The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022596	Mycoplasma bovis strain NADC67 chromosome, complete genome	1113699	80737	144354	1113699	transposase,tRNA	Faecalibacterium_phage(20.0%)	55	NA	NA
WP_078086171.1|80737_81766_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.0	5.0e-21
WP_041309069.1|81968_82733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954530.1|82725_83706_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	40.6	8.1e-53
WP_115265526.1|83830_88207_+	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	31.8	6.2e-12
WP_013954532.1|88612_89836_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	35.1	1.5e-61
WP_013456569.1|89825_90791_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	40.9	3.6e-29
WP_115265527.1|90780_91440_+	uracil-DNA glycosylase	NA	A0A068EP41	Falconid_herpesvirus	36.4	1.6e-28
WP_013954534.1|91441_93628_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_115265528.1|93637_94903_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	50.8	6.2e-98
WP_013954536.1|94912_95884_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_013954537.1|95876_97037_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_013954538.1|97062_97455_+	iron-sulfur cluster assembly scaffold protein	NA	NA	NA	NA	NA
WP_115265529.1|97444_98692_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_013954540.1|98697_99792_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_172792935.1|99806_100547_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_013954542.1|100528_101722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954543.1|101758_102019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954544.1|102021_102897_+	class II fructose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_115265530.1|102977_103550_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_115265531.1|103590_104835_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.3	1.4e-09
WP_013456528.1|105009_105480_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_013954546.1|105479_106175_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_014829861.1|106221_106680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075271140.1|106666_108034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954549.1|108024_108783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954550.1|109003_109537_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_115265532.1|109521_110253_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_014829862.1|110260_110494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954553.1|110493_111354_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_013954554.1|111381_111771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954555.1|111908_112871_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_013954556.1|112863_113847_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_013954557.1|113848_114772_+	FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	41.2	1.5e-61
WP_075271137.1|114876_115566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013455974.1|115785_116877_+	pyruvate dehydrogenase E1 subunit alpha	NA	NA	NA	NA	NA
WP_013954559.1|116913_117900_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_013456556.1|118036_118261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954560.1|118260_118995_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_013455917.1|118996_120610_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	7.8e-37
WP_078086165.1|120879_121908_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_004024280.1|122327_122534_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_013456035.1|122588_123134_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_115265533.1|123150_124059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115265596.1|124517_125546_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.0	5.0e-21
WP_101456646.1|126104_128990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013455934.1|129021_130143_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013456209.1|130142_131411_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013456492.1|131425_132574_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.0	4.1e-08
WP_013456036.1|132563_134966_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.6	2.2e-11
WP_075270998.1|134978_135962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456113.1|136032_136524_+	membrane protein	NA	NA	NA	NA	NA
WP_013456012.1|136610_137828_+	YitT family protein	NA	NA	NA	NA	NA
WP_115265534.1|137865_139806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173022447.1|139994_141596_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_013954995.1|143109_144354_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
>prophage 2
NZ_CP022596	Mycoplasma bovis strain NADC67 chromosome, complete genome	1113699	150698	242716	1113699	transposase,tRNA	Enterobacteria_phage(21.05%)	50	NA	NA
WP_013456141.1|150698_152135_+|tRNA	proline--tRNA ligase	tRNA	A0A1V0SJ28	Klosneuvirus	37.9	1.1e-93
WP_013456293.1|152194_152563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954995.1|154047_155292_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_013456555.1|155934_156633_+	LemA family protein	NA	NA	NA	NA	NA
WP_101456649.1|156815_159203_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_101456650.1|159261_161103_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	19.1	2.1e-17
WP_013456016.1|161365_162778_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	68.7	1.2e-81
WP_013456380.1|162761_163598_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	62.0	2.5e-87
WP_013456215.1|163590_164484_+	spermidine/putrescine ABC transporter permease	NA	Q6GZ01	Mycoplasma_phage	62.3	2.1e-92
WP_013455994.1|164470_166372_+	membrane protein	NA	Q6GZ00	Mycoplasma_phage	34.2	3.9e-80
WP_013456051.1|166596_166797_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_075271213.1|166860_168489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271214.1|168490_169627_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_013455960.1|169669_169948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173022448.1|169989_171351_-	DUF285 domain-containing protein	NA	NA	NA	NA	NA
