_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258940.1|2369409_2369736_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258941.1|2369745_2370660_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258942.1|2370656_2371952_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_011408488.1|2371948_2373040_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_011258944.1|2373036_2374164_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_011258945.1|2374160_2374763_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011258946.1|2374759_2375494_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_011258947.1|2375487_2376264_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011258948.1|2376253_2376874_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_109181941.1|2377459_2381314_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408491.1|2381538_2381838_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_042464821.1|2381841_2382036_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011258951.1|2386135_2386915_-	pectate lyase	NA	NA	NA	NA	NA
WP_075239627.1|2386956_2387055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182117.1|2387807_2387993_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	93.4	8.6e-25
WP_012444935.1|2387992_2388196_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	70.3	6.1e-16
WP_011258952.1|2388331_2389405_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.9	5.0e-64
WP_011408494.1|2389509_2389809_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	54.2	3.4e-23
WP_011408495.1|2390172_2390412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057497.1|2390518_2392003_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.2	1.4e-40
WP_041182119.1|2392004_2392325_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_011408497.1|2392321_2393506_+	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.4	5.2e-54
WP_109181942.1|2393502_2393733_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	55.6	2.0e-10
WP_109181943.1|2394878_2395103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408500.1|2395302_2395686_+	hypothetical protein	NA	A0A1D6ZIV0	Xanthomonas_phage	100.0	1.7e-70
WP_011408501.1|2395857_2396505_-	conjugal transfer protein TrbP	NA	A0A1D6ZIU7	Xanthomonas_phage	100.0	3.0e-120
WP_011408502.1|2396506_2397694_-	hypothetical protein	NA	A0A1D6ZIU8	Xanthomonas_phage	100.0	2.8e-217
WP_011408503.1|2397693_2398023_-	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	100.0	3.8e-55
WP_042464851.1|2398022_2399429_-	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	100.0	6.4e-245
WP_011408505.1|2399565_2399796_-	hypothetical protein	NA	A0A1D6ZIT7	Xanthomonas_phage	100.0	1.7e-30
WP_042464854.1|2399807_2400011_-	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	100.0	9.8e-30
WP_011408506.1|2400014_2400311_-	DNA-binding protein	NA	A0A1D6ZIU6	Xanthomonas_phage	100.0	3.6e-49
WP_011408507.1|2400307_2401348_-	replication initiation protein	NA	A0A1D6ZIT9	Xanthomonas_phage	100.0	8.2e-205
WP_109181944.1|2401500_2401713_-	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	98.6	1.1e-26
WP_069970101.1|2402024_2402654_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	80.6	2.5e-71
WP_011408511.1|2402778_2402961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168751.1|2403082_2403394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187780.1|2403463_2404226_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2404559_2405528_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_041182123.1|2405788_2406214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408516.1|2406827_2407340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181945.1|2407469_2408232_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182100.1|2413518_2413713_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_011408491.1|2413716_2414016_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_069964534.1|2414239_2417995_+	avirulence protein	NA	NA	NA	NA	NA
WP_109181946.1|2418084_2418847_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042464821.1|2419078_2419273_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011408491.1|2419276_2419576_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_012444927.1|2424034_2424211_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011408520.1|2424207_2424879_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_125168753.1|2425904_2426150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|2426133_2427090_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011409456.1|2427853_2428816_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_041182129.1|2429697_2430663_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182130.1|2430640_2434741_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_011408397.1|2435049_2436234_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_041182131.1|2436284_2437184_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.8e-36
WP_011408524.1|2437350_2437857_+	glyoxalase	NA	NA	NA	NA	NA
WP_011258968.1|2438331_2438964_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011258969.1|2438963_2440820_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011258970.1|2440816_2442235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258971.1|2442258_2442723_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_109182104.1|2442719_2443520_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258973.1|2443789_2444830_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011258974.1|2444826_2446596_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258975.1|2446592_2447057_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011408526.1|2447060_2447723_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011408527.1|2447751_2450160_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_109181948.1|2450413_2451379_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258980.1|2452772_2453507_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_010378794.1|2453499_2454741_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014503500.1|2454764_2455217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408531.1|2455167_2455416_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_011408532.1|2455526_2456309_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_012444910.1|2456325_2456535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258983.1|2456538_2458329_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_011258984.1|2458363_2458750_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_011258985.1|2458746_2459142_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_012444907.1|2459201_2459468_-	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_109181949.1|2459411_2460284_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_011258986.1|2460412_2461510_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
WP_011408534.1|2461942_2463373_+	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
WP_011258989.1|2464372_2465092_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_011258990.1|2465194_2467111_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011408535.1|2467166_2467826_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_044756829.1|2468046_2469423_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	1.3e-77
WP_094187715.1|2469456_2470220_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703995.1|2470262_2470466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444899.1|2471037_2471214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258994.1|2471481_2471862_+	response regulator	NA	NA	NA	NA	NA
WP_044756830.1|2472075_2475471_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
WP_094187715.1|2477036_2477799_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	2591873	2639975	4994045	tRNA,transposase	Moumouvirus(16.67%)	44	NA	NA
WP_011408598.1|2591873_2593268_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	7.6e-81
WP_011259080.1|2593269_2593527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408599.1|2593523_2593829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408600.1|2593825_2594152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408603.1|2594878_2595541_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_024744799.1|2595629_2596160_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
WP_011408606.1|2598383_2599655_+	kynureninase	NA	NA	NA	NA	NA
WP_011408607.1|2599826_2601194_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_011259089.1|2601497_2602943_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_011259090.1|2602939_2603626_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_011259091.1|2603598_2604618_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011259092.1|2604659_2605220_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_011259093.1|2605240_2606197_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_011408609.1|2606364_2607141_-	NAD kinase	NA	NA	NA	NA	NA
