The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022588	Mycoplasma bovis strain MJ4 chromosome, complete genome	1053367	83116	94477	1053367	tRNA	Bodo_saltans_virus(28.57%)	8	NA	NA
WP_013954527.1|83116_84097_+	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	27.1	3.9e-15
WP_013954528.1|84100_84922_+	alpha/beta hydrolase	NA	G9E3U1	Emiliania_huxleyi_virus	32.5	2.3e-08
WP_013954529.1|85005_85770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954530.1|85762_86743_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	40.6	8.1e-53
WP_115305906.1|86867_91244_+	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	31.8	6.2e-12
WP_013954532.1|91649_92873_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	35.1	1.5e-61
WP_013456569.1|92862_93828_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	40.9	3.6e-29
WP_013954533.1|93817_94477_+	uracil-DNA glycosylase	NA	A0A068EP41	Falconid_herpesvirus	36.4	1.6e-28
>prophage 2
NZ_CP022588	Mycoplasma bovis strain MJ4 chromosome, complete genome	1053367	156731	165585	1053367	transposase	Mycoplasma_phage(66.67%)	7	NA	NA
WP_101456650.1|156731_158573_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	19.1	2.1e-17
WP_013456016.1|158835_160248_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	68.7	1.2e-81
WP_013456380.1|160231_161068_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	62.0	2.5e-87
WP_013456215.1|161060_161954_+	spermidine/putrescine ABC transporter permease	NA	Q6GZ01	Mycoplasma_phage	62.3	2.1e-92
WP_013455994.1|161940_163842_+	membrane protein	NA	Q6GZ00	Mycoplasma_phage	34.2	3.9e-80
WP_013456051.1|164066_164267_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_013455927.1|164568_165585_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.6	8.4e-37
>prophage 3
NZ_CP022588	Mycoplasma bovis strain MJ4 chromosome, complete genome	1053367	190185	349886	1053367	tRNA,integrase,transposase	Faecalibacterium_phage(16.67%)	111	277859:277878	311948:311967
WP_101456658.1|190185_191469_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_013954601.1|191627_192011_+	membrane protein	NA	NA	NA	NA	NA
WP_013954602.1|192148_193138_-	lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.9	1.8e-39
WP_115305916.1|193547_194348_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_013954605.1|194463_194625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954606.1|194801_195254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954606.1|197417_197870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954607.1|198037_200461_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_115305918.1|200447_202175_-	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	30.3	4.3e-41
WP_013954609.1|203972_205097_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	28.6	3.8e-22
WP_075271984.1|205225_205615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954611.1|205742_207248_-	trigger factor	NA	NA	NA	NA	NA
WP_013954612.1|207614_207773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954613.1|207901_209311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078086166.1|210388_211417_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.8	3.8e-21
WP_013954618.1|215738_216125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954619.1|217992_218910_-	5'-3' exonuclease	NA	A0A0N7ACJ6	Bacillus_phage	31.1	1.3e-31
WP_013954620.1|218911_221845_-	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	34.4	1.0e-87
WP_013954621.1|222353_223778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172792932.1|224412_225792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172792933.1|225737_228074_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_078086163.1|230726_231755_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_115305920.1|232331_233744_+|transposase	IS1634-like element ISMbov2 family transposase	transposase	NA	NA	NA	NA
WP_014829881.1|234048_235482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172792934.1|236119_237499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041323925.1|237444_239760_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_013954624.1|239934_240384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101456660.1|240705_242547_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_013954626.1|242533_242986_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_049773792.1|243096_244812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954628.1|244956_245976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101456661.1|245976_246525_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_013455969.1|246592_247153_+	peptide deformylase	NA	NA	NA	NA	NA
WP_101456662.1|247165_248563_+	CvpA family protein	NA	NA	NA	NA	NA
WP_013954631.1|248676_250593_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.9	5.7e-119
WP_013954632.1|250606_253192_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	29.6	9.8e-90
WP_013954633.1|253333_254263_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_075271093.1|254264_254981_+	ribonuclease HIII	NA	NA	NA	NA	NA
WP_013954635.1|256825_257800_+	DNA cytosine methyltransferase	NA	R4TMW4	Halovirus	38.4	1.6e-48
WP_080551570.1|258400_259429_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013456076.1|259967_260297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101456663.1|260540_261236_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_014829885.1|261219_262206_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	35.7	2.2e-42
WP_115305922.1|262424_263147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013455927.1|263993_265010_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.6	8.4e-37
WP_115306037.1|265173_266001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101456664.1|266682_267627_-	endonuclease	NA	NA	NA	NA	NA
WP_115305924.1|267725_269672_+	transketolase	NA	NA	NA	NA	NA
WP_101456666.1|269734_270289_-	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	1.6e-21
WP_013456603.1|270367_270637_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_101456667.1|270750_271338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115305927.1|271431_273609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101456669.1|273620_275006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101456745.1|275005_275341_+	HIT family protein	NA	NA	NA	NA	NA
WP_101456670.1|275459_276158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004024364.1|276211_276364_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_115306039.1|276803_277832_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	32.9	3.2e-20
277859:277878	attL	ACTTTTGAGTACTCAAAAGT	NA	NA	NA	NA