WP_075271215.1|171703_173170_-	DUF285 domain-containing protein	NA	NA	NA	NA	NA
WP_075271216.1|173800_176236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271217.1|176387_178877_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	39.9	5.8e-140
WP_075271218.1|178879_179740_+	bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.6	1.3e-33
WP_013954592.1|179839_180796_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_013954593.1|180799_181993_+	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_101456651.1|182008_182431_+	pantetheine-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_101456652.1|182430_183012_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_101456653.1|183039_184536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101456654.1|184672_186109_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_101456655.1|186177_187158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101456656.1|187408_189202_+	molecular chaperone DnaK	NA	A0A0G2YAL1	Acanthamoeba_polyphaga_mimivirus	45.8	2.5e-129
WP_162293106.1|189395_190997_-|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_013954995.1|191307_192552_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_101456658.1|192645_193929_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_013954601.1|194087_194471_+	membrane protein	NA	NA	NA	NA	NA
WP_013954602.1|194608_195598_-	lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.9	1.8e-39
WP_075271077.1|196007_196808_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013954605.1|196923_197085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954606.1|197261_197714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115265536.1|203728_205417_-	RsmD family RNA methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	30.1	4.3e-30
WP_013954995.1|206063_207308_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_013954611.1|208622_210128_-	trigger factor	NA	NA	NA	NA	NA
WP_013954612.1|210494_210653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101456648.1|214855_216289_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_115265597.1|216307_217297_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.8	2.8e-21
WP_115265537.1|219374_221435_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013954618.1|221619_222006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101456648.1|222120_223554_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954619.1|223874_224792_-	5'-3' exonuclease	NA	A0A0N7ACJ6	Bacillus_phage	31.1	1.3e-31
WP_013954620.1|224793_227727_-	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	34.4	1.0e-87
WP_173022442.1|232258_233638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172792933.1|233583_235920_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_078086163.1|238572_239601_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013954995.1|241471_242716_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
>prophage 3
NZ_CP022596	Mycoplasma bovis strain NADC67 chromosome, complete genome	1113699	247543	318800	1113699	integrase,transposase,tRNA	Bacillus_virus(12.5%)	58	303220:303268	317105:317153
WP_013954660.1|247543_248932_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954624.1|250753_251203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954625.1|251524_253366_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_013954626.1|253352_253805_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_115265599.1|253915_255631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954628.1|255774_256794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954629.1|256794_257343_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_013455969.1|257410_257971_+	peptide deformylase	NA	NA	NA	NA	NA
WP_013954630.1|257983_259381_+	CvpA family protein	NA	NA	NA	NA	NA
WP_013954631.1|259494_261411_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.9	5.7e-119
WP_013954632.1|261424_264010_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	29.6	9.8e-90
WP_013954633.1|264151_265081_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_075271093.1|265082_265799_+	ribonuclease HIII	NA	NA	NA	NA	NA
WP_013954635.1|265986_266961_+	DNA cytosine methyltransferase	NA	R4TMW4	Halovirus	38.4	1.6e-48
WP_013954636.1|266953_267661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456076.1|268130_268460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954638.1|268702_269398_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_014829885.1|269381_270368_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	35.7	2.2e-42
WP_013954642.1|270585_271308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038582854.1|271911_272679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954646.1|273363_274308_-	endonuclease	NA	NA	NA	NA	NA
WP_013954647.1|274406_276353_+	transketolase	NA	NA	NA	NA	NA
WP_013954648.1|276415_276970_-	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	2.1e-21
WP_013456603.1|277048_277318_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_013954649.1|277431_278019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954650.1|278112_280281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954651.1|280292_281675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954652.1|281674_282010_+	HIT family protein	NA	B5LJ12	Mycobacterium_phage	33.8	3.6e-05
WP_013954653.1|282128_282827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004024364.1|282880_283033_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_013954654.1|283166_283325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456491.1|283498_283984_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_013456378.1|284021_284258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954655.1|284247_285312_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_013954656.1|285380_285665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014829889.1|285686_287237_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	35.7	1.9e-80