WP_011408610.1|2607624_2609760_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_027703372.1|2609756_2609948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259098.1|2611722_2612229_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259099.1|2612269_2612797_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408612.1|2612793_2613285_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_011408613.1|2613308_2613884_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011259101.1|2613960_2614914_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259102.1|2615002_2615875_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011408616.1|2615871_2616717_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_011408617.1|2616829_2617528_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408618.1|2617691_2618474_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011408619.1|2618482_2618863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259107.1|2618859_2619570_+	endonuclease III	NA	NA	NA	NA	NA
WP_011408621.1|2620880_2621429_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_011258802.1|2621600_2622569_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_044756431.1|2623173_2624409_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_041182144.1|2624972_2625293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259109.1|2625632_2626883_+	porin	NA	NA	NA	NA	NA
WP_011408625.1|2627071_2628091_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.7	1.6e-48
WP_011408626.1|2628278_2629370_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_069959864.1|2629482_2630457_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_069959865.1|2630456_2631326_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011259114.1|2631348_2632179_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011408630.1|2632307_2633018_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_109181952.1|2633150_2633564_+	RcnB family protein	NA	NA	NA	NA	NA
WP_011259117.1|2633847_2634483_+	ribonuclease T	NA	NA	NA	NA	NA
WP_109181953.1|2634553_2635873_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464912.1|2636109_2637171_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2637221_2638406_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109181954.1|2638655_2639975_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	2646694	2717819	4994045	tRNA,protease,transposase	uncultured_Mediterranean_phage(35.71%)	52	NA	NA
WP_011259125.1|2646694_2647840_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_027703908.1|2647909_2648980_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259127.1|2649166_2649598_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408638.1|2649721_2651218_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011259129.1|2651562_2652270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259140.1|2655603_2656725_-	phytase	NA	NA	NA	NA	NA
WP_041182147.1|2658997_2659465_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011259142.1|2659615_2660248_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_109181946.1|2660644_2661407_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259143.1|2661687_2662719_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408648.1|2662725_2664519_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_012444765.1|2664515_2664800_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_027703974.1|2665031_2665529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259147.1|2665575_2666082_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_011259148.1|2666078_2666699_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011408651.1|2666939_2668844_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_109181955.1|2668931_2669989_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_109181956.1|2670086_2671406_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239722.1|2671639_2672797_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_109181957.1|2673073_2674039_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181958.1|2674016_2675492_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.2e-76
WP_162013043.1|2675527_2675734_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2678031_2679000_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_075245207.1|2679267_2679501_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011259163.1|2681381_2682602_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011259164.1|2682916_2684314_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011408657.1|2684324_2685542_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011259166.1|2685541_2686180_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011259167.1|2686250_2687111_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011408658.1|2687107_2687896_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_011259169.1|2687906_2689112_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_002812972.1|2689130_2689556_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_011259170.1|2689775_2690408_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259171.1|2690432_2692805_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259172.1|2692962_2694168_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011259173.1|2694488_2695820_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
WP_011408659.1|2695816_2696167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408660.1|2696198_2696606_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_011259175.1|2696602_2696929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182106.1|2696960_2698337_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.1	8.9e-74
WP_011259177.1|2698573_2702740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703232.1|2702852_2703524_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011259179.1|2703588_2705517_-	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_011259180.1|2705679_2708040_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_011259181.1|2708323_2709292_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_011408662.1|2709349_2710471_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_042465566.1|2711898_2712651_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002813418.1|2712731_2712950_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_011259186.1|2713230_2715513_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	8.7e-175
WP_005914463.1|2715656_2715977_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_011408665.1|2716227_2716686_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011259189.1|2716682_2717819_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 21
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	2799564	2869901	4994045	tRNA,transposase	Ralstonia_phage(46.15%)	46	NA	NA
WP_109181960.1|2799564_2800884_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|2801033_2802002_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_162597426.1|2802096_2802492_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_011409456.1|2802544_2803507_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109181962.1|2803745_2808986_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	39.8	1.6e-09
WP_011258802.1|2809916_2810885_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407175.1|2812948_2813917_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_125168757.1|2815541_2816021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259260.1|2824145_2824538_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259261.1|2824546_2825008_+	cytochrome c	NA	NA	NA	NA	NA
WP_153296779.1|2825428_2825827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181963.1|2827530_2828496_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181964.1|2828502_2829648_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_069959881.1|2829772_2830741_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	9.6e-99
WP_075239109.1|2832809_2834546_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	1.8e-15
WP_069960108.1|2835062_2836019_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.8e-41
WP_011257031.1|2836178_2837147_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011259269.1|2837903_2838014_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_012444741.1|2838234_2839500_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259272.1|2839480_2841394_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_011408714.1|2841761_2843006_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	2.5e-91
WP_011408715.1|2843170_2844325_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.8	1.2e-47
WP_011259275.1|2844338_2844599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408716.1|2844598_2844964_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408717.1|2844963_2846259_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_041182650.1|2846382_2847333_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_011259279.1|2847945_2849289_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_011259280.1|2849328_2850429_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_011408722.1|2850434_2850887_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259282.1|2851128_2852370_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_011259283.1|2852441_2853467_-	N-acetylornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_027703614.1|2853779_2854274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444736.1|2854450_2855875_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_011408724.1|2856372_2856810_+	SufE family protein	NA	NA	NA	NA	NA