WP_173674353.1|278033_278192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456491.1|278365_278851_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_013456378.1|278888_279125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101456671.1|279114_280179_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_075270987.1|280247_280532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075270988.1|280553_282104_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	35.1	2.1e-79
WP_075270989.1|282106_282892_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_101456672.1|282912_285102_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	1.3e-71
WP_101456673.1|285104_285347_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_013456283.1|285689_286277_+	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	38.6	1.2e-08
WP_013456579.1|286282_287035_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_013456514.1|287052_288051_+	serine/threonine protein kinase	NA	Q85453	Moloney_murine_sarcoma_virus	32.2	4.3e-17
WP_013456585.1|288062_288908_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_013455939.1|288894_289557_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_013456032.1|290419_292645_-	AAA family ATPase	NA	A0A2K9V9X6	Bandra_megavirus	26.6	3.4e-30
WP_013456112.1|292790_294224_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954662.1|294696_295740_+	AAA family ATPase	NA	A0A2H4UTU5	Bodo_saltans_virus	29.0	9.9e-09
WP_013954663.1|295741_298012_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_013954664.1|298241_301382_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	24.8	2.3e-24
WP_013954665.1|301383_303024_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_075278710.1|304378_304909_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013954667.1|304905_305598_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013954669.1|305678_306647_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.2	3.8e-31
WP_081375095.1|306872_307334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456029.1|308825_310238_+|transposase	IS1634-like element ISMbov2 family transposase	transposase	NA	NA	NA	NA
WP_078086163.1|310892_311921_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_101456674.1|312959_314579_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	39.8	7.7e-109
311948:311967	attR	ACTTTTGAGTACTCAAAAGT	NA	NA	NA	NA
WP_013954674.1|314818_317485_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	27.3	4.2e-80
WP_013954675.1|317497_318208_+	signal peptidase II	NA	NA	NA	NA	NA
WP_115305929.1|318402_320262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954676.1|321211_321808_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_013456191.1|321788_322751_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	26.5	1.5e-06
WP_013456399.1|322787_325154_+	membrane protein	NA	NA	NA	NA	NA
WP_013456468.1|325224_326091_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_013456636.1|326083_326926_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_013456459.1|326957_327845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456065.1|327935_328202_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_075271075.1|328355_329147_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_115266442.1|329272_330490_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	32.5	3.5e-13
WP_013456385.1|330555_331530_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013456634.1|331516_332341_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_115305931.1|332489_334259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954682.1|334297_335365_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_075271184.1|335654_337655_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_013456489.1|337635_338091_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_013954685.1|338080_339556_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	33.5	6.0e-52
WP_101456679.1|339555_340848_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_115305933.1|341206_342229_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_014829901.1|342638_343013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456595.1|343242_344151_+	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_013455927.1|344459_345476_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.6	8.4e-37
WP_013456502.1|345733_346033_-	PTS transporter subunit EIIB	NA	NA	NA	NA	NA
WP_075271416.1|346211_347111_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_101456648.1|348452_349886_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP022588	Mycoplasma bovis strain MJ4 chromosome, complete genome	1053367	441122	514708	1053367	tRNA,transposase	Faecalibacterium_phage(25.0%)	49	NA	NA
WP_078086171.1|441122_442151_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.0	5.0e-21
WP_013954737.1|442594_444739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038582878.1|445557_446598_+	zinc-dependent alcohol dehydrogenase	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	29.2	8.0e-35
WP_013954740.1|446641_447889_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_075271400.1|447873_448671_-	DNA (cytosine-5-)-methyltransferase	NA	A0A140HLV8	Bacillus_phage	40.5	9.8e-25
WP_013954742.1|448597_449080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115287402.1|450784_451699_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_115276529.1|451944_452973_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	32.6	1.1e-20
WP_013954750.1|453295_454711_-	DUF285 domain-containing protein	NA	NA	NA	NA	NA
WP_013954751.1|455008_456490_+	AAA family ATPase	NA	E3T5S4	Cafeteria_roenbergensis_virus	27.7	6.1e-28
WP_013954995.1|456726_457971_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_013954753.1|461103_461964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115305946.1|462137_462866_-	purine nucleoside phosphorylase DeoD-type	NA	NA	NA	NA	NA
WP_013954755.1|463035_464160_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_013954756.1|464170_466813_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	36.1	6.5e-65
WP_013954757.1|466805_467246_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_013954758.1|467235_467964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954759.1|468245_470381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954760.1|470555_471278_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	33.8	1.4e-06
WP_162293106.1|471702_473304_-|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_013954761.1|475138_475591_+	SocA family protein	NA	A0A0N9SGM1	Paenibacillus_phage	41.0	2.0e-22
WP_013954764.1|476190_476415_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013954765.1|476696_477548_+	DUF285 domain-containing protein	NA	NA	NA	NA	NA