WP_075270989.1|287239_288025_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_115265539.1|288045_290235_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	1.0e-71
WP_013456572.1|290237_290480_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_013456283.1|290822_291410_+	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	38.6	1.2e-08
WP_013456579.1|291415_292168_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_013456514.1|292185_293184_+	serine/threonine protein kinase	NA	Q85453	Moloney_murine_sarcoma_virus	32.2	4.3e-17
WP_013456585.1|293195_294041_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_013455939.1|294027_294690_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_115265540.1|295552_297778_-	AAA family ATPase	NA	A0A2K9V9X6	Bandra_megavirus	26.7	2.3e-31
WP_013456112.1|297923_299357_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954662.1|299829_300873_+	AAA family ATPase	NA	A0A2H4UTU5	Bodo_saltans_virus	29.0	9.9e-09
WP_013954663.1|300874_303145_+	S8 family peptidase	NA	NA	NA	NA	NA
303220:303268	attL	ATAATTATGTTTTCTTGTTTTATGCTTAAACTGGGAAACGTAGGAAAAT	NA	NA	NA	NA
WP_115265541.1|303374_306509_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.8	2.3e-24
WP_115265542.1|306534_307779_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	26.6	1.2e-08
WP_013954995.1|308470_309715_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_078086174.1|309926_311528_+|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_173022449.1|311594_313211_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_013954666.1|313197_313749_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013954667.1|313745_314438_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013954668.1|314616_315792_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013954669.1|315865_316834_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.2	3.8e-31
WP_078086164.1|317198_318800_-|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
317105:317153	attR	ATTTTCCTACGTTTCCCAGTTTAAGCATAAAACAAGAAAACATAATTAT	NA	NA	NA	NA
>prophage 4
NZ_CP022596	Mycoplasma bovis strain NADC67 chromosome, complete genome	1113699	324057	397456	1113699	transposase,tRNA	Enterobacteria_phage(23.08%)	48	NA	NA
WP_115265544.1|324057_326739_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	27.2	1.5e-80
WP_075271156.1|326740_327451_+	signal peptidase II	NA	NA	NA	NA	NA
WP_101456675.1|329540_331400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101456676.1|332350_332947_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_075271197.1|332927_333890_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	26.5	1.9e-06
WP_075271196.1|333926_336293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954995.1|336339_337584_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_075271195.1|337706_338573_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_075271194.1|338565_339408_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_075271193.1|339439_340327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456065.1|340417_340684_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_075271192.1|340837_341629_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_115265545.1|341754_342972_+	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	32.5	2.7e-13
WP_115265546.1|343037_344012_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013456634.1|343998_344823_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_075271187.1|344971_346741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954682.1|346779_347847_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_075271184.1|348136_350137_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_013456489.1|350117_350573_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_013954685.1|350562_352038_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	33.5	6.0e-52
WP_101456679.1|352037_353330_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_101456680.1|353688_354711_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_101456681.1|355118_355493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101456682.1|356791_357091_-	PTS transporter subunit EIIB	NA	NA	NA	NA	NA
WP_101456683.1|360283_361141_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_115265547.1|361569_362919_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.8	1.9e-12
WP_101456685.1|362911_364522_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_101456686.1|364587_366027_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_013954995.1|366152_367397_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_101456687.1|367481_369578_-	peptidase S41	NA	NA	NA	NA	NA
WP_075271013.1|369541_371383_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_075271012.1|371385_373695_-	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_075271011.1|373719_374013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075271010.1|374013_375375_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013954698.1|375894_376728_+	DNA adenine methylase	NA	A0A1S5PRR3	Streptococcus_phage	45.7	3.6e-54
WP_013954699.1|377034_377988_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_013954700.1|378037_378934_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_115265548.1|378967_380842_-	peptidase S41	NA	NA	NA	NA	NA
WP_013954995.1|380947_382192_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_115265549.1|382217_382712_-	dUTP diphosphatase	NA	S6AVW3	Thermus_phage	33.1	3.2e-10
WP_078086168.1|383014_384616_-|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_013954704.1|385001_386366_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_162293107.1|386820_388422_+|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_013954705.1|388551_389337_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_013954706.1|389341_390871_-	RNA polymerase sigma factor	NA	G8CLC7	Synechococcus_phage	33.7	2.0e-29
WP_101456689.1|390863_392804_-	DNA primase	NA	A0A1S5RFD7	Helicobacter_phage	35.3	5.7e-42
WP_013954708.1|392845_394222_-|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	32.0	3.9e-53
WP_013954660.1|396067_397456_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP022596	Mycoplasma bovis strain NADC67 chromosome, complete genome	1113699	411733	504691	1113699	transposase,tRNA	Tupanvirus(28.57%)	60	NA	NA