WP_011259287.1|2856806_2858057_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259288.1|2858124_2859186_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_075242610.1|2859328_2860369_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_011408727.1|2860453_2860741_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_011408728.1|2860737_2862087_+	dihydroorotase	NA	NA	NA	NA	NA
WP_011408729.1|2862086_2862926_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.4e-13
WP_094187715.1|2863824_2864587_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259294.1|2864613_2864877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444728.1|2865248_2865737_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_011408734.1|2865960_2867280_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2867416_2868385_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_069964543.1|2868584_2869901_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	2901732	2962822	4994045	tRNA,protease,transposase	Bacillus_virus(22.22%)	49	NA	NA
WP_011259328.1|2901732_2902611_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_011259329.1|2902708_2903608_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_011408747.1|2903695_2904436_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011259331.1|2904595_2905171_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408749.1|2905344_2906316_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_109181965.1|2906349_2907291_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259334.1|2907290_2909168_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_012444702.1|2909305_2911039_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
WP_011259336.1|2911091_2911592_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_075243426.1|2911588_2913076_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_069959886.1|2913100_2914168_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_094187715.1|2914282_2915046_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182164.1|2915129_2916467_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	36.2	1.3e-37
WP_069959887.1|2916762_2918025_-	virulence factor	NA	NA	NA	NA	NA
WP_094187754.1|2918241_2918989_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181966.1|2919305_2921141_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	32.9	5.6e-23
WP_041182166.1|2921412_2922504_+	ribonuclease D	NA	NA	NA	NA	NA
WP_011259345.1|2923596_2923998_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_015463309.1|2924861_2925041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004541336.1|2925184_2925382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703932.1|2925642_2925933_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011408759.1|2925920_2926199_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_080256628.1|2926683_2926872_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011408760.1|2927644_2928829_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_109181928.1|2929409_2930375_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042465594.1|2934939_2935284_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_011408764.1|2935494_2935821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259352.1|2935853_2936294_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
WP_011259353.1|2936372_2937008_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_027703625.1|2937400_2938159_-	cytochrome c1	NA	NA	NA	NA	NA
WP_011259355.1|2938151_2939411_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_011259356.1|2939410_2940055_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011259357.1|2940584_2941571_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_011408766.1|2943506_2944961_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011408767.1|2945384_2946371_+	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
WP_011259362.1|2946782_2947445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259363.1|2947499_2947985_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011408769.1|2947984_2948503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408770.1|2948597_2949476_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011259366.1|2949472_2950753_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011259367.1|2950768_2951770_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_011408772.1|2951921_2953286_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011408773.1|2953540_2953951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408774.1|2954106_2954937_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_075240820.1|2955250_2956498_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
WP_011408777.1|2956643_2958137_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011408778.1|2958141_2959728_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011408779.1|2959724_2960927_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_109181967.1|2961433_2962822_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	2989461	3072838	4994045	transposase	Ralstonia_phage(33.33%)	51	NA	NA
WP_069959890.1|2989461_2990445_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	1.5e-99
WP_011408793.1|2996194_2996854_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408794.1|2996868_2998173_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259395.1|2998185_3001356_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_109181969.1|3002331_3003297_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408798.1|3004003_3004999_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_059317461.1|3005159_3007676_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_011259401.1|3007672_3008629_+	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_069963855.1|3008787_3010530_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_012444645.1|3010707_3011985_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_011258802.1|3012651_3013620_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_012445230.1|3013980_3015216_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_069959892.1|3015234_3017580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182891.1|3017597_3018329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325293.1|3018360_3020703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503414.1|3020727_3021456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959894.1|3021484_3023827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465604.1|3023851_3024595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325294.1|3024625_3027460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964550.1|3027456_3028386_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_041182637.1|3036040_3036430_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_082325566.1|3037956_3040446_-	avirulence protein	NA	NA	NA	NA	NA
WP_041182637.1|3040485_3040875_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_157724569.1|3041035_3041989_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|3041921_3042236_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_011408815.1|3042463_3043783_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259409.1|3044887_3045304_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_011259410.1|3045300_3045747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259411.1|3045989_3046625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|3047124_3048093_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_125168758.1|3048749_3049250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465618.1|3049558_3052660_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042465003.1|3053649_3054102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756758.1|3054356_3056162_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_125168759.1|3056163_3056511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756757.1|3056586_3057294_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	8.4e-52
WP_011408825.1|3057445_3057838_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011408826.1|3057884_3058376_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703781.1|3058372_3058726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259417.1|3058814_3059555_+	flagellar motor protein	NA	NA	NA	NA	NA
WP_011408827.1|3059561_3060536_+	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_011259419.1|3060537_3061320_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_042465006.1|3061316_3062339_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259421.1|3062439_3062748_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_002806565.1|3062744_3063110_+	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_011408829.1|3063143_3065153_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011408830.1|3065320_3065575_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_103073514.1|3067256_3067943_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.2	2.8e-12
WP_011408833.1|3068258_3069020_+	transporter	NA	NA	NA	NA	NA