WP_014829922.1|477766_478036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014829924.1|479186_480548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038582722.1|480548_482558_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_013456441.1|482615_482882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954770.1|482874_483726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954771.1|483718_483943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954772.1|483962_484394_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_013954773.1|484406_485060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014829925.1|485287_486796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456404.1|487263_487569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038582731.1|487636_489874_+	membrane protein	NA	NA	NA	NA	NA
WP_013954660.1|491246_492635_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954780.1|494373_494961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954781.1|494963_499487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954782.1|499821_500466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954783.1|500784_502017_+	UPF0236 family protein	NA	NA	NA	NA	NA
WP_013455996.1|502929_503421_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_013456577.1|503410_503962_+	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_013456513.1|504063_504543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456428.1|504745_505849_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_013954784.1|505889_506699_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_115305948.1|506670_507357_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_013954786.1|507372_510204_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	52.6	1.7e-276
WP_013954787.1|510205_512215_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_013954788.1|512334_513282_+	DNA cytosine methyltransferase	NA	V5URQ5	Oenococcus_phage	63.3	2.4e-110
WP_078086163.1|513679_514708_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
>prophage 5
NZ_CP022588	Mycoplasma bovis strain MJ4 chromosome, complete genome	1053367	532319	596815	1053367	tRNA,transposase	Moraxella_phage(28.57%)	44	NA	NA
WP_013954804.1|532319_534659_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	33.7	2.6e-110
WP_172792936.1|534868_537868_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.0	6.8e-135
WP_038582744.1|537959_538685_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_115305952.1|538873_539380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456419.1|539484_540396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456542.1|540530_540944_-	ATP synthase F1 subunit epsilon	NA	NA	NA	NA	NA
WP_013456276.1|540959_542423_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_013456581.1|542475_543339_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_013954807.1|543331_544918_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_013954808.1|544910_545471_-	ATP synthase F1 subunit delta	NA	NA	NA	NA	NA
WP_013954809.1|545473_546046_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_013456149.1|546050_546278_-	ATP synthase F0 subunit C	NA	NA	NA	NA	NA
WP_013456258.1|546293_547112_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_013954812.1|549684_550488_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_078086173.1|550962_551991_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	32.9	1.1e-20
WP_014829937.1|552242_552944_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013954660.1|553491_554880_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014829938.1|555185_555626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954815.1|555618_557367_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.9e-101
WP_014829939.1|557374_558370_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013954817.1|558486_559242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075270961.1|559422_560859_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014829940.1|560892_561204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101456648.1|561841_563275_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_078086175.1|565005_566034_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.8	3.8e-21
WP_115305954.1|566299_567061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014829944.1|567443_567707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075270938.1|567861_568413_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_115305956.1|570371_571403_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_101456697.1|571838_574067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101456698.1|574245_574425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115305958.1|575153_577142_+	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_075271160.1|577450_579175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153700566.1|579638_580304_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013456133.1|580490_581792_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_075270944.1|582600_584559_+	peptidase S41	NA	NA	NA	NA	NA
WP_101456648.1|584635_586069_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954995.1|586481_587726_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_101456648.1|588045_589479_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_115305962.1|590992_592018_-	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_013456598.1|592004_593111_-	DUF285 domain-containing protein	NA	NA	NA	NA	NA
WP_013456494.1|593553_593925_+	PTS transporter subunit EIIB	NA	NA	NA	NA	NA
WP_115265558.1|593989_595861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115305964.1|595885_596815_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	36.6	4.2e-51
>prophage 6
NZ_CP022588	Mycoplasma bovis strain MJ4 chromosome, complete genome	1053367	748071	799951	1053367	integrase,transposase	Faecalibacterium_phage(16.67%)	48	795122:795148	805995:806021
WP_115305996.1|748071_749505_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954924.1|754721_755714_+	histidine acid phosphatase	NA	NA	NA	NA	NA
WP_013456029.1|756399_757812_-|transposase	IS1634-like element ISMbov2 family transposase	transposase	NA	NA	NA	NA
WP_115306041.1|758271_759300_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.8	3.8e-21