WP_078086163.1|411733_412762_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013456295.1|413105_413561_-	Sua5/YciO/YrdC/YwlC family protein	NA	NA	NA	NA	NA
WP_013954715.1|413611_415282_-	APC family permease	NA	NA	NA	NA	NA
WP_013954716.1|415520_416837_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	25.1	2.7e-11
WP_013456122.1|416905_418609_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	23.1	2.0e-14
WP_013456084.1|420033_420825_-	aquaporin family protein	NA	M1HQW3	Paramecium_bursaria_Chlorella_virus	27.5	7.3e-12
WP_013954718.1|420833_422342_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_013456345.1|422631_424023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041309259.1|424155_425142_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_013456401.1|425158_426127_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_013456470.1|426240_426984_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_013456409.1|427163_427448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456558.1|427440_429087_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_013456463.1|429093_430098_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_013456004.1|430090_430765_+	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	31.9	1.2e-18
WP_115265551.1|430837_433816_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_013954721.1|433868_435221_-	YitT family protein	NA	NA	NA	NA	NA
WP_013954722.1|435315_436152_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_013954723.1|436138_436870_-	DNA-processing protein DprA	NA	NA	NA	NA	NA
WP_013954660.1|438739_440128_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_101456648.1|440418_441852_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_038582875.1|442040_443081_+	zinc-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	29.7	5.2e-34
WP_143823096.1|443400_443619_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013954995.1|443649_444894_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_173022443.1|444934_445420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954726.1|446036_448838_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_013954727.1|449066_456098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954730.1|456810_457011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014829909.1|457130_457862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038582704.1|458666_459575_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_115265596.1|459913_460942_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.0	5.0e-21
WP_115265552.1|461425_462286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954754.1|462459_463188_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_013954755.1|463357_464482_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_013954756.1|464492_467135_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	36.1	6.5e-65
WP_013954757.1|467127_467568_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_013954758.1|467557_468286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954759.1|468567_470703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954760.1|470877_471600_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	33.8	1.4e-06
WP_101456648.1|471804_473238_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954761.1|473582_474035_+	SocA family protein	NA	A0A0N9SGM1	Paenibacillus_phage	41.0	2.0e-22
WP_014829921.1|474634_474805_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013954765.1|475142_475994_+	DUF285 domain-containing protein	NA	NA	NA	NA	NA
WP_014829922.1|476212_476482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954995.1|476634_477879_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_014829924.1|478975_480337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038582722.1|480337_482347_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_013456441.1|482404_482671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954770.1|482663_483515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954771.1|483507_483732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954772.1|483751_484183_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_013954773.1|484195_484849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014829925.1|485076_486585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456404.1|487052_487358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101456648.1|488595_490029_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_101456648.1|493647_495081_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954780.1|495847_496435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954995.1|499180_500425_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_013954782.1|502638_503283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954995.1|503446_504691_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
>prophage 6
NZ_CP022596	Mycoplasma bovis strain NADC67 chromosome, complete genome	1113699	534791	575928	1113699	transposase,tRNA	Staphylococcus_phage(28.57%)	30	NA	NA
WP_013954804.1|534791_537131_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	33.7	2.6e-110
WP_172792936.1|537340_540340_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.0	6.8e-135
WP_038582744.1|540431_541157_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_013456007.1|541345_541852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115265554.1|542053_543046_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.6	1.1e-36
WP_013954995.1|543071_544316_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_101456648.1|544626_546060_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013456419.1|546366_547278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456542.1|547413_547827_-	ATP synthase F1 subunit epsilon	NA	NA	NA	NA	NA
WP_013456276.1|547842_549306_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_013456581.1|549358_550222_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_115265555.1|550214_551801_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_013954808.1|551793_552354_-	ATP synthase F1 subunit delta	NA	NA	NA	NA	NA