WP_011408834.1|3069033_3071376_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	4.5e-09
WP_109181970.1|3071872_3072838_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	3169623	3181398	4994045	tRNA	Escherichia_phage(22.22%)	12	NA	NA
WP_011259503.1|3169623_3169923_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
WP_011259504.1|3169965_3170196_-	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259505.1|3170439_3171189_-	isopentenyl transferase	NA	NA	NA	NA	NA
WP_011408881.1|3171193_3171889_-	hypothetical protein	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_012444559.1|3172074_3172374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057240.1|3172761_3173166_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	56.6	1.1e-32
WP_003481884.1|3173891_3174104_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_011259507.1|3174243_3176892_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_012444556.1|3176993_3177482_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011408884.1|3177784_3178819_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_011408885.1|3178991_3179633_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408886.1|3179721_3181398_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 25
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	3274327	3375455	4994045	transposase,plate	Ralstonia_phage(66.67%)	71	NA	NA
WP_069959920.1|3274327_3275425_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465048.1|3275841_3278922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033013236.1|3281957_3282665_+	response regulator	NA	NA	NA	NA	NA
WP_011408941.1|3282661_3283654_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259589.1|3283650_3286110_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_011259590.1|3286223_3287204_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408942.1|3287212_3288241_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_109181977.1|3288407_3289205_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181978.1|3289267_3290065_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444504.1|3290125_3290452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703483.1|3290448_3293352_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
WP_011259593.1|3293348_3294071_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011408946.1|3294067_3294715_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_011408947.1|3294711_3298170_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011408948.1|3298173_3299490_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_011408949.1|3299491_3300829_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011408951.1|3302212_3302752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444497.1|3302760_3304698_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
WP_011408952.1|3304962_3305421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168760.1|3305807_3306302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703476.1|3306367_3306865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408953.1|3307053_3309759_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	4.3e-80
WP_011408954.1|3309791_3310802_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011259602.1|3310765_3312643_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259603.1|3312646_3313150_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011259604.1|3313137_3313971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259605.1|3314006_3314510_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_027703472.1|3314609_3316124_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_024711387.1|3316116_3316623_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_109181902.1|3317926_3319246_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|3319458_3320427_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181979.1|3320562_3321879_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257310.1|3322049_3323285_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|3323470_3324439_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109181980.1|3324490_3326407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259611.1|3326431_3327169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408961.1|3327199_3329542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465640.1|3329559_3330306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465052.1|3330334_3333169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465054.1|3333826_3335656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445381.1|3335669_3336269_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_012445382.1|3336356_3336713_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_012445383.1|3336709_3337132_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408967.1|3337147_3337381_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_069960235.1|3337407_3337668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704269.1|3339832_3340819_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_042465057.1|3341229_3344943_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_094187765.1|3345468_3346232_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445389.1|3346335_3346983_-	response regulator	NA	NA	NA	NA	NA
WP_011408973.1|3347204_3347966_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011258802.1|3348123_3349092_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408974.1|3349225_3349591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408975.1|3349649_3350081_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011259625.1|3350092_3351355_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011408976.1|3351338_3352631_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011408977.1|3353000_3353771_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011408979.1|3357043_3357301_-	stress-induced protein	NA	NA	NA	NA	NA
WP_011408980.1|3357740_3358724_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011258802.1|3359039_3360008_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408981.1|3360136_3361099_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_153296740.1|3361348_3361507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182195.1|3361538_3361718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|3362082_3363048_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408985.1|3364255_3365233_+	siroheme synthase	NA	NA	NA	NA	NA
WP_042465070.1|3366041_3366236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408987.1|3367629_3367992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408988.1|3367975_3368545_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_011259640.1|3368582_3369836_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011408989.1|3370041_3370419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408991.1|3372347_3373583_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|3374420_3375455_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 26
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	3516563	3577036	4994045	tRNA,protease,transposase	Burkholderia_virus(14.29%)	49	NA	NA
WP_094187736.1|3516563_3517327_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259756.1|3518350_3520717_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011409066.1|3520713_3521388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259758.1|3521597_3522536_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_011259759.1|3522658_3524008_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011259760.1|3524004_3524892_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011409067.1|3525209_3526016_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011259762.1|3526461_3527679_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011409068.1|3527784_3528753_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.2e-09
WP_011259764.1|3529137_3529806_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_011259765.1|3529802_3530576_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_075241401.1|3531149_3533102_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|3533782_3534808_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409070.1|3534892_3535966_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
WP_011259771.1|3535958_3537062_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_011259772.1|3537072_3537999_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011259773.1|3538079_3538730_+	SCO family protein	NA	NA	NA	NA	NA
WP_011409071.1|3538726_3539575_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_041182211.1|3540125_3541709_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
WP_103057205.1|3543131_3544349_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_153296738.1|3544309_3544597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409076.1|3544707_3545214_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_011259780.1|3545335_3546736_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_012445553.1|3546998_3547574_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011409078.1|3547570_3548005_+	HIT family protein	NA	NA	NA	NA	NA