WP_013954925.1|760299_761343_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_013456526.1|761473_761908_-	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_013954926.1|761926_762622_-	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_013456329.1|762624_762975_-	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_013455947.1|762999_763539_-	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_013954927.1|763548_763944_-	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_013455972.1|763945_764131_-	type Z 30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_075270967.1|764133_764679_-	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_004023949.1|764681_765008_-	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_004023950.1|765020_765389_-	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_013456343.1|765392_765659_-	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_013456156.1|765658_765856_-	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_013456225.1|765855_766281_-	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_013954928.1|766280_766931_-	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_013954929.1|766933_767278_-	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_013954930.1|767280_767559_-	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_013954931.1|767558_768404_-	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_013456175.1|768473_768914_-	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_038582884.1|768913_769873_-	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_013954934.1|769893_770724_-	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_013456535.1|770777_771083_-	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_013456552.1|771699_771975_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_013954936.1|771998_772490_-	Holliday junction resolvase RecU	NA	A0A0S2MVB5	Bacillus_phage	33.5	5.7e-15
WP_075271100.1|772628_773621_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	54.6	2.3e-95
WP_013456391.1|773706_774519_+	YmdB family metallophosphoesterase	NA	NA	NA	NA	NA
WP_013954939.1|774571_775657_-	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_013954940.1|775904_776615_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_013456038.1|776651_776930_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_013455997.1|776936_777236_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_013456093.1|777428_777695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456268.1|777788_778211_-	MscL family protein	NA	NA	NA	NA	NA
WP_013954941.1|778398_779424_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_013954942.1|779407_780415_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_013954943.1|780583_780796_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_075270971.1|780818_781415_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_013954945.1|781712_783215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954946.1|783253_786013_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.2	3.1e-110
WP_075270973.1|786635_791348_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_013954691.1|791412_792657_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	5.3e-09
WP_013954660.1|792964_794353_-|transposase	transposase	transposase	NA	NA	NA	NA
795122:795148	attL	GGAATTTACTAACGCTTGAGAACAGGA	NA	NA	NA	NA
WP_101456749.1|795818_796238_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_075271129.1|796360_797662_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_101456750.1|798038_799061_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_115306043.1|799075_799951_+|integrase	tyrosine-type recombinase/integrase	integrase	A8ATD6	Listeria_phage	48.5	2.1e-76
805995:806021	attR	TCCTGTTCTCAAGCGTTAGTAAATTCC	NA	NA	NA	NA
>prophage 7
NZ_CP022588	Mycoplasma bovis strain MJ4 chromosome, complete genome	1053367	945775	991753	1053367	tRNA,integrase,transposase	Faecalibacterium_phage(27.27%)	37	974176:974195	991780:991799
WP_013456477.1|945775_946393_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_004024108.1|946447_946663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456259.1|946951_947563_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_013455927.1|947859_948876_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.6	8.4e-37
WP_013456320.1|949033_950707_-	ribonuclease J	NA	NA	NA	NA	NA
WP_013455948.1|951752_952478_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	36.9	1.4e-30
WP_013456583.1|952470_953373_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_013456476.1|953372_954020_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	35.6	2.2e-22
WP_013456384.1|954034_954622_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_013456226.1|954624_954915_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_115266483.1|954931_956782_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	38.9	1.5e-52
WP_115306045.1|957020_958049_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013456015.1|958566_959232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456011.1|959361_960858_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_013456010.1|960860_961760_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_013456212.1|961948_962701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013455980.1|962898_963432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456446.1|963418_964027_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_041309179.1|964085_964991_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_013955056.1|965029_965686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456231.1|965830_966343_-	adenine phosphoribosyltransferase	NA	A0A2K9L2N8	Tupanvirus	34.4	1.4e-11
WP_013456169.1|966371_968177_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.7	2.8e-27
WP_013456107.1|968155_968458_-	YlxR family protein	NA	NA	NA	NA	NA
WP_101456727.1|968441_970076_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_101456728.1|970083_970530_-	ribosome assembly cofactor RimP	NA	NA	NA	NA	NA
WP_013456273.1|970669_971242_-	thymidine kinase	NA	Q6GYZ9	Mycoplasma_phage	70.1	9.4e-70
WP_013456539.1|971317_972688_-	peptidase M17	NA	Q6GYZ8	Mycoplasma_phage	73.1	1.5e-153
WP_078086180.1|973120_974149_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
974176:974195	attL	ACTTTTGAGTACTCAAAAGT	NA	NA	NA	NA
WP_115306015.1|974359_975367_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_115306017.1|977546_977738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115306019.1|977990_978593_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_174245886.1|978768_979230_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013456029.1|979585_980998_-|transposase	IS1634-like element ISMbov2 family transposase	transposase	NA	NA	NA	NA
WP_115303289.1|987054_987417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174244267.1|988593_989142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456123.1|989351_990101_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_115306045.1|990724_991753_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
991780:991799	attR	ACTTTTGAGTACTCAAAAGT	NA	NA	NA	NA