WP_013954809.1|552356_552929_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_013456149.1|552933_553161_-	ATP synthase F0 subunit C	NA	NA	NA	NA	NA
WP_013456258.1|553176_553995_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_013954811.1|554632_556306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954812.1|556568_557372_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_078086173.1|557846_558875_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	32.9	1.1e-20
WP_014829937.1|559126_559828_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_014829938.1|560439_560880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954815.1|560872_562621_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.9e-101
WP_014829939.1|562628_563624_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013954817.1|563740_564496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954818.1|564676_566113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014829940.1|566146_566458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078086174.1|566528_568130_-|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_078086175.1|568603_569632_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.8	3.8e-21
WP_078086176.1|572340_573969_+|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_013456029.1|574515_575928_-|transposase	IS1634-like element ISMbov2 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP022596	Mycoplasma bovis strain NADC67 chromosome, complete genome	1113699	837930	870288	1113699	integrase,transposase,tRNA	Staphylococcus_phage(25.0%)	21	837397:837422	843287:843312
837397:837422	attL	GGAATTTACTAACGCTTGAGAACAGG	NA	NA	NA	NA
WP_075270949.1|837930_838851_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	48.3	1.6e-79
WP_013954950.1|838896_842094_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_115265574.1|842102_843350_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
843287:843312	attR	CCTGTTCTCAAGCGTTAGTAAATTCC	NA	NA	NA	NA
WP_013954952.1|843354_846033_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	39.6	7.0e-91
WP_115265575.1|846536_847856_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_115265576.1|847858_849103_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_115265601.1|849401_850142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954954.1|850198_850687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954957.1|851965_852520_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_013954958.1|852528_854463_-	peptidase S41	NA	NA	NA	NA	NA
WP_115265577.1|854626_856531_-	peptidase S41	NA	NA	NA	NA	NA
WP_075271178.1|856818_858210_+|tRNA	glutamate--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	25.2	6.6e-08
WP_013456580.1|858200_858602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456621.1|858864_860013_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	52.4	3.8e-102
WP_115265578.1|860229_861195_-	YwaF family protein	NA	NA	NA	NA	NA
WP_013456411.1|861211_862570_-	signal recognition particle protein	NA	D6PHS7	uncultured_phage	29.0	8.7e-05
WP_013456099.1|862588_863413_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013456213.1|863484_863724_-	hypothetical protein	NA	A0A172JI00	Bacillus_phage	40.9	4.6e-10
WP_013954995.1|864032_865277_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_101456648.1|867176_868610_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954660.1|868899_870288_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP022596	Mycoplasma bovis strain NADC67 chromosome, complete genome	1113699	876792	961000	1113699	transposase,tRNA	Enterobacteria_phage(22.22%)	53	NA	NA
WP_078086174.1|876792_878394_-|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_013456433.1|879061_880423_-	peptidase M17	NA	Q6GYZ8	Mycoplasma_phage	56.4	3.1e-103
WP_075271003.1|880533_881766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078086167.1|881950_883552_-|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_075271003.1|884715_885948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954974.1|886003_888046_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_013456179.1|888211_890305_-	elongation factor G	NA	A0A1B0RXH7	Streptococcus_phage	25.2	1.8e-54
WP_013456121.1|890334_890805_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_004024001.1|890835_891249_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_013954975.1|891569_892787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115265579.1|892824_894438_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.8	1.4e-54
WP_041309168.1|894543_894744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041309169.1|894863_895595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954981.1|895603_895762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456337.1|896212_897067_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013456540.1|897550_898939_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954983.1|899373_901206_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.3	3.4e-28
WP_038582898.1|901216_903001_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.3	1.0e-29
WP_013954985.1|903224_904694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456163.1|904952_905198_-	YneF family protein	NA	NA	NA	NA	NA
WP_013954986.1|905223_906312_-	M42 family peptidase	NA	NA	NA	NA	NA
WP_014829974.1|906414_907659_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	26.6	6.9e-09
WP_075271052.1|907703_915701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954989.1|915856_920293_-	DNA-directed RNA polymerase subunit beta'	NA	A0A076FGB9	Aureococcus_anophage	23.5	3.2e-48
WP_115265580.1|920285_923921_-	DNA-directed RNA polymerase subunit beta	NA	W8W1V4	Invertebrate_iridescent_virus	26.9	2.0e-48
WP_013456028.1|924372_925017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004024017.1|925151_925523_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_172792937.1|925549_926044_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_013456027.1|926535_927261_+	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_013456485.1|927272_928742_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	36.9	4.0e-80