WP_011259783.1|3548970_3549156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259784.1|3549190_3549760_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_011259785.1|3549852_3550704_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259787.1|3552091_3554107_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_012445555.1|3554377_3555076_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409081.1|3555116_3555524_-	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_011409082.1|3555961_3556924_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409084.1|3558207_3559458_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011409085.1|3559465_3560710_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011259794.1|3560937_3561417_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027704197.1|3561527_3562064_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259796.1|3562173_3562923_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_011259797.1|3563130_3563622_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011409088.1|3564735_3566055_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_109181983.1|3566197_3567904_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011409090.1|3567937_3569242_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011259802.1|3569273_3569534_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011409091.1|3569535_3570411_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_027704198.1|3572245_3572710_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_012445570.1|3572761_3572950_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_069963878.1|3572922_3573243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465665.1|3573239_3574607_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011409095.1|3574752_3575334_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_011259808.1|3575590_3577036_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 27
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	3596136	3646283	4994045	tRNA,transposase,integrase	Ralstonia_phage(33.33%)	37	3620401:3620460	3637070:3637733
WP_011259825.1|3596136_3598779_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_011259826.1|3598851_3599463_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011409107.1|3599667_3600525_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_011409108.1|3600780_3601230_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_109181928.1|3601529_3602495_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|3602619_3603382_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704065.1|3603992_3604286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407489.1|3604880_3606200_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109181985.1|3606269_3606470_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_011409111.1|3606503_3607517_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259831.1|3607484_3607676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181986.1|3607766_3609086_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182217.1|3609173_3610388_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_011259834.1|3610533_3611061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181987.1|3611057_3612023_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187771.1|3612263_3613026_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409116.1|3613328_3615461_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011258529.1|3616011_3616980_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011258803.1|3617140_3618109_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_052285784.1|3619265_3619598_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|3619594_3620358_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
3620401:3620460	attL	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTC	NA	NA	NA	NA
WP_094187763.1|3621229_3622027_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409118.1|3622060_3622453_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_027704094.1|3622543_3622936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239728.1|3625274_3625694_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
WP_012445601.1|3627410_3629195_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_011259851.1|3629385_3629586_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011409125.1|3630121_3630916_+	thiazole synthase	NA	NA	NA	NA	NA
WP_011259853.1|3631216_3631975_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011259854.1|3632050_3633913_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_011409127.1|3633970_3634312_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259856.1|3634571_3634847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409129.1|3637893_3638607_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
3637070:3637733	attR	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTCAGCACAAGCCCAAACGCGGATGACGGCGTACAACGGCGGCCACACGCAGCTGGGTGCCGGAGGAGTTGCGGATTGTGCATCGCCCCGAAGAAGTGCAGACGCGCTTGGTCCCAGGTCATTGGGAAGGCGACTTGATCAAGGGCGCATTCAATCGTTCTTGCGTGGGCACGTTGGTGGAACGCAAGACGCGCTTTGTCGTGCTGTGCCGCATGGATGGCTGCACGGCCGCAGATGCGCTGGAAGGGTTTACCCGGCAAATGAAGAAACTGCCGGCCTCAATGCGGACAAGTCTGACCTACGATCGCGGTACCGAGCTCACGTGCTACGCCGAGCTGATGCAAGGATTGAACATCGACGTGTGGTTCGCTGATCCACATGCGCCGTGGCAGCGGGGAAGTAACGAGAACACCAACGGCCTGCTGCGCCAATTCCTGCCCAAGGGCGCCGACCTGTCCACTGTCAGCCAAGAGTATCTCAATCACATCGCACTGCTGATGAATACCCGCCCTCGTCAGACGCTCGGATGGAAGACACCAAGCGAGGCAATGGAGGAAGAAATCGCAGCACTCAAATCACGTGTTGCACTTGAATCTTGAGACTGCCC	NA	NA	NA	NA
WP_012445603.1|3638667_3639090_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_094187715.1|3639221_3639985_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409134.1|3643058_3643970_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_109181988.1|3645317_3646283_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	3693731	3764641	4994045	transposase,plate	Ralstonia_phage(16.67%)	47	NA	NA
WP_011407175.1|3693731_3694700_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407587.1|3695720_3696755_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011259895.1|3697138_3697864_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409154.1|3697995_3698457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704153.1|3701623_3703744_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_027704154.1|3704010_3704856_-	transporter	NA	NA	NA	NA	NA
WP_011257031.1|3705847_3706816_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011259903.1|3707140_3709111_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_011259904.1|3709539_3710937_+	endoproteinase ArgC	NA	NA	NA	NA	NA
WP_027704156.1|3711049_3711868_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011259907.1|3712178_3715430_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	6.1e-81
WP_011259908.1|3715611_3717030_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_011259909.1|3717039_3717690_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_011409164.1|3717691_3718297_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
WP_011259911.1|3718446_3718668_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409165.1|3718677_3719103_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	48.5	5.8e-08
WP_094187731.1|3719594_3720392_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409167.1|3721469_3722249_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011409168.1|3722463_3723093_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027704159.1|3723153_3723909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069963882.1|3724237_3725014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182229.1|3725422_3726997_+	protein kinase	NA	NA	NA	NA	NA
WP_011409172.1|3727245_3727512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964578.1|3727790_3730970_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.3	4.6e-73
WP_069963885.1|3730969_3731644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959956.1|3731643_3732390_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_075242182.1|3732386_3733898_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_011409179.1|3733890_3734325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182476.1|3734335_3735865_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	29.3	2.5e-45
WP_011409181.1|3736167_3737160_-	restriction endonuclease	NA	A0A1B1IUE7	uncultured_Mediterranean_phage	29.2	1.5e-30
WP_044756557.1|3737212_3737521_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_109182111.1|3738101_3741575_+	type I restriction-modification system endonuclease	NA	A0A1B1IW48	uncultured_Mediterranean_phage	21.9	1.9e-08
WP_109181989.1|3741714_3742713_+	Abi family protein	NA	NA	NA	NA	NA
WP_011409185.1|3742759_3744304_+	type I restriction-modification system subunit M	NA	A0A220A2U5	Liberibacter_phage	23.9	2.0e-13
WP_011409186.1|3744296_3745649_+	type I restriction endonuclease StySPI subunit S	NA	NA	NA	NA	NA
WP_011259929.1|3745682_3745991_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011259930.1|3745997_3746261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082323166.1|3746983_3747739_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_109181990.1|3748032_3749064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181991.1|3749072_3751007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181992.1|3750918_3751881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181993.1|3751958_3754823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181994.1|3754841_3755747_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011259938.1|3758551_3758905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259939.1|3758935_3761665_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_011259940.1|3761750_3762842_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_069959967.1|3762805_3764641_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 29
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	4182181	4292336	4994045	transposase	Ralstonia_phage(21.05%)	76	NA	NA
WP_109182118.1|4182181_4183789_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075242322.1|4183950_4184214_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_075242321.1|4184218_4184878_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	7.1e-13
WP_011260279.1|4185064_4186429_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_011409411.1|4186644_4187340_+	VIT family protein	NA	NA	NA	NA	NA
WP_011409413.1|4188286_4188910_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011260283.1|4189054_4189852_+	cytochrome c4	NA	NA	NA	NA	NA
WP_011409415.1|4189945_4190596_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260284.1|4190687_4191503_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011409416.1|4191552_4192290_+	endonuclease	NA	NA	NA	NA	NA
WP_011409419.1|4194217_4195207_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_109182011.1|4195329_4197903_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_109182012.1|4198095_4198858_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|4198931_4199900_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011409421.1|4200633_4200900_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094187728.1|4201831_4202630_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260292.1|4204276_4205509_+	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_011409423.1|4205548_4206511_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|4206686_4207643_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011258802.1|4207854_4208823_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187715.1|4209158_4209921_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182013.1|4213331_4214297_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012444134.1|4214758_4214989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409428.1|4215613_4217656_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_011409429.1|4217657_4219556_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_011260297.1|4219557_4220811_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_011260298.1|4220807_4221413_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_011409430.1|4221832_4222987_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_011260300.1|4222989_4224018_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_011409431.1|4224014_4225091_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260302.1|4225131_4226409_-	sugar MFS transporter	NA	NA	NA	NA	NA
WP_011409432.1|4226453_4227221_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409433.1|4227435_4228602_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_011260306.1|4231145_4234043_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
WP_011260307.1|4234193_4236884_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409437.1|4237165_4238122_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.6e-42
WP_109182014.1|4238612_4239848_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260311.1|4241283_4242468_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011409442.1|4242535_4243273_+	pteridine reductase	NA	NA	NA	NA	NA
WP_011260313.1|4243441_4243957_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011260314.1|4244048_4245551_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
WP_011260315.1|4245554_4245995_-	response regulator	NA	NA	NA	NA	NA
WP_011409443.1|4245991_4247803_-	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
WP_011260317.1|4248088_4248460_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_011260318.1|4248610_4249663_+	oxidoreductase	NA	NA	NA	NA	NA
WP_011260319.1|4250002_4250944_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.9	5.9e-69
WP_075239460.1|4250964_4252302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409446.1|4252473_4252854_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_012444115.1|4252978_4253740_-	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_011409450.1|4255988_4257392_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	51.5	8.1e-131
WP_011260326.1|4257514_4258570_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.3e-80
WP_103057229.1|4258742_4259597_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011260328.1|4259888_4262072_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.6	2.8e-82
WP_011260329.1|4262570_4263665_-	type II restriction enzyme	NA	NA	NA	NA	NA
WP_041182275.1|4263661_4265473_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_011260331.1|4265717_4266731_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_011260332.1|4266745_4267444_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_011409453.1|4267431_4267710_-	YbeD family protein	NA	NA	NA	NA	NA
WP_011260334.1|4268775_4269981_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	4.6e-66
WP_011260335.1|4270481_4271897_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_011260336.1|4271893_4273033_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_125168765.1|4274258_4274801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409455.1|4274772_4276047_-	DUF3380 domain-containing protein	NA	B3FJ91	Pseudomonas_phage	33.7	1.2e-21
WP_075242420.1|4276046_4276265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409456.1|4276341_4277304_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_115840194.1|4277183_4279319_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011409458.1|4279315_4280395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182015.1|4280391_4281876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409460.1|4281935_4282931_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011260340.1|4283692_4284811_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_011409461.1|4284807_4286868_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_011409462.1|4286871_4287357_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_027703470.1|4287353_4288700_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_012444096.1|4288872_4289919_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.2	4.6e-06
WP_011260344.1|4290194_4291127_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_011257031.1|4291367_4292336_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
>prophage 30
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	4345458	4421807	4994045	transposase	Ralstonia_phage(28.57%)	56	NA	NA
WP_094187715.1|4345458_4346222_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704042.1|4347269_4348055_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_075243437.1|4348308_4350000_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_011409497.1|4350543_4350990_-	autotransporter	NA	NA	NA	NA	NA
WP_012444053.1|4351320_4351605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703841.1|4352199_4353111_-	magnesium transporter	NA	NA	NA	NA	NA
WP_027703842.1|4353356_4354352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757313.1|4354445_4355822_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_041182283.1|4357042_4358689_+	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_044756397.1|4359097_4360870_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_044756396.1|4361145_4362021_-	DMT family transporter	NA	NA	NA	NA	NA
WP_044757311.1|4362218_4363097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033013384.1|4363188_4363791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260398.1|4365136_4366228_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_041182286.1|4368130_4370455_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_109182018.1|4370650_4372597_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409509.1|4372971_4373163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260404.1|4373553_4375137_+	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_027704189.1|4375484_4376081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960267.1|4377429_4378278_-	threonine aldolase	NA	NA	NA	NA	NA
WP_011409514.1|4378312_4379788_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
WP_011260408.1|4380406_4381336_-	lipid kinase YegS	NA	NA	NA	NA	NA
WP_011260409.1|4381570_4382062_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260410.1|4382058_4382730_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011409516.1|4383124_4383454_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_012444032.1|4383662_4384589_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	34.7	3.9e-49
WP_044757306.1|4385062_4385740_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	60.3	8.8e-75