WP_013954990.1|928895_929786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954991.1|929830_931990_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013954992.1|932136_934305_+	AAA family ATPase	NA	K4FB40	Cronobacter_phage	34.4	1.1e-107
WP_013954995.1|935547_936792_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_115265581.1|937815_938544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954691.1|938599_939844_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	5.3e-09
WP_013954660.1|940997_942386_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954995.1|943947_945192_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_075271022.1|945433_945679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271144.1|945650_947366_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_075271020.1|947469_947922_+	SocA family protein	NA	A0A0N9SGM1	Paenibacillus_phage	44.3	1.2e-22
WP_078086178.1|948255_949284_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.8	3.8e-21
WP_075271147.1|949739_951320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271018.1|951444_952707_-	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_075271017.1|952921_953275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075271005.1|954971_956108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173022444.1|956242_956407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954997.1|956528_957626_+	DNA adenine methylase	NA	M1HGA9	Paramecium_bursaria_Chlorella_virus	31.6	6.5e-27
WP_014829976.1|957607_958549_+	DNA adenine methylase	NA	A0A1W6JN66	Lactococcus_phage	39.9	6.5e-52
WP_013954999.1|958687_958978_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_013456497.1|958981_959665_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_013456054.1|959654_960005_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_013955000.1|960160_961000_-|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	23.7	9.1e-05
>prophage 9
NZ_CP022596	Mycoplasma bovis strain NADC67 chromosome, complete genome	1113699	1043603	1095458	1113699	integrase,transposase,tRNA	Staphylococcus_phage(25.0%)	44	1043270:1043321	1070862:1070913
1043270:1043321	attL	ATATTCATTAACAAAGCAAAAAGCACCACAAGTTAACTTGCGGCGCTTTTTG	NA	NA	NA	NA
WP_078086180.1|1043603_1044632_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_115265587.1|1044842_1045850_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_173022446.1|1046395_1047361_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_115265588.1|1047527_1047908_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_115265590.1|1049366_1050074_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_115265591.1|1050777_1051461_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_099620147.1|1052873_1053965_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013456123.1|1054250_1055000_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_013955063.1|1055398_1057243_+	ribonuclease J	NA	NA	NA	NA	NA
WP_013955064.1|1057377_1058529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014829996.1|1058718_1061136_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_013955066.1|1061153_1061462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075271049.1|1061759_1063181_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_013955068.1|1063173_1064487_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_013955069.1|1064486_1064792_-|tRNA	glutamyl-tRNA(Gln) amidotransferase	tRNA	NA	NA	NA	NA
WP_013955070.1|1064797_1065652_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_013456616.1|1065663_1066242_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	29.7	1.2e-11
WP_013955071.1|1066231_1066993_-	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_013456430.1|1066985_1067726_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_013456524.1|1067735_1068050_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_013456382.1|1068223_1069534_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_013456261.1|1069536_1070202_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_014829997.1|1070272_1070734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013955073.1|1071021_1072155_-	DnaJ domain-containing protein	NA	A0A1V0SBY2	Catovirus	32.2	3.0e-27
1070862:1070913	attR	ATATTCATTAACAAAGCAAAAAGCACCACAAGTTAACTTGCGGCGCTTTTTG	NA	NA	NA	NA
WP_013955074.1|1072392_1072734_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_013955075.1|1072907_1074143_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	33.2	3.3e-59
WP_013955076.1|1074153_1074756_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_013456246.1|1074817_1075720_+	DegV family protein	NA	NA	NA	NA	NA
WP_014829999.1|1075880_1076114_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_013955078.1|1076153_1076876_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_115265592.1|1076875_1077952_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_013955080.1|1078077_1078650_-	Fic family protein	NA	NA	NA	NA	NA
WP_013955081.1|1078671_1080093_-	YitT family protein	NA	NA	NA	NA	NA
WP_013954660.1|1081547_1082936_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013955084.1|1083250_1085218_+	type IIA DNA topoisomerase subunit B	NA	G3M9Z3	Bacillus_virus	41.5	8.7e-131
WP_013955085.1|1085340_1085655_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	39.0	1.7e-12
WP_013955086.1|1085707_1086154_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	37.4	1.8e-12
WP_013954660.1|1086643_1088032_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_078086167.1|1089126_1090728_+|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_115265593.1|1091032_1092022_-	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_041309194.1|1092141_1092348_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_115265606.1|1092484_1093444_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013955092.1|1093639_1094035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013955093.1|1094213_1095458_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.3	1.1e-09