WP_011409520.1|4388257_4388743_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_011409522.1|4389281_4392110_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_011409523.1|4392109_4392484_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_069960013.1|4392480_4394025_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_044756383.1|4394021_4394528_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_011260421.1|4394524_4394809_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_011260422.1|4394805_4395159_+	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
WP_103057261.1|4395606_4395945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|4396128_4397097_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_162597427.1|4399217_4400333_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_011260425.1|4400458_4400947_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409530.1|4401303_4401894_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_109182020.1|4401905_4403414_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.4	1.1e-61
WP_011260428.1|4403856_4404750_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_011409533.1|4406132_4406798_+	pyruvate dehydrogenase E1 subunit alpha	NA	NA	NA	NA	NA
WP_109182021.1|4407430_4408396_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260435.1|4408928_4409309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080493654.1|4409511_4410414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409537.1|4410485_4411781_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_011409538.1|4411910_4412435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260439.1|4412860_4414126_-	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_011409539.1|4414122_4415100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444011.1|4415203_4416007_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_109182022.1|4416182_4416992_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_109182023.1|4416999_4417798_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465763.1|4417840_4418458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409543.1|4418582_4419158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181902.1|4419369_4420689_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011409545.1|4420838_4421807_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 31
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	4429558	4488600	4994045	tRNA,transposase	Acinetobacter_phage(37.5%)	50	NA	NA
WP_094187763.1|4429558_4430357_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099051302.1|4430410_4431209_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409552.1|4431428_4432391_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182024.1|4432838_4433602_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260456.1|4433883_4434660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409554.1|4434656_4435973_+	amino acid permease	NA	NA	NA	NA	NA
WP_011408623.1|4436489_4437725_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260459.1|4438318_4438600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960022.1|4439160_4439598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|4439600_4440569_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409559.1|4440929_4442108_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_069960023.1|4443103_4444066_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260467.1|4446399_4448571_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_109182026.1|4448798_4449155_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_069964611.1|4449233_4450298_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.6	4.3e-100
WP_002808376.1|4450577_4450793_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_011409564.1|4451115_4451562_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.2	1.0e-23
WP_012443989.1|4453039_4454002_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_011260472.1|4454091_4455840_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
WP_041182298.1|4457167_4457413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059317500.1|4457412_4457679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013369.1|4457903_4458950_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_011409569.1|4459133_4460714_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011409570.1|4461102_4461999_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_011260477.1|4462001_4463165_-	heme A synthase	NA	NA	NA	NA	NA
WP_011260478.1|4463175_4463751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409571.1|4463778_4464498_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_012443949.1|4464558_4464777_+	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_011260481.1|4464876_4465752_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_012443948.1|4465790_4466387_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_011260484.1|4466537_4468142_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_069964612.1|4468180_4469134_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_044757542.1|4469150_4469627_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_011260487.1|4469903_4473104_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_109182027.1|4474319_4475285_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_069960028.1|4475297_4475768_-	bacterioferritin	NA	NA	NA	NA	NA
WP_027703893.1|4476110_4476326_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011260490.1|4476406_4477024_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005990700.1|4477572_4477965_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011260491.1|4477968_4478397_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_069960112.1|4478582_4479236_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_011409578.1|4479491_4479806_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011260494.1|4479965_4480760_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_011260495.1|4480897_4481590_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_011409579.1|4481910_4482627_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011260497.1|4482619_4483417_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
WP_011409580.1|4483553_4484591_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
WP_011260499.1|4484708_4485338_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011409581.1|4485489_4486071_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
WP_094187806.1|4487498_4488600_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
>prophage 32
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	4493486	4584509	4994045	tRNA,transposase,integrase	Acidithiobacillus_phage(15.38%)	56	4493368:4493388	4559881:4559901
4493368:4493388	attL	ATAGTCGCCCCTGAAAAACCG	NA	NA	NA	NA
WP_069964614.1|4493486_4494863_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.5	3.7e-80
WP_094187777.1|4497070_4497869_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069964474.1|4498853_4499822_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_069960033.1|4499988_4500960_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	7.2e-38
WP_109182028.1|4501152_4502337_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011260517.1|4502804_4503620_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_011409596.1|4504378_4505695_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011260520.1|4505954_4507199_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011260521.1|4507290_4510539_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_011409597.1|4510672_4513813_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011409598.1|4514102_4515470_-	VOC family protein	NA	NA	NA	NA	NA
WP_109181928.1|4516214_4517180_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109182029.1|4517598_4518564_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_027703675.1|4519026_4519497_+	thioesterase	NA	NA	NA	NA	NA
WP_011409601.1|4519525_4519948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260528.1|4520023_4520458_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011260529.1|4520567_4521083_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011409602.1|4521098_4522124_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011260531.1|4522446_4523043_-	Ax21 family protein	NA	NA	NA	NA	NA
WP_011260532.1|4523400_4525128_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_011260533.1|4525177_4526620_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011260534.1|4526604_4527951_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409603.1|4528141_4528891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260536.1|4528992_4529604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260537.1|4529708_4530932_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260538.1|4531273_4531750_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011409604.1|4531776_4532238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010370565.1|4532623_4532944_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_011260540.1|4533045_4534062_+	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011260541.1|4534133_4535297_+	Fic family protein	NA	NA	NA	NA	NA
WP_011260542.1|4535293_4536925_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.5	1.7e-63
WP_011409605.1|4536932_4539428_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_011260544.1|4539424_4540327_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409606.1|4540548_4540932_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011260546.1|4541250_4542921_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_011409607.1|4543149_4544160_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.6	1.5e-14
WP_011260548.1|4544224_4544383_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_011260549.1|4544617_4545994_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
WP_041182305.1|4546004_4546538_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409609.1|4546966_4548226_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_011260552.1|4548364_4549672_-	MFS transporter	NA	NA	NA	NA	NA
WP_011407587.1|4551756_4552791_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011409611.1|4553141_4553687_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_011409612.1|4553712_4553979_-	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011260556.1|4554153_4555992_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011260557.1|4556222_4557098_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.5	5.3e-56
WP_012445230.1|4558583_4559819_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_075240199.1|4562795_4563695_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
4559881:4559901	attR	CGGTTTTTCAGGGGCGACTAT	NA	NA	NA	NA
WP_011260561.1|4564641_4567443_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
WP_011409617.1|4567519_4567810_+	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_075240612.1|4569372_4569963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133260589.1|4570103_4571009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014504812.1|4571198_4573886_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_109182031.1|4576946_4577915_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.8e-97
WP_155296185.1|4582373_4582514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409629.1|4583996_4584509_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	68.8	1.6e-44
>prophage 33
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	4682540	4740841	4994045	tRNA,transposase	Leptospira_phage(50.0%)	33	NA	NA
WP_109182036.1|4682540_4683506_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260658.1|4683606_4684032_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094187715.1|4684074_4684837_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260659.1|4684899_4685931_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.0e-70
WP_011260660.1|4687291_4688548_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011260661.1|4688544_4689435_+	allantoinase PuuE	NA	NA	NA	NA	NA
WP_012443820.1|4689431_4689827_+	DUF3225 domain-containing protein	NA	NA	NA	NA	NA
WP_075239612.1|4689846_4690425_+	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_115801912.1|4690310_4691168_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_011409690.1|4691100_4692489_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260667.1|4697274_4699359_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011260668.1|4699458_4701486_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011260669.1|4701728_4703339_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
WP_011260670.1|4703349_4704513_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011409694.1|4704641_4705262_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012443812.1|4705592_4705781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260672.1|4705823_4706159_-	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_075242289.1|4707783_4708095_-	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_011409699.1|4709213_4709732_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_011409700.1|4710002_4711721_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_011260679.1|4711811_4712198_-	MerC family mercury resistance protein	NA	NA	NA	NA	NA
WP_011260680.1|4712259_4713585_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_113331519.1|4713699_4715013_-	type III effector protein XopR	NA	NA	NA	NA	NA
WP_011260682.1|4715111_4715837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409701.1|4716053_4716716_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409702.1|4716794_4717889_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_011409706.1|4722404_4723994_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_011409707.1|4723993_4726231_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_011409708.1|4726519_4727428_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011409709.1|4727517_4729332_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_153303324.1|4729717_4738543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182038.1|4738641_4739439_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409735.1|4739521_4740841_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP021789	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4994045	4751092	4828332	4994045	tRNA,transposase,tail	Arthrobacter_phage(25.0%)	49	NA	NA
WP_011260702.1|4751092_4752010_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_011409721.1|4754175_4755243_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409722.1|4755418_4757614_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409723.1|4757610_4759575_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409724.1|4759586_4760846_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_011260707.1|4760845_4762546_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011260708.1|4762548_4765263_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260709.1|4765485_4766958_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_011260711.1|4767935_4768991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260712.1|4769218_4770637_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_011409725.1|4770677_4771655_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_042465333.1|4773071_4774373_-	MFS transporter	NA	NA	NA	NA	NA
WP_011409727.1|4774834_4777768_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409728.1|4777866_4779354_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260718.1|4779385_4780420_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_094187716.1|4780836_4781634_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182039.1|4782940_4783897_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_109182040.1|4784624_4785387_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075242372.1|4785404_4786505_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011260725.1|4786570_4787692_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_011409734.1|4787701_4788778_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260727.1|4788870_4789551_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_109182041.1|4789583_4790382_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409735.1|4790510_4791830_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465802.1|4791932_4792889_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.4e-41
WP_011260733.1|4794355_4794814_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409738.1|4794915_4795344_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_069960048.1|4795590_4796454_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_042465346.1|4799630_4799897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260739.1|4800058_4800307_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_109182042.1|4800515_4801274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465805.1|4801270_4801966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409745.1|4802064_4802397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409747.1|4802868_4803303_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_069960049.1|4803418_4803664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260743.1|4803999_4804332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703652.1|4804781_4806176_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011260746.1|4807104_4807395_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	53.8	1.5e-15
WP_012443754.1|4807412_4807694_-	plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	40.7	3.1e-10
WP_069960050.1|4807788_4810041_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	21.9	1.8e-10
WP_044756262.1|4810228_4814302_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.5	4.1e-10
WP_109182043.1|4814298_4817712_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_113175344.1|4817828_4818050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182044.1|4818117_4820772_+	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	26.6	1.1e-48
WP_075250760.1|4825014_4825257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409756.1|4825542_4826088_+|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_011260754.1|4826156_4826684_+|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011260755.1|4826742_4827279_+|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
WP_109182045.1|4827366_4828332_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
